Reagent for pretreatment of sample as subject to nucleic acid detection, and pretreatment method

By using EDTA and high-temperature heating treatment in environmental samples, combined with RT-PCR reagents, the problem of complex and time-consuming detection in existing technologies is solved, and efficient and accurate detection of nucleic acids in water samples is achieved.

CN120648780APending Publication Date: 2025-09-16YOKOGAWA ELECTRIC CORP
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510295119.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-03-15
Filing Date
2025-03-13
Publication Date
2025-09-16

AI Technical Summary

Technical Problem

Existing technologies for detecting nucleic acids in environmental samples are complex and time-consuming, especially in water samples such as sewage treatment water and rivers, which are easily affected by nucleases, making it difficult to achieve high-sensitivity and high-precision detection.

Method used

The method of mixing ethylenediaminetetraacetic acid (EDTA) with the sample and then heating it at high temperature is combined with nucleic acid detection reagents, especially reverse transcription polymerase chain reaction (RT-PCR) reagents, to simplify the pretreatment steps and inhibit the influence of nucleases.

Benefits of technology

It achieves high-sensitivity and high-precision detection of nucleic acids in environmental samples, especially viral nucleic acids in water samples, in a short time, simplifies the operation process and improves detection efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005309796080000151
    Figure BDA0005309796080000151
  • Figure BDA0005309796080000171
    Figure BDA0005309796080000171
  • Figure BDA0005309796080000181
    Figure BDA0005309796080000181
Patent Text Reader

Abstract

The present invention addresses the problem of more simply and accurately detecting a target nucleic acid contained in a sample, particularly a water sample in an environment such as sewage treatment water and a river. A sample to be detected of a nucleic acid is mixed with a pretreatment reagent containing EDTA, and the mixture is heated by a heating means at 90 DEG C or higher.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a pretreatment reagent and a pretreatment method for detecting a target nucleic acid from a sample containing nucleic acid. Background Art

[0002] As one of the pollution indicators of water environments such as rivers, the quantitative value of viruses in water is used. In particular, in recent years, reports have shown that the amount of viruses in sewage may serve as a leading indicator of the spread of infectious diseases, and is also used to determine the government's infectious disease control measures. The quantitative measurement of environmental viruses used to understand the pollution status of such rivers and water sources is mainly implemented using quantitative PCR. The pretreatment of the samples used here requires extraction and purification of viral nucleic acids, and in the case of RNA viruses, a reverse transcription process of RNA is required.

[0003] The nucleic acid pretreatment process requires a complex combination of reaction operations. Commercially available nucleic acid extraction kits are often used to simplify the extraction of viral nucleic acids from samples, but even these kits typically take approximately an hour. Environmental samples must be collected from multiple measurement points and measured continuously, necessitating a method that allows for the pretreatment of measurement samples to be performed as quickly and cost-effectively as possible using the simplest possible procedure.

[0004] Patent Document 1 discloses a method for amplifying and detecting nucleic acids from microorganisms in samples containing a large amount of impurities, such as contaminated food, by adding metal ions to the sample, thereby avoiding the influence of food components. Furthermore, Patent Document 2 discloses a method for simply and quickly extracting viral nucleic acids by heat-treating samples from an aquatic environment. Furthermore, Non-Patent Document 1 discloses that the addition of polyvinylpyrrolidone (PVPP) to samples containing a large amount of impurities improves the efficiency of nucleic acid amplification.

[0005] Prior art literature

[0006] Patent Literature

[0007] Patent Document 1: Japanese Patent Application Laid-Open No. 2008-72904

[0008] Patent Document 2: Japanese Patent Application Laid-Open No. 2012-157265

[0009] Non-patent literature

[0010] Non-patent document 1: M. Watanabe et al. Plant Biotechnology 33, 133-136 (2016) Summary of the Invention

[0011] Technical problem solved by the invention

[0012] The present invention aims to more easily and accurately detect target nucleic acids contained in samples, particularly water samples from sewage treatment water, rivers, and other environments. In particular, the present invention aims to detect nucleic acids under conditions that are less susceptible to the effects of nucleases contained in the sample.

[0013] Technical means to solve the problem

[0014] The present invention provides the following contents.

[0015] [1] A method for pre-treating a sample to be tested for nucleic acid, comprising:

[0016] i) a step of mixing the sample with a pretreatment reagent containing ethylenediaminetetraacetic acid (EDTA); and

[0017] ii) A step of heating the sample mixed in step i) by heating means at 90° C. or higher.

[0018] [2] The method according to [1], wherein

[0019] The sample is a water sample in the environment.

[0020] [3] The method according to [1] or [2], wherein

[0021] The nucleic acid is a viral nucleic acid.

[0022] [4] The method according to any one of [1] to [3], comprising:

[0023] A step of concentrating nucleic acids in a sample before step i).

[0024] [5] The method according to any one of [1] to [4], wherein

[0025] The concentration of EDTA in the sample mixed in step i) is 0.01 to 20 mM.

[0026] [6] The method according to [5], wherein

[0027] The concentration of EDTA in the sample mixed in step i) is 0.1 to 10 mM.

[0028] [7] The method according to any one of [1] to [6], wherein

[0029] The heating treatment time in step ii) is less than 120 seconds.

[0030] [8] The method according to any one of [1] to [7], wherein

[0031] The temperature of the heating means in the step ii) is 105° C. or higher and 160° C. or lower.

[0032] [9] A method for detecting nucleic acid in a sample, comprising:

[0033] a) a step of mixing a sample to be detected by nucleic acid with a pretreatment reagent containing EDTA;

[0034] b) heating the sample after step a) at 90° C. or above;

[0035] c) a step of mixing the sample after step b) with a nucleic acid detection reagent; and

[0036] d) a step of detecting nucleic acid in the sample after step c).

[0037]

[10] The method according to [9], wherein

[0038] The nucleic acid detection reagent is a reverse transcription polymerase chain reaction (RT-PCR) reagent.

