Primer-free isothermal amplification kit and application thereof

Abstract

The invention belongs to the field of gene detection, and particularly relates to a primer-free isothermal amplification kit and application thereof. The primer-free isothermal amplification kit comprises detection reagents, wherein each detection reagent comprises a reagent a, a reagent b and a reagent c; in each part of the detection reagent, the reagent a comprises 7.5 [mu] L of 2 * Taq-Plus PCR Master Mix, 0.3 [mu] L of an upstream primer, 0.3 [mu] L of a downstream primer and 4.9 [mu] L of ddH2O; the reagent b comprises 2 [mu] L of 10 * CutOne Buffer, 1 [mu] L of PstI and 12 [mu] L of ddH2O; the reagent c comprises an RPA reagent, 2 mu L of PstI with the concentration of 20 U / mu L and 1.25 mu L of an activating agent containing Mg < 2 + >. According to the primer-free genotype conversion technology, primers do not need to be designed in the detection process, and the accuracy and the sensitivity of the primer-free genotype conversion technology are equivalent to those of a gold label.

Description

Technical Field

[0001] The present invention belongs to the field of gene detection, and in particular relates to a primer-free isothermal amplification kit and an application thereof. Background Art

[0002] Circulating tumor DNA (ctDNA) is a special type of cell-free DNA (cfDNA), specifically DNA fragments released by tumor cells into the bloodstream. It reflects the genetic characteristics of a tumor, including specific mutations, copy number variations, and epigenetic alterations. Therefore, ctDNA provides an important biomarker for early cancer diagnosis, treatment monitoring, and personalized treatment. As an emerging liquid biopsy technique, ctDNA testing offers the advantages of its non-invasive and real-time monitoring capabilities, effectively capturing the genetic heterogeneity of tumors. Through a simple blood draw, it can assess a patient's disease status, treatment response, and provide prognostic information. This holds great promise for the application of ctDNA in cancer diagnosis and treatment.

[0003] However, ctDNA detection also faces significant challenges. First, wild-type and mutant forms are highly similar, and the abundance of mutant sequences is low, typically accounting for between 1 / 100,000 and 5 / 100 of cfDNA. This makes detection difficult against the backdrop of the overwhelming presence of wild-type sequences. Second, ctDNA fragment lengths vary greatly, ranging from tens to hundreds of base pairs. This uncertainty increases the difficulty of PCR primer design and makes it easy to lose short fragments during the detection process. These characteristics necessitate the use of highly sensitive and specific methods to accurately identify and quantify ctDNA, and these methods should minimize reliance on fragment length.

[0004] Currently, next-generation sequencing (NGS) and polymerase chain reaction (PCR) are commonly used methods for clinical detection of ctDNA. PCR-based methods include mutation amplification retardation system PCR (ARMS-PCR), low-temperature denaturing co-amplification PCR (COLD-PCR), droplet digital PCR (ddPCR), and BEAMing, which combines digital PCR with flow cytometry. NGS offers high throughput and the ability to detect multiple variants simultaneously; however, it faces challenges in sensitivity, particularly for low-frequency variants, which often require deep sequencing, which can be costly and time-consuming. ARMS-PCR requires primer design specific to the mutation target, necessitating extensive initial screening and primer optimization, which is time-consuming and labor-intensive. COLD-PCR, on the other hand, primarily serves to enrich the detection template and often requires integration with other detection technologies (such as ddPCR or NGS) to achieve greater effectiveness in ctDNA detection. This results in cumbersome procedures and high costs. While digital PCR (including ddPCR and BEAMing) offers advantages in sensitivity, it does not significantly improve specificity because it uses similar standards for primer design and reaction condition optimization as non-digital PCR and is even more prone to false positives. Digital PCR also requires expensive specialized equipment, limiting its application in low-resource settings. Furthermore, PCR-based detection methods require primer design for ctDNA of a specific length, making it difficult to effectively detect mutations in ctDNA of varying lengths. Summary of the Invention

[0005] The purpose of the present invention is to provide a primer-free isothermal amplification method and application thereof.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: A primer-free isothermal amplification kit, comprising detection reagents, each of which comprises reagent a, reagent b, and reagent c; Each test reagent contains reagent a: 7.5 μL 2× Taq-Plus PCR Master Mix, 0.3 μL upstream primer, 0.3 μL downstream primer, and 4.9 μL ddH2O; Reagent b includes: 2 μL 10× CutOne Buffer, 1 μL PstⅠ, and 12 μL ddH2O; Reagent c includes: RPA reagent, 2 μL of Pst I with a concentration of 20 U / μL, 1.25 μL of Mg-containing 2+ activator.

