Method for improving Lepidoptera pest resistance of plant mediated RNAi and application

Abstract

The invention relates to the technical field of biology, in particular to a method for improving lepidoptera pest resistance of plant mediated RNAi and application. A CDS sequence of a pest target gene and a coding sequence of hpRNA targeting the target gene are constructed into the same expression vector and then integrated into a plant nuclear genome, so that full-length mRNA of the target gene and the hpRNA of the target gene are synchronously expressed at the same position and the same time of a plant cell, the generation of siRNA and the existence of mRNA are ensured to have space-time overlap, and the target gene is obtained. The siRNA product is more efficiently combined with the mRNA template, and the stability and the degradation resistance of the siRNA are improved. According to the present invention, the cascade effect of RNAi amplification is generated, and the generation of the secondary siRNA further enhances the RNAi efficiency and significantly increases the accumulation amount of the siRNA, such that the body weight of the pest feeding the transgenic plant is significantly reduced, and the death rate is further increased so as to improve the pest resistance level of the plant, and the broad application prospect in the improvement of the pest resistance character of the crop is provided.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method and application for improving plant-mediated RNAi resistance to lepidopteran pests. Background Art

[0002] RNA interference (RNAi), a conserved gene expression regulation mechanism in eukaryotes, plays a central role in antiviral resistance and maintaining genomic stability through sequence-specific mRNA degradation mediated by small interfering RNA (siRNA). Plant-mediated RNAi insecticide strategies utilize transgenic technology to cause plants to express double-stranded RNA (dsRNA) of pest target genes. After ingestion by pests, the dsRNA enters their bodies and is cleaved by the Dicer enzyme to produce siRNA, which in turn induces target gene silencing. This strategy is both highly effective and environmentally friendly, providing an innovative solution for crop protection.

[0003] Existing research indicates that the location of dsRNA expression within plant cells significantly influences its insecticide efficacy: dsRNA expressed via nuclear transformation systems can be processed into modified siRNAs by the plant's own RNAi pathway, whereas plastid transformation systems, lacking eukaryotic processing machinery, produce only unmodified dsRNAs. Modified siRNAs are resistant to nuclease degradation, allowing them to remain stable in the insect gut and activate RNAi pathways, a key mechanism underlying the insecticide activity of nuclear-transformed plants. However, lepidopteran pests are generally less sensitive to RNAi, primarily due to factors such as the secretion of dsRNases in the insect midgut, which leads to rapid degradation of dsRNA; inefficient cellular uptake of dsRNA; and the lack of systemic RNAi signal amplification mechanisms.

[0004] Transitive silencing occurs in plant cells, whereby an initial siRNA is synthesized into a secondary dsRNA using the target mRNA as a template by RNA-dependent RNA polymerase (RdRP). Dicer cleaves the secondary siRNA, creating a cascade effect. This mechanism significantly enhances RNAi efficiency, but its application is limited by the stability of siRNAs in plant-pest interactions and the effectiveness of the initial triggering molecules. There is an urgent need to develop methods to increase siRNA accumulation, enhance its stability, and slow its degradation in pests. Summary of the Invention

[0005] In view of this, the present invention provides a method and application for improving plant-mediated RNAi resistance to lepidopteran pests.

[0006] The technical solution of the present invention is achieved as follows:

[0007] In a first aspect, the present invention provides a method for improving the application of plant-mediated RNAi in the fight against lepidopteran pests, wherein the CDS sequence of the pest target gene and the coding sequence of hpRNA (hairpin RNA) targeting the target gene are constructed into the same expression vector, which is then integrated into the plant cell nuclear genome, so that the full-length mRNA of the target gene and the hpRNA of the target gene are synchronously expressed at the same position and at the same time in the plant cell, thereby improving the efficiency of plant-mediated RNAi against lepidopteran pests.

[0008] In some specific embodiments, the target gene is the Helicoverpa armigera HaATPaseH gene, the CDS sequence of which is shown in SEQ ID NO: 2, and the coding sequence of the hpRNA is shown in SEQ ID NO: 1.

[0009] In some specific embodiments, the plant is tobacco.