[0039]

[11] The method according to [9] or

[10] , wherein

[0040] After step b), the time until step d) starts is less than 4 hours.

[0041]

[12] The method according to any one of [9] to

[11] , wherein

[0042] In the step c), the EDTA concentration in the mixed sample is 0.001 to 10 mM.

[0043]

[13] A reagent for pretreatment of a sample to be detected by nucleic acid, comprising EDT A.

[0044]

[14] The reagent according to

[13] , wherein

[0045] The concentration of EDTA is 0.01~20mM.

[0046]

[15] The reagent according to

[14] , wherein

[0047] The concentration of EDTA is 0.1~10mM.

[0048]

[16] The reagent according to any one of

[13] to

[15] , wherein

[0049] The sample is a water sample in the environment.

[0050]

[17] The reagent according to any one of

[13] to

[16] , wherein

[0051] The nucleic acid is a viral nucleic acid.

[0052]

[18] The reagent according to any one of

[13] to

[17] , further comprising a buffer.

[0053] Effects of the Invention

[0054] According to the reagent and method of the present invention, a target nucleic acid contained in a sample, particularly a water sample in an environment such as sewage water or a river, can be detected more simply and accurately. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] [ Figure 1 ] is a graph showing the relationship between the heating treatment time of the sample in Comparative Example 1 and the quantitative value of PMMoV.

[0056] [ Figure 2 ] is a graph showing the correlation between the standing time from the heat treatment to the reverse transcription reaction in Comparative Example 1 and the quantitative value of PMMoV.

[0057] [ Figure 3 ] is a graph showing the relationship between the heating treatment time of the sample in Comparative Example 2 and the quantitative value of PMMoV.

[0058] [ Figure 4 ] is a graph showing the relationship between the presence or absence of EDTA addition in Example 1, the standing conditions from heat treatment to reverse transcription reaction, and the quantitative value of PMMoV.

[0059] [ Figure 5 ] is a graph showing the relationship between the heat treatment conditions (95°C for 5 minutes or 140°C for 15 seconds) of Samples A to C in Example 2 and the quantitative values ​​of PMMoV. DETAILED DESCRIPTION

[0060] 1 Definition

[0061] In this specification, "pretreatment" refers to a process for making the nucleic acid in the sample suitable for amplification before the nucleic acid detection process (especially the nucleic acid amplification process) for the sample to be detected by nucleic acid. More specifically, it refers to a process for extracting nucleic acid from virus particles or cells. In this specification, the "quantitative value" of the virus refers to a numerical value corresponding to the number of viruses per given volume (e.g., 1 μL, 5 μL, etc.) in the sample, calculated based on the output value of a standard solution containing viral nucleic acid of a known concentration. In this specification, the term "reagent" includes both compounds consisting of a single component and compositions containing multiple components.

[0062] In this specification, the term "ethylenediaminetetraacetic acid (EDTA)" includes any form of the free acid, metal salt, or solvate. While any of these forms may be used, water-soluble metal salts, particularly metal salts in the form of disodium EDTA and dipotassium EDTA, are generally used. Furthermore, when preparing an aqueous solution of EDTA, solvates of these metal salts, particularly hydrates, may be used.

[0063] As used herein, the term "sample" for nucleic acid detection is not particularly limited as long as it is a sample that may contain nucleic acids. Examples include samples from environments such as rivers, sewage treatment water, activated sludge, and soil; samples related to quality control of foods, beverages, pharmaceuticals, and cosmetics; biological samples collected from animals and plants; and samples of microbial cultures. In particular, samples from environments that may contain unknown components that may inhibit nucleic acid amplification reactions are suitable.

[0064] In this specification, the term "nucleic acid" also includes all nucleic acids derived from viruses, bacteria, fungi and other eukaryotic cells. In the case of viral origin, as for nucleic acid, for example, it includes genomic DNA and genomic RNA, and can be in the form of single-stranded DNA, single-stranded RNA, double-stranded DNA, and double-stranded RNA. In the case of bacteria, fungi and other eukaryotic cells, nucleic acid can be in the form of genomic DNA, ribosomal RNA, messenger RNA, plasmid DNA, etc. As viruses, for example, plant-infecting viruses such as pepper mild mottle virus (PMMoV) detected from sewage as an indicator of environmental pollution, or viruses that infect humans such as rotavirus, adenovirus, norovirus, RS virus, human metapneumovirus, SARS-CoV-2, etc. can be cited.Examples of the bacteria include Acinetobacter, Actinomyces, Aerococcus, Aeromonas, Alcaligenes, Bacillus, Bacteroides, Bordetella, Branhamella, Brevibacterium, Campylobacter, Candida, Capnocytophaga, Chromobacterium, Clostridium, Corynebacterium, Cryptococcus, and Deinococcus. us, Enterococcus, Erysielothrix, Escherichia, Flavobacterium, Gemella, Haemophilus, Klebsiella, Lactobacillus, Lactococcus, Legionella, Leuconostoc, Listeria, Micrococcus, Mycobacterium, Neisseria, Cryptosporidium, Nocardia; Oersko The genus includes Pseudomonas, Rhodococcus, Rhodospirillium, Staphylococcus, Streptomyces, Streptococcus, Vibrio, and Yersinia.

[0065] In this specification, the "heating means" is not particularly limited as long as it can apply a temperature of 90°C or higher to the container wall, and examples thereof include a heating block including a Peltier element, an oil bath, and hot air.

[0066] In this manual, the method for " nucleic acid detection " is not particularly limited, and can be any of the known methods such as nucleic acid amplification method, Northern hybridization, Southern hybridization, DNA probe method. Particularly preferably, the nucleic acid amplification method that can carry out highly sensitive detection is used. In this manual, " nucleic acid amplification " is not particularly limited as long as it is a method for amplifying a given base sequence of a template nucleic acid as a detection object, and can use any methods such as PCR (Polymerase Chain Reaction) method, LAMP (Loop-Mediated Isothermal Amplification) method, SDA method (Strand Displacement Amplification) method. In the case where the nucleic acid as the detection object is RNA, preferably before nucleic acid amplification, reverse transcription reaction is included.