[0007] The RPA reagent is a common commercially available product, such as the RPA reagent of Hangzhou Zhongce Biotechnology Co., Ltd.

[0008] In one preferred embodiment, the RPA reagent includes: 5 μg Escherichia coli RecA protein, 2 μg yeast Rad51 protein, 25 μg single-stranded binding protein, 1 μg Escherichia coli DNA polymerase I, 50 μg dNTP, 125 μg ATP, 25 μg dithiothreitol, 400 μg creatine phosphate, and 12.5 μL of 10% PEG 35000 solution.

[0009] Reagent b is a common commercially available Pst Ⅰ ​​enzyme digestion product, such as LightNing from Jiangsu Yugong Life Science Co., Ltd. TM PstⅠ.

[0010] In one preferred embodiment, the Mg-containing 2+ The activator is one or more of magnesium acetate, magnesium chloride and magnesium sulfate.

[0011] In one preferred embodiment, the upstream primer is: AAGATCCTGTGAGCGAAGTTCCAGCA (SEQ ID NO. 1); The downstream primer is: GAGGGAGATTTCGCTCCTGA (SEQ ID NO. 2).

[0012] This project established a primer-free genotype conversion technology. Unlike traditional enrichment strategies, this primer-free genotype conversion technique can convert wild-type to mutant forms to identify rare, short ctDNA. First, a mixed sample containing abundant wild-type fragments and rare mutants is amplified and pre-digested. The products of wild-type endonuclease degradation serve as primers, and the mutant fragments serve as templates. Escherichia coli DNA polymerase I performs primer extension and proofreading, gradually converting the wild-type to the mutant form, thereby achieving genotype conversion. The genotype conversion system comprises an isothermal amplification system (recombinase polymerase amplification (RPA)) and an endonuclease specific for the wild-type. It is performed at a relatively low temperature (39°C), which does not affect restriction enzyme activity and effectively suppresses nonspecific re-extension in pure wild-type samples. Combined with Sanger sequencing, accurate genotyping can be achieved. Using the excised wild-type fragments as primers eliminates the need for primer design, allowing simultaneous detection of mutations in the same ctDNA of varying lengths. This detection technology has great advantages for rare, mutated and variable-length ctDNA and will show great potential in precision oncology.

[0013] To develop an isothermal detection system compatible with restriction endonucleases, the present inventors evaluated existing isothermal technologies. LAMP, with its high reaction temperature (60-65°C), reduces the activity of most restriction endonucleases. RPA, on the other hand, operates efficiently at a lower temperature (approximately 39°C), making it more suitable for integration with enzyme digestion reactions. Therefore, RPA was ultimately selected as the amplification strategy. Furthermore, the present inventors combined RPA with a wild-type-specific endonuclease, offering unique advantages in ctDNA detection. The endonuclease not only efficiently excises wild-type DNA, improving detection specificity, but also operates at a significantly lower cost than the CRISPR / Cas system, making it more suitable for clinical application.

[0014] Based on the same inventive concept, the present invention also claims protection for the use of the primer-free isothermal amplification kit in the preparation of single-base mutation site-related disease detection reagents.

[0015] In one preferred embodiment, the disease associated with the single base mutation site is one or more of colorectal cancer, gastric cancer, non-small cell lung cancer, melanoma, breast cancer, colorectal cancer, thyroid cancer, and adenomatous polyps.

[0016] A method for detecting single-base mutations by primer-free isothermal amplification for non-diagnostic purposes, comprising the following steps: (1) Extracting cfDNA from samples; (2) Perform PCR amplification on the sample cfDNA using reagent a; (3) Use reagent b to perform enzyme digestion reaction on the PCR product; (4) Use reagent c to perform primer-free genotype conversion on the enzyme-digested PCR product to obtain the product; (5) Detect the product and confirm that the single base mutation is contained in the product.