[0010] In some specific embodiments, the application of the co-expression system of the pest target gene mRNA and the targeted hpRNA in plant insect resistance further comprises the following steps:

[0011] S1. The CDS sequence of the target gene and the plant expression vector are digested and ligated separately. After verification of successful ligation, the coding sequence of the hpRNA is ligated into the expression vector by homologous recombination. The product is transformed into DH5α competent cells. After resistance screening and sequencing verification, a co-expression recombinant vector is obtained.

[0012] S2. Introducing the co-expression recombinant vector into plant cells by gene gun method, electric shock method, microinjection method or Agrobacterium-mediated method.

[0013] In some specific embodiments, the plant expression vector is pCB301.

[0014] In a second aspect, the present invention provides a method for improving plant-mediated RNAi resistance to lepidopteran pests, wherein the CDS sequence of the pest target gene and the coding sequence of the hpRNA targeting the target gene are constructed into the same expression vector, which is then integrated into the plant cell nuclear genome, so that the full-length mRNA of the target gene and the hpRNA of the target gene are synchronously expressed at the same position and at the same time in the plant cell.

[0015] Based on the above technical solution, the present invention constructs the hpRNA of a key gene of a target pest and the CDS sequence of the target gene onto the same vector, which is then integrated into the plant genome through nuclear transformation. This allows the hpRNA of the target gene and the full-length mRNA of the target gene to be expressed synchronously at the same location and time within the plant cell. The siRNA of the target gene obtained through the above-mentioned solution of the present invention interacts with another product—the mRNA of the target gene. Using the mRNA as a template and itself as a primer, the siRNA is amplified by the plant RdRP to produce new hpRNA, which is further cleaved by the Dicer enzyme to produce secondary siRNA, which accumulates in large quantities.

[0016] In a specific embodiment of the present invention, the resistance of transgenic plants to pests is detected by bioassays such as feeding experiments. At the same time, the accumulation level of target gene siRNA in the transgenic plants is detected by methods such as Northern Blot analysis of siRNA, and the expression level of the target gene in the pest after interference is detected by means of fluorescent quantitative PCR. The results show that the hpRNA of the key gene of the target pest and the full-length CDS sequence of the target gene are integrated into the same position of the plant genome, and the expression of the two is consistent in time and space, which can enable the siRNA product to bind to the mRNA template more efficiently and greatly improve the stability and degradation resistance of the siRNA, thereby having a stronger RNAi effect on lepidopteran pests such as cotton bollworm.

[0017] The beneficial effects of the present invention include at least the following:

[0018] The present invention significantly enhances RNAi efficiency by synchronously expressing mRNA and hpRNA of key genes of target pests: the CDS sequence of the target gene is expressed in full-length mRNA in plant cells, serving as a template for RNAi. The hairpin-structured hpRNA is cleaved into siRNA by the Dicer enzyme, triggering RNA interference. Both are expressed in the same cellular location, the nucleus, and within the same time window, ensuring efficient binding of siRNA to the target mRNA. The initially expressed hpRNA is cleaved into siRNA and integrated into the RISC complex. Using mRNA as a template, siRNA synthesizes new dsRNA under the action of RNA-dependent RdRP, which is further cleaved into secondary siRNA by the Dicer enzyme, further generating an amplified cascade effect. The generation of secondary siRNA further enhances RNAi efficiency and significantly increases the accumulation of siRNA, resulting in a significant decrease in the weight of pests feeding on transgenic plants and a further increase in mortality, thereby improving the insect resistance of the plants.

[0019] In plant cells, synchronously expressed mRNA can reduce the probability of nuclease contact with siRNA, while co-localized expression in the nucleus promotes rapid integration of siRNA into the RISC complex. This dual mechanism synergistically reduces the risk of degradation. At the same time, after the siRNA accumulated in the plant enters the pest intestine through feeding, its structural stability enables it to resist degradation by dsRNase in the intestine, effectively activating the pest RNAi pathway. In addition, the traditional hpRNA method is not effective in lepidopteran pests, mainly because the highly active dsRNase in the pest midgut degrades dsRNA. The present invention utilizes RdRP in plant cells to synthesize new dsRNA using mRNA as a template, bypassing the dsRNase in the pest intestine. The generation of secondary siRNA further enhances the efficiency of RNAi, and even if the initial dsRNA is partially degraded, sufficient siRNA levels can still be maintained.