[0067] 2. Reagents for pretreatment of samples for nucleic acid detection

[0068] The first embodiment of the present invention is a reagent for pre-treating a sample to be subjected to nucleic acid detection. The reagent of this embodiment comprises ethylenediaminetetraacetic acid (EDTA). The reagent of this embodiment can avoid the influence of nucleases contained in the sample for a sample containing nucleic acid, thereby enabling high sensitivity and high precision detection in a subsequent nucleic acid detection.

[0069] The reagent of this embodiment is suitable for pre-treating water samples from the environment. Because it can avoid the effects of nucleases and other enzymes in the sample, it is particularly suitable for nucleic acid detection in samples from environments containing unknown components, particularly water samples from rivers, sewage treatment water, and other environments. By enabling high-sensitivity and high-precision nucleic acid detection in water samples from the environment, it is possible to assess the infectivity and contamination status of the aquatic environment. The reagent of this embodiment is preferably used to detect nucleic acids derived from viruses, bacteria, and other infectious sources, particularly nucleic acids derived from viruses.

[0070] The concentration of EDTA contained in the reagent of this embodiment is preferably 0.01 to 20 mM, particularly preferably 0.1 to 10 mM. The concentration of EDTA can be, for example, 0.2 mM or more, 0.3 mM or more, 0.4 mM or more, 0.5 mM or more, 0.6 mM or more, 0.7 mM or more, 0.8 mM or more, 0.9 mM or more, 1.0 mM or more, 1.1 mM or more, 1.2 mM or more, 1.3 mM or more, 1.4 mM or more, 1.5 mM or more, 1.6 mM or more, 1.7 mM or more, 1.8 mM or more, 1.9 mM or more, 2.0 mM or more, 2.1 mM or more, 2.2 mM or more, 2.3 mM or more, 2.4 mM or more, 2.5 mM or more, 3.0 mM or more, 3.5 mM or more, 4.0 mM or more, 4.5 mM or more, 5.0 mM or more, 6.0 mM or more, 7.0 mM or more, 8.0 mM or more, or 9.0 mM or more. The concentration of EDTA can be, for example, 9.5 mM or less, 9.0 mM or less, 8.5 mM or less, 8.0 mM or less, 7.5 mM or less, 7.0 mM or less, 6.9 mM or less, 6.8 mM or less, 6.7 mM or less, 6.6 mM or less, 6.5 mM or less, 6.4 mM or less, 6.3 mM or less, 6.2 mM or less, 6.1 mM or less, 6.0 mM or less, 5.9 mM or less, 5.8 mM or less, 5.7 mM or less, 5.6 mM or less, 5.5 mM or less, 5.4 mM or less, 5.3 mM or less, 5.2 mM or less, 5.1 mM or less, 5.0 mM or less, 4.9 mM or less, 4.8 mM or less, 4.7 mM or less, 4.6 mM or less, 4.5 mM or less, 4.4 mM or less, 4.3 mM or less, 4.2 mM or less, 4.1 mM or less, 4.0 mM or less, 3.9 mM or less, 3.8 mM or less, 3.7 mM or less, 3.6 mM or less, 3.5 mM or less, 3.4 mM or less, 3.3 mM or less, 3.2 mM or less, 3.1 mM or less, 3.0 mM or less, 2.5 mM or less, 2.0 mM or less, 1.5 mM or less, or 1.0 mM or less.

[0071] In the subsequent nucleic acid detection, especially nucleic acid amplification reaction system of the pretreatment reagent, the concentration of EDTA is preferably diluted to 1.5 to 20 times, particularly preferably to 2.0 to 10 times, from the above concentration.

[0072] The reagent of this embodiment preferably includes a buffer, and particularly preferably includes a pH buffer. The buffer used here is preferably a known buffer that does not have a negative impact on the reaction system of the nucleic acid detection below. As such a buffer material, for example, in addition to Tris-HCl (pH 7.0-8.5), pH buffers such as HEPES, BES, TES, MOBS, DIPSO, TAPSO, HEPPSO, TAPSO, TEA, glycine, and bicine can be used. The pH of the reagent of this embodiment is preferably 6.0-9.0, particularly preferably 6.5-8.5.

[0073] The reagent of this embodiment can further include other components. As other components, for example, components for exposing nucleic acid from capsids and cells can be cited. As such components, alkali (NaOH, KOH, etc.), acid (HCl, H2SO4, etc.), enzyme (proteinase: Proteinase K, etc., polysaccharide degrading enzyme: chitinase (chitinase), lysozyme (lysozyme), yeast lyase (zymolyase), etc.), surfactant (anionic: SDS, etc., cationic: CTAB (hexadecyltrimethylammonium bromide), etc., nonionic: Triton-X, etc., zwitterionic: betaine (a general term for compounds with specific structures, trimethylglycine, etc.), redox agent (hydrogen peroxide, β-mercaptoethanol, dithiothreitol, etc.), protein modifier (guanidine hydrochloride, urea, etc.) can be cited. The above multiple mixtures can also be used. Furthermore, when the sample contains a large amount of impurities other than nucleic acids, for example, polyvinylpyrrolidone (PVPP) may be added so that the final concentration during nucleic acid detection is approximately 50 mg / mL (see Non-Patent Document 1).

[0074] 3. Method for pre-treating samples for nucleic acid detection

[0075] A second embodiment of the present invention is a method for pre-treating a sample to be tested for nucleic acid. The method of this embodiment comprises the following steps.

[0076] i) a step of mixing the sample with a pretreatment reagent containing EDTA; and

[0077] ii) A step of heating the sample mixed in step i) by heating means at 90° C. or higher.

[0078] In the method of this embodiment, the sample is particularly preferably a water sample from an environment such as a river or sewage water. In addition, the nucleic acid to be detected is preferably derived from a virus.