[0017] In one preferred embodiment, the product is detected by electrophoresis and sequencing to determine whether the single base mutation is contained in the product.

[0018] In one preferred embodiment, the PCR amplification process is: denaturation at 95°C for 5 minutes, followed by 40 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and extension at 72°C for 45 seconds; and then treatment at 95°C for 15 minutes to inactivate the Taq enzyme.

[0019] In one preferred embodiment, the temperature of the enzyme digestion reaction is 35-37° C., and the reaction time is 1.5-2.5 h.

[0020] In one preferred embodiment, the step of primer-free genotype conversion is: preheating the enzyme-digested PCR product at 90-95°C for 2-3 minutes, adding it to reagent C, and reacting it at 38-40°C for 2-3 hours.

[0021] The present invention first amplifies and pre-digests a mixed sample containing abundant wild-type fragments and rare mutants. A primer-free genotype conversion strategy is then implemented. The pre-digested product serves as an endogenous primer, and the undigested mutant fragment serves as a template for extension, mediated by Escherichia coli DNA polymerase I. Because the double-stranded products with sticky ends after digestion have little recombinase-mediated strand invasion activity, a high-temperature pretreatment step is introduced before amplification to promote unwinding of the double strands into single strands. At this point, the endogenous primer and template strand undergo complementary base pairing to initiate the first round of amplification. Subsequent cycles rely on recombinase-mediated strand displacement reactions. During this process, the 3'→5' exonuclease activity (proofreading function) of E. coli DNA polymerase I removes mismatched nucleotides at the 3' end of the endogenous primer, ensuring precise complementarity between the primer and the mutant template, thereby converting the wild-type sequence to the mutant. Simultaneously, the endonuclease continues to digest the wild-type fragment in the system, while the mutant template remains due to the mutation at the restriction site. The genotype conversion system includes an isothermal amplification system (recombinase polymerase amplification RPA) and a nuclease targeting the wild type. It is performed at a lower temperature (39°C) and does not affect the activity of the restriction endonuclease. It can effectively inhibit nonspecific re-extension in pure wild-type samples. The restriction endonuclease cleavage efficiency may not be 100%, so it needs to be combined with Sanger sequencing to achieve accurate genotyping.

[0022] The primer-free reaction of the present invention comprises three steps: PCR, enzyme digestion, and genotype conversion. The specific process is as follows: Plasmid samples were preamplified using a PCR reaction system consisting of 7.5 μL Taq-Plus PCR MasterMix (2×) (Jiangsu Yugong Life Science Co., Ltd.), 0.3 μL PCR-GS-F (10 μM), 0.3 μL PCR-GS-R (10 μM), 2 μL of the test sample, and 4.9 μL ddH₂O. The PCR reaction system was placed in a Biometra PCR Thermal Cycler (Analytical Instruments Jena, Germany) and cycled 40 times: 94°C for 30 s, 55°C for 30 s, and an extension at 72°C for 45 s. The Taq enzyme was then inactivated at 95°C for 15 minutes to prevent interference with subsequent reactions.

[0023] Pst Ⅰ ​​digestion reaction was performed according to LightNing TMPst I (Jiangsu Yugong Life Science Co., Ltd.) was used according to the manufacturer's instructions. The reaction system consisted of: 15 μL of the product to be digested (PCR product from the previous step), 2 μL of 10× CutOne Buffer, 1 μL of Pst I, and 12 μL of ddH2O. The reaction was incubated at 37°C for 2 h.

[0024] The primer-free genotype conversion system includes: 12.5 μL RPA reagent (Hangzhou Zhongce Biotechnology Co., Ltd.), 2 μL Pst Ⅰ, 10 μL pre-enzyme digestion product, 1.25 μL activator (Mg 2+ ).

[0025] The RPA reagent includes RPA reaction powder and 12.5 μL PEG 35000; the RPA reaction powder contains 5 μg Escherichia coli RecA protein, 2 μg yeast Rad51 protein, 25 μg single-stranded binding protein, 1 μg Escherichia coli DNA polymerase I, 50 μg dNTP, 125 μg ATP, 25 μg dithiothreitol and 400 μg creatine phosphate, and the concentration of PEG 35000 is 10%.