[0020] The present invention has good broad-spectrum applicability, is not restricted by host plants and target pest species, is more practical, can be completed with a single transgenic operation, and has broad application prospects in improving crop insect-resistant traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0022] Figure 1 The weight test results of cotton bollworms after feeding on different transgenic tobacco plants in the examples are shown; Figure 1 A is the weight change of cotton bollworm larvae after feeding on detached leaves for 3 days (mean ± SEM, n = 25); Figure 1 B shows the weight changes of cotton bollworm larvae after 5 days of feeding on detached leaves (mean ± SEM, n = 25); different letters (a, b, c) in the figure are based on the results of analysis of variance (ANOVA), and a, b, c indicate significant differences among the groups (P < 0.05);

[0023] Figure 2 The figure shows the changes in the survival rate of cotton bollworm larvae after feeding them with detached leaves in the example (mean ± SEM, n = 25); different letters (a, b) in the figure are based on the results of analysis of variance (ANOVA), and different letters indicate significant differences between groups (P < 0.05);

[0024] Figure 3 The results of the siRNA accumulation test in different transgenic tobacco tissues in the examples are shown; Figure 3A shows the probe design for detecting siRNA expression: Probe 1 (blue) targets hpHaATPaseH, and probe 2 (orange) targets a sequence approximately 300 bp downstream of the target sequence (this sequence is the specific recognition vector sequence transferred into Nt-ZH11); Figure 3 B is the gel electrophoresis image of the detection of siRNA expression corresponding to probe 1;

[0025] Figure 3 C is Figure 3 B Detection of gray value statistics corresponding to siRNA expression; Figure 3 D is the gel electrophoresis image of the detection of siRNA expression corresponding to probe 2; Figure 3 E is Figure 3 D shows the grayscale value statistics corresponding to the siRNA expression level. The black part is the gel electrophoresis diagram of the extracted RNA, which is used to indicate that the total RNA amount of the siRNA tested is the same. The RNA loading amount in each lane is 30 μg. The white part reflects the amount of siRNA.

[0026] Figure 4 The results of detecting the expression of target genes after cotton bollworms fed on different transgenic tobacco plants in the embodiment are shown in FIG. Figure 4 A shows the changes in the relative expression of HaATPaseH in larvae of cotton bollworms after feeding them with detached leaves for 2 days (mean ± SEM, n = 24); Figure 4 B shows the changes in the relative expression of HaATPaseH in larvae of cotton bollworm after 4 days of feeding with detached leaves (mean ± SEM, n = 24); different letters (a, b, c) in the figure are based on the results of analysis of variance (ANOVA), and different letters indicate significant differences among groups (P < 0.05). DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions in the present invention will be described clearly and completely below. Obviously, the embodiments described are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. The experimental methods in the following examples where detailed conditions are not specified are generally carried out according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The experimental materials used in the examples of the present invention can be obtained from commercial channels unless otherwise specified. The experimental methods in the following examples, unless otherwise specified, are all conventional methods. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels.

[0028] Table 1 Sequence information

[0029]

[0030]

[0031] Example

[0032] 1. Construction of a co-expression recombinant vector for target gene and hpRNA

[0033] (1) Target gene CDS amplification and enzyme cleavage site introduction

[0034] The target gene CDS (SEQ ID NO: 2) was amplified using high-fidelity Taq enzyme (purchased from TakaraBio Biotechnology (Beijing) Co., Ltd.). Kpn I and Spe I restriction sites were designed into the upstream and downstream primers. The reaction system consisted of 25 μL Taq enzyme, 20 μL H₂O, 2 μL each of the upstream and downstream primers, and 1 μL of cotton bollworm cDNA. Reaction conditions were: 95°C for 2 min, 95°C for 5 s, 55°C for 5 s, 72°C for 10 s (34 cycles), and 72°C for 10 min. The specific primer sequences are as follows:

[0035] Upstream F primer: TCGGTACCCGGGGATGAAAATGTTAGTC (SEQ ID NO: 5)

[0036] Downstream R primer: TCACTAGTTTAGGCCTTAGCGCCGACAA (SEQ ID NO: 6)