[0079] 3-1 Preparation process

[0080] Hereinafter, for the method of the present embodiment, each process is described. The method of the present embodiment has the steps i) and ii) as necessary processes, and may also have one or more preparatory processes before the step i). For example, when the sample contains a large amount of impurities in addition to nucleic acid, a process for removing them may be provided. As such a process, for example, filtration based on a coarse mesh filter or filter paper may be cited. In addition, for example, when the sample is a sample with many solid components such as a portion of food or a biological sample, a process for crushing the solid component in a liquid and a process for removing insoluble components (residues) may be provided.

[0081] When the nucleic acid concentration in the sample is low, particularly in the case of environmental water samples, it is preferable to include a step of concentrating the nucleic acid in the sample. The method for sample concentration is not particularly limited, and any of the methods that can be used include ultrafiltration, nucleic acid adsorption on a filter made of glass fiber or similar materials, and nucleic acid precipitation using ethanol or isopropanol.

[0082] 3-2 Step i) EDTA mixing step

[0083] Step i) of this embodiment is a step of mixing the sample with a pretreatment reagent containing EDTA. As the pretreatment reagent containing EDTA, the reagents described in the section "2. Pretreatment reagents for samples to be detected for nucleic acid" can be used.

[0084] In step i), the concentration of EDTA in the mixed sample is preferably 0.01 to 20 mM, particularly preferably 0.1 to 10 mM, further preferably 1 to 5 mM, and most preferably 2.5 mM. The concentration of EDTA can be, for example, 0.2 mM or more, 0.3 mM or more, 0.4 mM or more, 0.5 mM or more, 0.6 mM or more, 0.7 mM or more, 0.8 mM or more, 0.9 mM or more, 1.0 mM or more, 1.1 mM or more, 1.2 mM or more, 1.3 mM or more, 1.4 mM or more, 1.5 mM or more, 1.6 mM or more, 1.7 mM or more, 1.8 mM or more, 1.9 mM or more, 2.0 mM or more, 2.1 mM or more, 2.2 mM or more, 2.3 mM or more, 2.4 mM or more, 2.5 mM or more, 3.0 mM or more, 3.5 mM or more, 4.0 mM or more, 4.5 mM or more, 5.0 mM or more, 6.0 mM or more, 7.0 mM or more, 8.0 mM or more, or 9.0 mM or more. The concentration of EDTA can be, for example, 9.5 mM or less, 9.0 mM or less, 8.5 mM or less, 8.0 mM or less, 7.5 mM or less, 7.0 mM or less, 6.9 mM or less, 6.8 mM or less, 6.7 mM or less, 6.6 mM or less, 6.5 mM or less, 6.4 mM or less, 6.3 mM or less, 6.2 mM or less, 6.1 mM or less, 6.0 mM or less, 5.9 mM or less, 5.8 mM or less, 5.7 mM or less, 5.6 mM or less, 5.5 mM or less, 5.4 mM or less, 5.3 mM or less, 5.2 mM or less, The concentration of the EDTA-containing nucleic acid is preferably 5.1 mM or less, 5.0 mM or less, 4.9 mM or less, 4.8 mM or less, 4.7 mM or less, 4.6 mM or less, 4.5 mM or less, 4.4 mM or less, 4.3 mM or less, 4.2 mM or less, 4.1 mM or less, 4.0 mM or less, 3.9 mM or less, 3.8 mM or less, 3.7 mM or less, 3.6 mM or less, 3.5 mM or less, 3.4 mM or less, 3.3 mM or less, 3.2 mM or less, 3.1 mM or less, 3.0 mM or less, 2.5 mM or less, 2.0 mM or less, 1.5 mM or less, or 1.0 mM or less. By setting the concentration to such a level, the degradation of nucleic acids, particularly RNA, can be sufficiently suppressed, and by performing appropriate dilution, the target nucleic acid can be detected even in the subsequent detection step without causing reaction inhibition due to EDTA or reduction in sensitivity due to excessive dilution.

[0085] The pretreatment reagent containing EDTA preferably further comprises a buffer in addition to EDTA, and particularly preferably comprises a pH buffer. The buffer used herein is preferably a well-known buffer that does not have a negative impact on the reaction system of the nucleic acid detection below. As such a buffer, an optional pH buffer having a buffer pH range of between 6 and 9 can be used, such as Tris-HCl (pH 7.0-8.5), HEPES, BES, TES, MOBS, DIPSO, TAPSO, HEPPSO, TAPSO, TEA, glycine, Bicine, etc. The pH of the mixed sample is preferably 6.0-9.0, particularly preferably 6.5-8.5.

[0086] The pretreatment reagent may further include other components. Examples of other components include components for exposing nucleic acids from capsids or cells. Examples of such components include alkalis (such as NaOH and KOH), acids (such as HCl and H2SO4), enzymes (such as proteinases such as proteinase K, and polysaccharide degrading enzymes such as chitinase, lysozyme, and zymolyase), surfactants (such as anionic surfactants such as SDS, cationic surfactants such as CTAB (cetyltrimethylammonium bromide), nonionic surfactants such as Triton-X, and zwitterionic surfactants such as betaine (a general term for compounds with a specific structure, such as trimethylglycine), redox agents (such as hydrogen peroxide, β-mercaptoethanol, and dithiothreitol), and protein modifiers (such as guanidine hydrochloride and urea). A combination of these may also be used.

[0087] In step i), the nucleic acid concentration of the sample after mixing is not particularly limited, but is preferably 1 fg / μL to 500 ng / μL, and particularly preferably 0.1 pg / μL to 100 ng / μL.

[0088] 3-3 Step ii) Heating Step

[0089] Step ii) of the method of this embodiment is a step of heating the sample mixed in step i) by heating means at or above 90° C. By including this step, the method of this embodiment can quickly bring the sample into a state suitable for nucleic acid detection.