[0026] The specific steps of primer-free genotype conversion are as follows: preheat the PCR product of the previous step at 95°C for 3 min and store it at -20°C for a short time; dissolve the RPA powder in the A buffer (10% PEG 35000) in the RPA kit, and then add 10 μL of the preheated product, 2 μL of PstⅠ, 1.25 μL of activator (MgCl2), and 1.5 μL of activator (MgCl2). 2+ ), and react at 39°C for 2 h.

[0027] The beneficial effects of the present invention are: The primer-free genotype conversion technology designed in this paper uses wild-type enzyme-digested fragments as endogenous primers, avoiding the limitations of primer design. It can use mutant sequences of varying lengths as templates, preventing the loss of short ctDNA fragments during detection and enabling the detection of the same ctDNA of varying lengths. This technology eliminates the need for expensive specialized equipment and reduces costs. Its accuracy and sensitivity are comparable to those of a gold standard. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is a schematic diagram of the design principle of the present invention; Figure 2 This is the electropherogram of the results of PstⅠ targeting the wild-type allele; Figure 3 This is the electrophoresis diagram of the heat resistance of PstⅠ cutting enzyme; Figure 4 This is the genotype conversion result of the mixed plasmid sample with mutation abundance of 0.01%-5% in Example 1. Figure 4a is the electrophoresis diagram of genotype conversion results; Figure 4 b Sanger sequencing diagram of genotype conversion results; Figure 5 Sanger sequencing images of genotype conversion and non-genotype conversion products (PCR product 1) for a mixed plasmid sample with 5% mutation abundance; Figure 6 The genotype conversion results of mutation abundance 0.1-5% gDNA, among which, Figure 6 a is the electrophoresis diagram of genotype conversion results; Figure 6 b is the Sanger sequencing diagram of the genotype conversion result; Figure 7 is the result diagram of ARMS-PCR, where Figure 7 a is the primer screening results of ARMS-PCR; Figure 7 b shows the results of ARMS-PCR of gDNA with mutation abundance of 0.01-5%; Figure 8 To detect the real sample results, Figure 8 a is the result of ARMS-PCR test on real samples; Figure 8 b is the electrophoresis diagram of genotype conversion results; Figure 8 c is the Sanger sequencing image of the positive genotype conversion result. DETAILED DESCRIPTION

[0029] The present invention is not limited to the following specific embodiments. Based on the disclosure of the present invention, a person skilled in the art may adopt a variety of other specific embodiments to implement the present invention. Any simple changes or modifications made to the design structure and concept of the present invention fall within the scope of protection of the present invention. It should be noted that the embodiments and features of the embodiments of the present invention may be combined with each other unless they conflict. Example 1

[0030] Feasibility verification The primer-free genotype conversion technology developed by the present invention includes a genotype conversion system comprising RPA reagents, a restriction endonuclease (PstⅠ) targeting the mutation site APC c.4012C>T mutation sequence, pre-enzyme digestion products, and an activator, magnesium acetate. Degraded wild-type fragments are used as endogenous primers, and mutant fragments (including potentially amplified mutant PCR products and original mutant plasmids) are used as templates to achieve genotype conversion under the action of Escherichia coli DNA polymerase I. The reaction temperature is maintained at approximately 39°C to ensure that the endonuclease maintains optimal activity and minimizes re-extension of wild-type samples. In the genotype conversion step, no primers are required, supporting the simultaneous detection of mutations of the same ctDNA of different lengths ( Figure 1 a. Figure 1 b).

[0031] Mixed samples of plasmids with different mutation abundances: Plasmids containing the APC c.4012C > T mutation and the corresponding wild-type plasmids were synthesized by Sangon Biotech (Shanghai) Co., Ltd. A micro-spectrophotometer (QUAWELL, USA) was used to determine the copy number of the DNA template. These plasmids were mixed to prepare mixed samples containing different mutation abundances.