[0037] (2) Overlapping PCR amplification of hpRNA and introduction of homologous recombination arms

[0038] The hpRNA fragment (SEQ ID NO: 1) was amplified by overlapping PCR. Homologous recombination arms identical to those in the pCB301 vector (purchased from Newpro Biotech) were added to the 5' ends of the upstream and downstream primers. A 30 μL reaction system consisted of 25 μL Taq enzyme, 20 μL H₂O, 2 μL each of the upstream and downstream primers, and 1 μL of cotton bollworm cDNA. Reaction conditions: 95°C for 2 minutes, 95°C for 5 seconds, 55°C for 5 seconds, 72°C for 10 seconds (34 cycles), and 72°C for 10 minutes. The specific primer sequences are as follows:

[0039] Upstream F primer: GGATCTTCCAGAGATCCCTCGAGGCCCGACAGGAACCCAGAAA (SEQ ID NO: 7)

[0040] Downstream R primer: CTGCCGTTCGACGATGCTCTAGAGCCCGACAGGAACCCAGAAA (SEQ ID NO: 8)

[0041] (3) Linearization of vectors, ligation, and homologous recombination

[0042] Double-digest pCB301 with restriction enzymes Kpn I and Spe I to obtain linearized vector. Reaction system: 1 μL each of Kpn I and Spe I, 5 μL buffer, 10 μL pCB301 vector, 33 μL HO. Reaction conditions: Incubate at 37°C for 30 min.

[0043] Ligate the target gene CDS after digestion with linearized pCB301 using T4 DNA ligase. Reaction conditions: Incubate at 16°C for 2 hours.

[0044] The hpRNA fragment was homologously recombined with the linearized vector pCB301 using homologous recombination enzyme (purchased from Nanjing Novozymes Biotech Co., Ltd.) to integrate the constructed hpRNA fragment into the pCB301 vector. The reaction system consisted of 10 μL of homologous recombination enzyme, 5 μL of linearized pCB301 vector, 10 μL of hpRNA fragment, and 25 μL of HO. Reaction conditions: Incubate at 37°C for 30 minutes, then immediately cool on ice.

[0045] (4) Transformation screening and sequencing verification

[0046] The constructed vector was transformed into competent Escherichia coli DH5a (purchased from Sangon Biotech (Shanghai) Co., Ltd., transformation parameters: ice bath for 30 minutes, heat shock at 42°C for 40 seconds, shaking at 37°C at 200 rpm for 60 minutes, and then 200 μL of the bacterial solution was evenly spread on a plate). Positive transformants were screened on LB plates with 100 μg / mL kanamycin. Single colonies were picked and cultured overnight to extract plasmids, which were then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing verification to obtain a co-expression recombinant vector (with target gene hpRNA and the full-length CDS sequence of the target gene). In the present invention, vector and plasmid have the same meaning.

[0047] 2. Agrobacterium-mediated gene transformation

[0048] Using Agrobacterium-mediated transgenic technology, a double recombinant plasmid carrying the target gene hpRNA and the full-length CDS sequence of the target gene is introduced into the plant cell nuclear genome. The specific operation is as follows:

[0049] (1) Using Agrobacterium GV3101 competent cells (purchased from Sangon Biotech (Shanghai) Co., Ltd.), freeze and thaw on ice for about 30 minutes, add 10 μL of the recombinant plasmid; ice bath for 5 minutes, quick freeze in liquid nitrogen for 5 minutes, heat shock at 37°C water bath for 5 minutes, add 1 mL of YEB liquid medium without any antibiotics, and shake on a shaker at 28°C at 100-150 rpm for about 2 hours. Then centrifuge at 5000 rpm for 4 minutes, remove a portion of the supernatant, resuspend the remaining portion, apply 200 μL on a YEB plate (50 mg / L Kan + 50 mg / L R-Lif), and culture at 28°C for 24-48 hours until a single colony grows. Pick a single colony for PCR identification to obtain a positive colony.

[0050] YEB liquid culture medium was purchased from Beijing Coolbo Technology Co., Ltd. 50 mg / L Kan and 50 mg / L Rif were added to prepare YEB plates.