[0090] In step ii), the temperature of the heating means is preferably 100°C or higher, particularly preferably 105°C or higher and 160°C or lower, and further preferably 125°C or higher and 145°C or lower. In this case, the sample is preferably heated while enclosed in a sealable and heatable container. That is, the container used is preferably a sealable container that is thermally conductive, heat-resistant, and pressure-resistant. In step ii), the sample to be heated is an aqueous solution. Without a sealed condition, it is difficult to raise the temperature to over 100°C. By heating in a sealed state, a high-temperature pressurized state can be achieved, allowing the sample to be heated to temperatures exceeding 100°C. Examples of such containers include boil-lock polypropylene tubes (capacity: 0.2mL, 0.6mL, 1.5mL, etc.) with a mechanical structure for sealing, heat-weldable bags, glass test tubes with screw caps, microfluidic chips, and the like. It should be noted that when the heating temperature is 90°C to 100°C, conventional polypropylene tubes and the like can be suitably used as containers.

[0091] To more reliably heat the sample to a high temperature, a method can be employed to eliminate the presence of a gas phase within the container. For example, the container can be filled with the sample liquid and sealed so that no bubbles or gas layers remain. Alternatively, a high-boiling-point solvent such as mineral oil can be introduced into the gas phase within the container.

[0092] In step ii), when the heating temperature is 90°C to 100°C, the heat treatment time is approximately 5 minutes. On the other hand, by setting the heating temperature to 100°C or higher, the heating time can be reduced to less than 120 seconds, preferably less than 45 seconds, less than 35 seconds, or less than 25 seconds. The heating time is most preferably set to 15 seconds or less. Heating can be achieved by preheating the heating device to a set temperature, placing the container therein, and then heating for a predetermined time. After heating for the predetermined time, the sample is preferably immediately cooled.

[0093] The heated sample is preferably cooled to room temperature (e.g., 20°C to 30°C), refrigerated temperature (e.g., 2°C to 8°C), or ice-cooled. In particular, when nucleic acid amplification is difficult to perform immediately, it is preferably stored immediately below refrigerated temperature.

[0094] When nucleic acids derived from cells with rigid structures, such as Gram-positive bacteria and fungi, are used, the heating step can be repeated two or more times. On the other hand, when nucleic acids derived from viruses, etc., originating from aquatic environments, are used, it is preferable to avoid prolonged heating steps to avoid the effects of nucleases and the like in the sample. Therefore, a single heating cycle is preferably used.

[0095] 4 Methods for detecting nucleic acids in samples

[0096] A third embodiment of the present invention is a method for detecting nucleic acid in a sample. The method of this embodiment includes the following steps.

[0097] a) a step of mixing a sample to be detected by nucleic acid with a pretreatment reagent containing EDTA;

[0098] b) heating the sample after step a) at 90° C. or above;

[0099] c) a step of mixing the sample after step b) with a nucleic acid detection reagent; and

[0100] d) a step of detecting nucleic acid in the sample after step c).

[0101] Unless otherwise specified or there is no particular contradiction, the method of this embodiment may be a method of further detecting nucleic acid on a sample pretreated by "3. Method of pretreating a sample to be detected by nucleic acid".

[0102] 4-1 Preparation process

[0103] The following describes each step of the method of this embodiment. The method of this embodiment includes steps a) to d) as essential steps, and may also include one or more preparatory steps prior to step a). For example, if the sample contains a large amount of impurities in addition to nucleic acids, a step for removing these impurities may be included. Examples of such steps include filtration using a coarse mesh filter or filter paper.

[0104] When the nucleic acid concentration in the sample is low, particularly in the case of a water sample in the environment, it is preferable to include a step of concentrating the nucleic acid in the sample.

[0105] 4-2 Step a) EDTA mixing step

[0106] Step a) of this embodiment involves mixing the sample with a pretreatment reagent containing EDTA. Pretreatment reagents containing EDTA can be used as those described in "2. Pretreatment Reagents for Samples Subject to Nucleic Acid Detection." In step a), the EDTA concentration in the mixed sample is preferably 0.01 to 20 mM, particularly preferably 0.1 to 10 mM.

[0107] The pretreatment reagent containing EDTA preferably further comprises a buffer in addition to EDTA, and particularly preferably comprises a pH buffer. The buffer used herein is preferably a well-known buffer that does not negatively affect the reaction system of the nucleic acid detection below. The buffer can be a pH buffer. The pH of the mixed sample is preferably 6 to 9, particularly preferably 6.5 to 8.5. The pretreatment reagent may further comprise other components. As other components, for example, components for exposing nucleic acids from capsids and cells can be cited.

[0108] 4-3 Step b) Heating Step

[0109] The process b) of this embodiment is a process of heating the sample after the process a) with a heating means at 90°C or above. In the process b), the sample is preferably heated in a state where it has been sealed in a heatable and sealable container. In the process b), the temperature of the heating means is preferably 100°C or above, particularly preferably 105°C or above and 160°C or below, and further preferably 125°C or above and 145°C or below. In this case, the sample is preferably heated in a state where it has been sealed in a heatable and sealable container. On the other hand, when the heating temperature is 90°C to 100°C, a conventional polypropylene tube or the like can be suitably used as a container.

[0110] To more reliably heat the sample to a high temperature, a method can be employed to eliminate the presence of a gas phase within the container. For example, the container can be filled with the sample liquid and sealed so that no bubbles or gas layers remain. Alternatively, a high-boiling-point solvent such as mineral oil can be introduced into the gas phase within the container.

[0111] In step b), when the heating temperature is 90°C to 100°C, the heating treatment time is approximately 5 minutes. On the other hand, when the heating temperature is 100°C or above, the heating treatment time can be less than 120 seconds, preferably less than 45 seconds, less than 35 seconds, or less than 25 seconds. The heating treatment time can most preferably be set to 15 seconds or less. Heating can be achieved by preheating the heating device to a set temperature, placing the container therein, and then setting the heating time for a predetermined period of time. After the predetermined heating period, the sample is preferably immediately cooled.