[0032] To verify the feasibility of the primer-free genotype conversion mechanism, the present invention first verified the enzymatic cleavage performance of the restriction endonuclease PstⅠ targeting the wild-type site. The wild-type plasmid and the mutant plasmid were first used as templates for PCR amplification and then enzymatic cleavage.

[0033] The PCR amplification system included: 10 μL Taq-Plus PCR Master Mix (2×) (Jiangsu Yugong Life Science Technology Co., Ltd.), 0.4 μL PCR-GS-F (10 μM), 0.4 μL PCR-GS-R (10 μM), 1 μL wild-type / mutant plasmid sample (~3×10 5 The PCR reaction system was placed in a Biometra PCR thermal cycler (Analytical Instruments Jena, Germany), denaturing at 95°C for 5 minutes, followed by 40 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and extension at 72°C for 45 seconds. The sequences of the resulting products are shown in Table 1.

[0034]

[0035] After obtaining the PCR product, it is digested with enzymes.

[0036] The enzyme digestion system consisted of: adding 10 μL of the product to be digested (PCR product from the previous step), 2 μL of 10× CutOne Buffer, 1 μL of Pst I, and 17 μL of ddH2O. The reaction was incubated at 37°C for 2 h.

[0037] The digested products were subjected to native polyacrylamide gel electrophoresis (PAGE). Sample buffer and sample solution were added to an electrophoresis tank containing a 12% native PAGE gel. Electrophoresis was performed using a DYY-7C electrophoresis analyzer (Six One Biotechnology Co., Ltd., Beijing, China) at a constant current of 16 mA for 45 minutes. Afterwards, the gel was stained with Gel-green and imaged using a Molecular Imager Chemi Doc™ XRS+ imaging system (Bio-Rad, Hercules, CA, USA).

[0038] The results are as follows Figure 2 As shown in the figure, the PCR product is 136 bp. The mutant plasmid product cannot be digested by Pst I, while the wild-type plasmid product can be completely digested by Pst I into two fragments, 64 bp and 72 bp. This demonstrates that Pst I can effectively target and cleave the wild-type site.

[0039] Subsequently, the present invention tested the heat resistance of the Pst I cleavage enzyme. First, a PCR system containing Pst I was used to amplify a mixed plasmid sample with varying mutation abundances, and the product was further digested and verified. The PCR amplification reaction system containing Pst I consisted of: 10 μL Taq-Plus PCR Master Mix (2×) (Jiangsu Yugong Life Science Co., Ltd.), 0.4 μL PCR-GS-F (10 μM), 0.4 μL PCR-GS-R (10 μM), 2 μL of the mixed plasmid sample, 2 μL 10× CutOne Buffer, 1 μL Pst I, and 4.2 μL ddH2O. The PCR reaction system was placed in a Biometra PCR Thermal Cycler (Analytical Instruments Jena, Germany) and denatured at 95°C for 5 minutes, followed by 40 cycles of: 94°C for 30 seconds, 55°C for 30 seconds, and an extension at 72°C for 45 seconds. The PCR product containing Pst I was then digested.

[0040] The enzyme digestion verification system includes: 10 μL of the product to be digested (the PCR product containing Pst I in the previous step), 2 μL of 10× CutOne Buffer, 1 μL of Pst I, and 17 μL of ddH2O. The reaction is carried out at 37°C for 2 h.

[0041] The Pst I-containing PCR product and the digested product were subjected to native polyacrylamide gel electrophoresis (PAGE) as follows: sample buffer and sample solution were added to an electrophoresis tank containing a 12% native PAGE gel. Electrophoresis was performed at a constant current of 16 mA for 45 minutes using a DYY-7C electrophoresis analyzer (Six One Biotechnology Co., Ltd., Beijing, China). Afterwards, the gel was stained with Gel Green and imaged using a Molecular Imager Chemi Doc™ XRS+ imaging system (Bio-Rad, Hercules, CA, USA).

[0042] The results are as follows Figure 3As shown, the PCR product containing Pst I appears as a single bright band, and the product bands are consistent, all long. Further electrophoresis after enzyme digestion confirmed that most of the product was cleaved into short bands, indicating that the product is mostly wild-type and can be cleaved by Pst I in the enzyme digestion system. This also indicates that Pst I is inactivated by high temperature during the PCR process, making it unable to perform enzymatic digestion in the PCR process.