[0051] (2) Pick a positive single colony that has been identified and place it in 10 mL YEB liquid culture medium (50 mg / L Kan + 50 mg / L R-Lif). Cultivate at 28°C and 180 rpm for about 18 h until the OD 600 =0.6-0.8. Add 200 μL of the bacterial solution from the previous step to 50 mL of YEB liquid culture medium (with Kan and Rif antibiotics at 50 mg / L concentration) and culture for about 6 h until OD 600 = between 0.2 and 0.5. Centrifuge at 4°C, 2500 rpm for 7 min in a refrigerated centrifuge to collect the cells, resuspend them in 40 mL of MS liquid culture medium, and place them on a plate for later use.

[0052] The MS liquid culture medium was re-formulated as follows: 4.4 g / L MS powder, 30 g / L sucrose, adjusted to pH 5.8, sterilized at 121°C and autoclaved for 20 minutes, and then cooled for use.

[0053] (3) Select tobacco strains that have been cultured for 20 days. Take 2-3 tender leaves from the top of each strain, cut them into 0.5×0.5 cm pieces and make 1-2 wounds. Soak them in the bacterial solution for 10 minutes. Take out the leaves and place them on filter paper to absorb the water. Then stick them on RMOP culture medium and culture them in the dark at 28℃ for 2 days. Place the leaves on the selective culture medium and culture them under light in the tissue culture room until the adventitious buds grow to 1 cm (about one month). Then place them in the rooting medium for subsequent molecular identification. After 2 weeks, transplant the rooted plants into the soil for greenhouse culture and subsequent experiments.

[0054] RMOP medium is formulated as follows: 4.4 g / L MS powder, 30 g / L sucrose, and 2.75 g / L agar. Adjust the pH to 5.8 and autoclave at 121°C for 20 minutes before adding 1 mg 6-BA and 0.1 mg NAA. The selection medium is RMOP medium supplemented with 100 mg / L Kan. The rooting medium is RMOP medium minus 6-BA.

[0055] 3. This application adopts the above-mentioned nuclear transformation method to construct the hpRNA of the target gene and the CDS sequence of the target gene into the same vector, and then integrates it into the plant genome through nuclear transformation; constructs In the same location in plant cells Spatiotemporal synchronous expression of hpHaATPaseH (hpRNA of target gene) and full-length CDS sequence of HaATPaseH (target gene) Tobacco strains: Nt-ZH11#1, Nt-ZH11#4, Nt-ZH11#6, and Nt-ZH11#11 ; The expression of the target gene's hpRNA and the full-length CDS sequence of the target gene is synchronized in time and space (hereinafter referred to as "spatiotemporal synchronous co-expression of hpRNA and CDS"). A tobacco strain, Nt-SJ17#11, expressing only hpHaATPaseH was constructed, and super-transformed mRNA was introduced based on this. The CDS sequence of HaATPaseH was introduced through secondary transformation, ultimately resulting in tobacco strains Nt-SJ17-ZH9#3 and Nt-SJ17-ZH9#8 (super-transformed strains) expressing HaATPaseH in different locations and at different times as controls. The specific method is as follows: The tobacco strains Nt-SJ17#11 expressing only hpHaATPaseH, as well as Nt-SJ17-ZH9#3 and Nt-SJ17-ZH9#8 (super-transformed strains), were transformed using the same method as described in steps 1-2 above. The transgenic tobacco donor strain, Nt-wt, was also used as a control.

[0056] 4. Transgenic tobacco insect resistance test

[0057] Taking tobacco and cotton bollworm as research objects, the specific operations are as follows:

[0058] (1) Hatch cotton bollworms in an artificial climate chamber at 28°C, transfer newly hatched larvae to artificial feed for culture, and select cotton bollworm larvae at the end of the first instar for testing.

[0059] (2) The tobacco seeds used in the experiment were sterilized and sown on MS plates. Two weeks later, the seedlings were selected and transplanted into greenhouse soil. After growing for another two weeks, bioassays were performed.

[0060] (3) Take leaves of the same growth and place them in a breeding box. Pick the first-instar larvae onto the leaves and place them in a breeding box and a 28°C artificial climate chamber. Replace the leaves with fresh ones every day and record the weight of the bollworms. Check the growth of the bollworms regularly and take photos to record them.