[0112] The heated sample is preferably cooled to room temperature (e.g., 20°C to 30°C), refrigerated temperature (e.g., 2°C to 8°C), or ice-cooled. In particular, when nucleic acid amplification is difficult to perform immediately, it is preferably stored immediately below refrigerated temperature.

[0113] The heating step may be repeated two or more times. However, when nucleic acids derived from viruses or the like originating from an aquatic environment are targeted, heating is preferably performed only once.

[0114] After the steps a) and b), a pretreated sample for nucleic acid detection can be obtained.

[0115] 4-4 Step c) Nucleic acid detection reagent mixing step

[0116] Step c) in the method of this embodiment is a step of mixing the sample after step b) with a nucleic acid detection reagent. Here, the nucleic acid detection reagent is preferably a reverse transcription polymerase chain reaction (RT-PCR) reagent when the nucleic acid to be detected is RNA, and preferably a polymerase chain reaction (PCR) reagent when the nucleic acid to be detected is DNA.

[0117] When the nucleic acid to be detected is RNA and a reagent for RT-PCR is used as a reagent for nucleic acid detection, the reagent for RT-PCR may contain, for example, the following components.

[0118] - DNA polymerase with reverse transcription function (e.g., Tth DNA polymerase);

[0119] - at least one set of primers for amplifying a desired region of a template nucleic acid;

[0120] -deoxynucleoside triphosphates;

[0121] - divalent metal ions; and

[0122] -pH buffer.

[0123] When the nucleic acid to be detected is DNA and a PCR reagent is used as the nucleic acid detection reagent, the PCR reagent may contain the following components.

[0124] - DNA polymerase (e.g. Taq DNA polymerase);

[0125] - at least one set of primers for amplifying a desired region of a template nucleic acid;

[0126] -deoxynucleoside triphosphates;

[0127] - divalent metal ions; and

[0128] -pH buffer.

[0129] When RT-PCR or PCR is performed under real-time PCR conditions, a detection probe (e.g., TaqMan (registered trademark) probe) or a fluorescent intercalator (SYBR (registered trademark) GREEN, etc.) may be further included. In addition, internal standard DNA, uracil DNA glycosylase (UNG), etc. may be included for accurate detection / quantification.

[0130] The structure of the primers and probes can be suitably designed according to the structure of the nucleic acid of the detection object. The RT-PCR reagent or PCR reagent can be prepared using a commercially available kit or the like. As such a kit, for example, PrimeScript (trademark) RT Master Mix (Takara Bio Co., Ltd.), SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Thermo Fisher), ReverTraAce qPCR RT Master Mix (Toyobo) and the like are known.

[0131] The sample after step b) is preferably mixed with a nucleic acid detection reagent as quickly as possible to perform the detection step in order to avoid the influence of residual nuclease activity and the like.

[0132] It is preferred to pre-set the EDTA concentration of the pretreatment reagent and the detection reagent so that after step c), the final EDTA concentration in the sample supplied to the nucleic acid detection step is 0.001 to 10 mM, particularly 0.01 to 5 mM, and further 0.1 to 1 mM. The final EDTA concentration can be, for example, 0.02 mM or more, 0.03 mM or more, 0.04 mM or more, 0.05 mM or more, 0.06 mM or more, 0.07 mM or more, 0.08 mM or more, 0.09 mM or more, 0.10 mM or more, 0.11 mM or more, 0.12 mM or more, 0.13 mM or more, 0.14 mM or more, 0.15 mM or more, 0.16 mM or more, 0.17 mM or more, .18mM or more, 0.19mM or more, 0.20mM or more, 0.21mM or more, 0.22mM or more, 0.23mM or more, 0.24mM or more, 0.25mM or more, 0.30mM or more, 0.35mM or more, 0.40mM or more, 0.45mM or more, 0.50mM or more, 0.60mM or more, 0.70mM or more, 0.80mM or more or 0.90mM or more. The final concentration of EDTA can be, for example, 4.9 mM or less, 4.8 mM or less, 4.7 mM or less, 4.6 mM or less, 4.5 mM or less, 4.4 mM or less, 4.3 mM or less, 4.2 mM or less, 4.1 mM or less, 4.0 mM or less, 3.9 mM or less, 3.8 mM or less, 3.7 mM or less, 3.6 mM or less, 3.5 mM or less, 3.4 mM or less, 3.3 mM or less, 3.2 mM or less, 3.1 mM or less, 3.0 mM or less, 2.9 mM or less, 2.8 mM or less. The reaction inhibition effect by EDTA can be avoided by directly avoiding the reaction inhibition by EDTA by making it to said concentration, or, as described below, by making a divalent metal salt coexist and avoiding reaction inhibition.

[0133] When the final concentration of EDTA is 1 mM or higher, it forms a chelate complex with an equivalent amount of divalent metal ions in the RT-PCR reagent or PCR reagent, thereby risking reduced DNA polymerase activity. In this case, it is preferable to add 0.5 to 2.0 equivalents, particularly 0.75 to 1.25 equivalents, of a divalent metal salt of EDTA before step d).

[0134] 4-5 Step d) Nucleic acid detection step

[0135] Step d) of this embodiment is a step of detecting nucleic acids in the sample after step c). The method of nucleic acid detection is not particularly limited, but preferably a nucleic acid amplification method is used. As a nucleic acid amplification method, when the nucleic acid to be detected is RNA, the RT-PCR method can be preferably used, and when it is DNA, the PCR method can be preferably used. More preferably, a real-time RT-PCR method or a real-time PCR method is used. Reagents that can be used for the real-time RT-PCR method and the real-time PCR method are described in the section "4-4 Step c) Nucleic Acid Detection Reagent Mixing Step".