[0061] By comparing and analyzing the changes in weight and survival rate of cotton bollworms feeding on tobacco transformed with spatiotemporally synchronous co-expression of hpRNA and CDS and other control groups, it was determined whether there was a significant difference in the inhibitory effect of the transgenic strategy on the pest.

[0062] Weight suppression results such as Figure 1 As shown, the lines (Nt-ZH11#6, #11) that spatiotemporally co-expressed hpRNA and CDS significantly inhibited the body weight of cotton bollworm larvae. Among them, after feeding cotton bollworms with detached leaves for 3 days, the body weight of cotton bollworms in the Nt-ZH11#6 or Nt-ZH11#11 group (mean±SEM, n=25) decreased by 83.9% relative to the Nt-wt group; decreased by 58.3% relative to the Nt-SJ17#11 group, and decreased by 46.5% compared to Nt-SJ17-ZH9#3 or 9#8; after feeding cotton bollworms with detached leaves for 5 days, the body weight of cotton bollworms in the Nt-ZH11#6 or Nt-ZH11#11 group (mean±SEM, n=25) decreased by 66.5% relative to the Nt-wt group; decreased by 49.1% relative to the Nt-SJ17#11 group, and decreased by 44.7% compared to Nt-SJ17-ZH9#3 or 9#8.

[0063] The survival rate statistics are as follows Figure 2 As shown, strains (Nt-ZH11#6 and #11) that spatiotemporally co-expressed hpRNA and CDS significantly reduced the survival rate of cotton bollworm larvae. Three days after feeding cotton bollworms with detached leaves, the survival rate of cotton bollworms in the Nt-ZH11#6 or Nt-ZH11#11 groups decreased by nearly 43% compared to the Nt-wt group, by 38% compared to the Nt-SJ17#11 group, and by 37% compared to Nt-SJ17-ZH9#3 or 9#8.

[0064] 5. Detection of target gene siRNA accumulation in transgenic tobacco

[0065] Design specific probes (such as Figure 3 A) Analyze the accumulation of siRNA in transgenic plants by Northern blot and compare the siRNA expression level with that in transgenic plants expressing only target gene hpRNA. The probes include the following:

[0066] Probe 1 (targeting hpHaATPaseH):

[0067] TTCAGTGGCTGGTTGAGATGCCCGACAGGAACCCAGAAACCTGTGCTGAGGTGTTCATGAACTTGCTGACCCACATCAGCAAGGACCACACCATCCAGTACTTGCTGGTCCTGATTGATGACATCCTTTCTGAAGACAAAAGCAGGGTGAAGATCTTCCGTGAGGCGAGGTCTCTGGGCAACCCGTGGCAGCCATTCCTCAACCTGCTGAACCGTCAGGATGAGTTTGTCCAGCACATGACTGCGCGCATCATCGCCAAGCTGGCTTGCTGGCACCCACACCTGATGGAGAAGAGTGACCTCCACTTCTACCTCTCCTGGCTCAAGGACCAACTGAAAATGAACAACAATGACTACATTCAATCGGTGGCTCGTTGCCTGCAAATGATGCTGCGCCCTATAGTGAGTCGTATTATT(SEQ ID NO:3)

[0068] Probe 2 (targeting a non-interfering region approximately 300 bp downstream of the target sequence):

[0069] GGCATCTCCACCCTGCTGTCTATCCTGGCCTCCAGGGTCAACTTCCAGGTGCAATACCAGCTGGTGTTCTGCCTGTGGGTGCTGACCTTCAACCCGCTGTTAGCCGAGAAGATGAACAAGTTCAACGCCATCCCCATCCTGGCTGACATCCTCAGCGACTCCGTGAAGGAGAAGGTCACTCGTATTGTGCTTGCTGTCTTCAGGAACCTGATTGAGAAGCCTGAAGATCATCAGGTGGCCAAAGAACACTGCATTGCCATGGTGCAGTGCAAGGTCCTGAAACAGCTTTCCATCTTGGAGCAGAAGCGTTCTGATGATGAGGACATTATGAACGATGTGGACTTCCTTAACGAACGCCTGCAGACCTCCGTGC(SEQ ID NO:4)

[0070] The specific steps of Northern blot analysis are as follows:

[0071] (1) Preparation of electrophoresis samples: The total RNA amount used in the experiment is 30 μg. Add an equal volume of RNA Loading Buffer to the RNA sample, make up to 20 μL with DEPC H2O, heat in a 95℃ metal bath for 5 min, and then quickly cool on ice for later use.

[0072] (2) Electrophoresis: Perform electrophoresis in 0.5×TBE electrophoresis buffer. First, use a voltage of 90 V to run the sample out of the well. Then, switch to a voltage of 120 V for about 2 hours (until bromophenol blue runs out of the polyacrylamide gel).

[0073] (3) Transfer: Cut off the bottom of the gel after electrophoresis to 3.5 cm, stain with 1 / 10,000 nucleic acid dye and take pictures, and then transfer the membrane on ice using electric current. The transfer device is arranged from bottom to top as follows: negative power supply - sponge - two pieces of wet filter paper of the same size as the gel - gel - NC membrane - two pieces of wet filter paper of the same size as the gel - sponge - positive power supply. After installing the device, transfer the membrane on ice at a voltage of 20V for 2 hours.

[0074] (4) Prehybridization and hybridization: After transfer, the RNA is fixed on the membrane by UV crosslinking. Then, prehybridize in a hybridization oven at 39.5°C for 2 hours, and then hybridize at 37°C for about 10 hours.

[0075] (5) Membrane washing: Prepare a washing solution consisting of 2× sodium citrate and 0.1% SDS. Rinse with the washing solution on a shaker at 75-85 rpm for 5 min, repeat three times. Then rinse in washing buffer (0.15 M sodium chloride, 0.1 M maleic acid, 0.3% Tween 20, adjusted to pH 7.5) for 5 min.

[0076] (6) Adding the probe: Add 20 mL of 1× Blocking Solution produced by Roche and block at 25°C for 1 h. Then add 1 μL of digoxigenin probe purchased from Roche and hybridize at 25°C for 30 min.

[0077] (7) Membrane washing and imaging: Rinse with wash buffer on a shaker at 75-85 rpm for 15 min, repeat three times. Soak in detection buffer for 3 min. Then soak the membrane in alkaline phosphatase substrate and wait for 30 min before imaging the membrane using a chemiluminescence imager.

[0078] The results of target gene siRNA accumulation in transgenic tobacco are as follows: Figure 3As shown, the accumulation of target gene siRNA in the strains (Nt-ZH11#6, #11) that spatiotemporally co-expressed hpRNA and CDS was significantly increased by 229% compared with the Nt-SJ17#11 group, and increased by 21% compared with Nt-SJ17-ZH9#3 or Nt-SJ17-ZH9#8, and siRNA accumulation was also detected outside the region corresponding to hpRNA, indicating that the strains that spatiotemporally co-expressed hpRNA and CDS also produced siRNA outside the target sequence, and the siRNA accumulation in the spatiotemporally co-expression system (Nt-ZH11#6, #11) was also increased by 31.8% compared with the super transformation system (Nt-SJ17-ZH9#3 or #8).

[0079] 6. Detection of target gene expression in pests feeding on transgenic tobacco

[0080] Taking transgenic tobacco and cotton bollworm as examples, the expression level of the target gene in the insect body was quantitatively detected by fluorescence quantitative PCR technology. The specific operation is as follows:

[0081] (1) Hatch cotton bollworms in an artificial climate chamber at 28°C, transfer newly hatched larvae to artificial feed for culture, and select cotton bollworm larvae at the end of the first instar for testing.

[0082] (2) The tobacco seeds used in the experiment were sterilized and sown on MS plates. Two weeks later, the seedlings were selected and transplanted into greenhouse soil. After growing for another two weeks, bioassays were performed.

[0083] (3) Leaves of the same growth were placed in a feeding box, and the first-instar larvae were picked onto the leaves. The leaves were placed in a feeding box and a 28°C artificial climate chamber. Fresh leaves were replaced every day, and total RNA was extracted regularly. The total RNA was detected by RT-qPCR kit (purchased from Qingke Company, trade name: TSINGKE TSE2012× The relative expression levels of target genes were detected using Master qPCR Mix (SYBR Green I, Catalog No.: TSE201).