[0136] When the real-time RT-PCR method is implemented, the detection process is divided into a reverse transcription process and an amplification / detection process. The reverse transcription process is a process for generating complementary strand DNA (cDNA) from the template RNA, and the amplification / detection process is a process for detecting the signal emitted by amplifying the cDNA. The reaction and signal detection in the process can be performed using, for example, CronoSTAR (registered trademark) 96 Real-Time PCR System (Takara Bio Co., Ltd.).

[0137] It is preferred that step d) be started as soon as possible after step b). The time from step b) to the start of step d) is preferably within 4 hours, particularly preferably within 30 minutes.

[0138] According to the method of this embodiment, a target nucleic acid in a sample can be detected easily and accurately.

[0139] [Example]

[0140] [Comparative Example 1] Detection of Pepper Mild Mottle Virus (PMMoV) in Sewage Treatment Water

[0141] Sewage (treated water) filtered with MF (microfiltration membrane) was aliquoted into a polypropylene centrifuge tube, and 20 μL of the aliquot was mixed with 20 μL of a lysis buffer containing 10 mM Tris-HCl (pH 8.0).

[0142] Place the centrifuge tube in a heating block at 140°C and heat for 15 seconds, 25 seconds, 35 seconds, or 45 seconds. As a control, prepare a sample that is not heated. Cool the heated tube to room temperature and centrifuge at 10,000×g for 1 minute. After the supernatant has stood at room temperature for 3 minutes, 30 minutes, 4 hours, or 24 hours, dilute it to 10 times with DNase / RNase-free water. Take 10 μL, add 10 μL of the mixed cDNA Reverse Transcription Kit (Thermo Fisher, model 4368813), and perform the reverse transcription reaction at 37°C for 60 minutes.

[0143] To 5 μL of the reverse transcription product, TaqPath (registered trademark) qPCR (Thermo Fisher, No. A15297) and the primers and probes listed below were added to create a 25 μL system. Quantitative PCR (TaqMan PCR) was performed using the Thermal Cycler Dice Real Time System (Takara Bio), and the Ct value was calculated as the output value. The PCR temperature conditions are shown in Table 1.

[0144] Forward primer: GAGTGGTTTGACCTTAACGTTTGA (SEQ ID NO. 1)

[0145] Reverse primer: TTGTCGGTTGCAATGCAAGT (SEQ ID NO. 2)

[0146] Probe: FAM-CCTACCGAAGCAAATG-MGB-NFQ (SEQ ID NO. 3)

[0147] [Table 1]

[0148]

[0149] Reverse transcription and quantitative PCR were performed under the same conditions using a standard solution of PMMoV containing a known amount of virus. The Ct was compared with the Ct of the sample to calculate the virus quantification value per 1 μL and 5 μL.

[0150] Figure 1 The quantitative value of the quantified virus in the sample at each heat treatment time ( / 1 μL) is shown. The longer the heat treatment time exceeds 15 seconds, the lower the quantitative value. Figure 2The relationship between the standing time after 15 seconds of heat treatment and the reverse transcription reaction and the PMMoV quantitative value ( / 5μL) is shown. Also shown as a control is the quantitative value of a sample that was not heat treated. PMMoV was not detected in the sample that was not heat treated. While heat treatment enabled PMMoV detection, the longer the standing time after heat treatment, the lower the PMMoV quantitative value. This is presumably due to the influence of nucleases contained in wastewater.

[0151] [Comparative Example 2] Detection of purified PMMoV

[0152] A virus solution containing PMMoV was inoculated into Nicotiana benthamiana leaves, and leaves exhibiting mosaic symptoms were collected. After freezing at -80°C, 10-fold the weight of the infected leaves was added with phosphate buffer (pH 7.2) to thoroughly disrupt the leaves. After disruption, the leaves were filtered through 5μm and 0.45μm filters, and the filtrate was collected in a 1.5mL Eppendorf (registered trademark) tube. This filtrate was diluted 10-fold with lysis buffer containing 10mM Tris-HCl (pH 8.0).

[0153] Place the centrifuge tube in a heating block at 140°C and heat for 15 seconds, 25 seconds, 35 seconds, or 45 seconds. Cool the heated tube to room temperature and centrifuge at 10,000×g for 1 minute. Immediately dilute the supernatant to 10 times with DNase / RNase-free water. Take 10 μL and add 10 μL of the mixed cDNA reverse transcription kit (Thermo Fisher, model 4368813) to it, and perform the reverse transcription reaction at 37°C for 60 minutes. For 5 μL of the reverse transcription product, perform a PCR reaction under the same conditions as in Comparative Example 1.

[0154] Figure 3 The values ​​represent the quantified viral load ( / 1 μL) in the sample at each heat treatment time. When purified virus was used as the sample, no significant changes in the quantitative values ​​were found due to differences in heat treatment time. This is presumably because purified virus samples, unlike wastewater, are less susceptible to nucleases and other effects.

[0155] [Example 1] Detection of PMMoV in sewage treatment water in the presence of EDTA

[0156] The wastewater after the MF filtration treatment was aliquoted into a polypropylene centrifuge tube, and 20 μL of the aliquot was mixed with 20 μL of a lysis buffer containing 10 mM Tris-HCl (pH 8.0) and 5 mM EDTA.

[0157] Place the centrifuge tube in a heating block at 140°C and heat for 15 seconds. For comparison, prepare a sample that is not heated. Cool the heated tube to room temperature and centrifuge at 10,000×g for 1 minute. Let the supernatant stand at room temperature or 4°C for 3 minutes, 30 minutes, 4 hours or 24 hours, and then dilute it to 10 times with DNase / RNase-free water. Take 10 μL and add 10 μL of the mixed cDNA reverse transcription kit (Thermo Fisher, model 4368813), and perform reverse transcription reaction at 37°C for 60 minutes. For 5 μL of the reverse transcription product, perform PCR reaction under the same conditions as in Comparative Example 1.

[0158] Figure 4 The figure shows the relationship between the time from heat treatment to reverse transcription reaction and the PMMoV quantitative value ( / 5μL) for samples that were heat-treated with EDTA and then allowed to stand at room temperature, and samples that were heat-treated without EDTA and then allowed to stand at room temperature and 4°C. Under the condition where EDTA was not added, the PMMoV quantitative value in the sample that was allowed to stand at room temperature was significantly lower after 30 minutes and 4 hours compared to the sample that was allowed to stand at 4°C. On the other hand, under the condition where EDTA was added, even after standing at room temperature, the quantitative value obtained after 30 minutes was not significantly different from that of the sample that was allowed to stand at 4°C. In addition, the quantitative value obtained after 4 hours was higher than that under the condition where EDTA was not added. This shows that the stability of the sample is improved by adding EDTA.

[0159] [Example 2] Comparison of PMMoV detection results in wastewater treated water under heat treatment conditions

[0160] Three types of filtered sewage (samples A to C) were suspended in 20 μL of a lysis buffer containing 10 mM Tris-HCl (pH 8.0) and 5 mM EDTA in a polypropylene centrifuge tube.

[0161] Place the centrifuge tube in a heating block at 140°C and heat for 15 seconds, or place it in a heating block at 95°C and heat for 5 minutes. Cool the heated tube to room temperature and centrifuge at 10,000 × g for 1 minute. After the supernatant was allowed to stand at room temperature for 30 minutes, 10 μL of a mixed cDNA reverse transcription kit (Thermo Fisher, model 4368813) was added and reverse transcription reaction was performed at 37°C for 60 minutes. PCR reaction was performed on 5 μL of the reverse transcription product under the same conditions as in Comparative Example 1.

[0162] Figure 5The PMMoV quantitative values ​​( / 5 μL) under various heating conditions are shown for samples A to C. All samples obtained high quantitative values ​​by treatment at 140°C for 15 seconds. This indicates that a high temperature of 140°C allows for short sample treatment times.

[0163] [Example 3] PCR reaction at various EDTA concentrations and divalent metal ion concentrations

[0164] The genomic DNA extracted from Bacillus subtilis (Bacillus subtilis, from NBRC, No.3134) using QIAamp DNA Kit (QIAGEN, 56304) was dissolved in DNase / RNase-free water at 100 pg / μL to prepare a DNA solution. TB Green premix Ex Ta qII (Takara Bio Co., Ltd., No.RR820S) was used to distribute the genomic DNA at 200 pg / tube, and EDTA and FeSO4 were added to the concentrations shown in Table 3. The following primers and probes were added to prepare a 20 μL system, and quantitative PCR was performed using a Thermal Cycler Dice RealTime System (Takara Bio). The temperature conditions for PCR are shown in Table 2.

[0165] Forward primer: TCAACTAGTTCAGTATGGACGAC (SEQ ID NO. 4)

[0166] Reverse primer: CCTCATCAAGAAACCACTGA (SEQ ID NO. 5)

[0167] [Table 2]

[0168]

[0169] Table 3 shows the Ct values ​​under various conditions. When the final EDTA concentration was 0 to 0.33 mM, nucleic acid amplification was possible even without the addition of FeSO4. On the other hand, when the FeSO4 concentration exceeded 1.0 mM, nucleic acid amplification was not observed. When the final EDTA concentration was 1 mM, nucleic acid amplification with lower Ct values ​​was observed by adding 0.33 to 1 mM FeSO4. When the final EDTA concentration was 3.3 mM, nucleic acid amplification was possible by adding 1.0 to 3.3 mM FeSO4. When the final EDTA concentration was 10 mM, nucleic acid amplification was not observed even with the addition of FeSO4.

[0170] [Table 3]

[0171]

[0172] As described above, it was shown that low concentrations of EDTA have no effect on nucleic acid amplification, and that nucleic acid amplification does not proceed sufficiently in systems containing high concentrations of EDTA. Furthermore, it was shown that the negative effects of EDTA can be reversed by adding an appropriate concentration of divalent metal ions after heat treatment and before nucleic acid amplification.

Claims

1. A method for pretreating a sample to be tested for nucleic acid, comprising: i) a step of mixing the sample with a pretreatment reagent containing ethylenediaminetetraacetic acid (EDTA); and ii) A step of heating the sample mixed in step i) by heating means at 90° C. or higher.

2. The method according to claim 1, wherein The sample is a water sample in the environment.

3. The method according to claim 1, wherein The nucleic acid is a viral nucleic acid.

4. The method according to claim 1, comprising: A step of concentrating nucleic acids in a sample before step i).

5. The method according to claim 1, wherein The concentration of EDTA in the sample mixed in step i) is 0.01 to 20 mM.

6. The method according to claim 5, wherein: The concentration of EDTA in the sample mixed in step i) is 0.1 to 10 mM.

7. The method according to claim 1, wherein The heating treatment time in step ii) is less than 120 seconds.

8. The method according to claim 1, wherein The temperature of the heating means in the step ii) is 105° C. or higher and 160° C. or lower.

9. A method for detecting nucleic acid in a sample, comprising: a) a step of mixing a sample to be detected by nucleic acid with a pretreatment reagent containing EDTA; b) heating the sample after step a) at 90° C. or above; c) a step of mixing the sample after step b) with a nucleic acid detection reagent; and d) a step of detecting nucleic acid in the sample after step c).

10. The method according to claim 9, wherein: The nucleic acid detection reagent is a reverse transcription polymerase chain reaction (RT-PCR) reagent.

11. The method according to claim 9, wherein After step b), the time until step d) starts is less than 4 hours.

12. The method according to claim 9, wherein In the step c), the EDTA concentration in the mixed sample is 0.001 to 10 mM.

13. A reagent for pre-treating a water sample in an environment to be used for viral nucleic acid detection, comprising: 0.1~10mM concentration of EDTA, and pH buffer.

Citation Information

Patent Citations

  • Method for avoiding inhibition in nucleic acid proliferation reaction

    JP2008072904A

  • Nucleic acid extraction method

    JP2012157265A