[0084] By detecting the relative expression levels of target genes in pests after feeding on transgenic tobacco, we determined whether the RNAi efficiency of pest target genes was significantly improved in plants that spatiotemporally and synchronously co-expressed hpRNA and CDS compared to other control plants. Figure 4As shown, the expression of HaATPase H in cotton bollworms fed tobacco plants spatiotemporally co-expressing hpHaATPaseH and full-length HaATPaseH was significantly downregulated compared to those fed tobacco plants expressing only hpHaATPaseH. Compared to cotton bollworms fed wild-type tobacco, HaATPaseH gene expression in cotton bollworms fed tobacco plants spatiotemporally co-expressing hpRNA and CDS decreased by 79.1% and 82.6% after three and five days, respectively. Compared with feeding on plants expressing only hpRNA, HaATPase H gene expression in bollworms fed on plants spatiotemporally co-expressing hpRNA and CDS tobacco decreased by 39.6% and 63.1% after three and five days, respectively. Furthermore, compared with feeding on plants spatiotemporally co-expressing hpRNA and CDS tobacco, HaATPaseH gene expression in bollworms fed on plants spatiotemporally co-expressing hpRNA and CDS tobacco decreased by 32.5% and 34.8% after three and five days, respectively. These results indicate that spatiotemporally co-expressing hpHaATPaseH and full-length HaATPaseH can significantly enhance RNAi efficiency in insect pests.

[0085] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for improving plant-mediated RNAi for use in combating lepidopteran pests, characterized in that: The CDS sequence of the pest target gene and the coding sequence of the hpRNA targeting the target gene are constructed into the same expression vector and then integrated into the plant cell nuclear genome, so that the full-length mRNA of the target gene and the hpRNA of the target gene are synchronously expressed at the same location and at the same time in the plant cell, thereby improving the efficiency of plant-mediated RNAi against lepidopteran pests.

2. The use according to claim 1, characterized in that The target gene is the Helicoverpa armigera HaATPaseH gene, the CDS sequence of which is shown in SEQ ID NO: 2, and the coding sequence of the hpRNA is shown in SEQ ID NO:

1.

3. The use according to claim 1, characterized in that The plant is tobacco.

4. The use according to claim 1, characterized in that The following steps are also included: S1. The CDS sequence of the target gene and the plant expression vector are digested and ligated separately. After verification of successful ligation, the coding sequence of the hpRNA is ligated into the expression vector by homologous recombination. The product is transformed into DH5α competent cells. After resistance screening and sequencing verification, a co-expression recombinant vector is obtained. S2. Introducing the co-expression recombinant vector into plant cells by gene gun method, electric shock method, microinjection method or Agrobacterium-mediated method.

5. The use according to claim 4, characterized in that The plant expression vector is pCB301.

6. A method for improving plant-mediated RNAi against lepidopteran pests, characterized in that: The CDS sequence of the pest target gene and the coding sequence of the hpRNA targeting the target gene are constructed into the same expression vector, and then integrated into the plant cell nuclear genome, so that the full-length mRNA of the target gene and the hpRNA of the target gene are synchronously expressed at the same location and at the same time in the plant cell.

7. The method according to claim 6, characterized in that The target gene is the Helicoverpa armigera HaATPaseH gene, the CDS sequence of which is shown in SEQ ID NO: 2, and the coding sequence of the hpRNA is shown in SEQ ID NO:

1.

8. The method according to claim 6, characterized in that The plant is tobacco.

9. The method according to claim 6, characterized in that The following steps are also included: S1. The CDS sequence of the target gene and the plant expression vector are digested and ligated separately. After verification of successful ligation, the coding sequence of the hpRNA is ligated into the expression vector by homologous recombination. The product is transformed into DH5α competent cells. After resistance screening and sequencing verification, a co-expression recombinant vector is obtained. S2. Introducing the co-expression recombinant vector into plant cells by gene gun method, electric shock method, microinjection method or Agrobacterium-mediated method.

10. The method according to claim 9, characterized in that The plant expression vector is pCB301.

Images