[0043] Next, the present invention subjected mixed plasmid samples with varying mutation abundances to PCR amplification without Pst I and restriction endonuclease pre-digestion. Subsequently, the products were added to a recombinase polymerase amplification (RPA) reaction system containing the heat-labile restriction endonuclease Pst I, triggering the genotype conversion process under constant temperature conditions. A mixed plasmid sample with a 5% mutation abundance was then compared to a non-genotype conversion sample. The non-genotype conversion comparison involved only the first PCR step, without subsequent restriction endonuclease digestion or genotype conversion.

[0044] Genotype conversion involves three steps: PCR, enzyme digestion, and primer-free amplification. The specific process is as follows: Plasmid mixtures were preamplified using a PCR reaction system consisting of 7.5 μL Taq-Plus PCR MasterMix (2×) (Jiangsu Yugong Life Science Co., Ltd.), 0.3 μL PCR-GS-F (10 μM), 0.3 μL PCR-GS-R (10 μM), 2 μL plasmid mixture, and 4.9 μL ddH₂O. The PCR reaction system was placed in a Biometra PCR Thermal Cycler (Analytical Instruments Jena, Germany) and denatured at 95°C for 5 min, followed by 40 cycles of 94°C for 30 s, 55°C for 30 s, and an extension at 72°C for 45 s. The Taq enzyme was inactivated at 95°C for 15 min to prevent interference with subsequent reactions.

[0045] PstⅠ digestion reaction was performed according to LightNing TM The reaction system was prepared according to the manufacturer's instructions for Pst I (Jiangsu Yugong Life Science Co., Ltd.): 15 μL of the product to be digested (PCR product from the previous step), 2 μL of 10× CutOne Buffer, 1 μL of Pst I, and 12 μL of ddH2O. The reaction was incubated at 37°C for 2 h.

[0046] The primer-free conversion system consisted of 12.5 μL RPA reagent (Hangzhou Zhongce Biotechnology Co., Ltd.), 2 μL Pst I, 10 μL pre-digested product, and 1.25 μL activator (280 mM magnesium acetate). The RPA reagent consisted of RPA dry powder and 12.5 μL PEG 35000. The RPA dry powder contained 5 μg E. coli RecA protein, 2 μg yeast Rad51 protein, 25 μg single-stranded binding protein, 1 μg E. coli DNA polymerase I, 50 μg dNTPs, 125 μg ATP, 25 μg dithiothreitol, and 400 μg creatine phosphate. The PEG 35000 concentration was 10%. The specific steps of primer-free conversion are as follows: preheat the PCR product of the previous step at 95 °C for 3 min, store it at -20 °C for a short time, add 10 μL of the preheated product, 2 μL of PstⅠ, 1.25 μL of activator (MgCl2) and 1.5 μL of activator (MgCl2) to the RPA reagent. 2+ ), and react at 39°C for 2 h.

[0047] The products of primer-free conversion were subjected to native polyacrylamide gel electrophoresis (PAGE). The sample buffer and sample solution were added to an electrophoresis tank containing a 12% native PAGE gel. Electrophoresis was performed using a DYY-7C electrophoresis analyzer (Six One Biotechnology Co., Ltd., Beijing, China) at a constant current of 16 mA for 45 minutes. Afterwards, the samples were stained with Gel-green and imaged using a Molecular Imager Chemi Doc™ XRS+ imaging system (Bio-Rad, Hercules, CA, USA).

[0048] The electrophoresis results are as follows Figure 4 As shown in a, using the 0% mutation abundance sample (pure wild type) as a control, when the mutation abundance was in the range of 0.01%–5%, specific re-extension bands were successfully detected in all samples during the genotype conversion step, while the wild-type control (0% mutation) produced no amplification signal.

[0049] The 136 bp band was then recovered by gel excision and further verified by Sanger sequencing. The product of the present invention was sent to Shanghai Sangon Biotechnology Co., Ltd. for Sanger sequencing. Bands were recovered from a 12% polyacrylamide gel (PAGE) using a UNIQ-10 column-based PAGE gel DNA recovery kit (Shanghai Sangon Biotechnology Co., Ltd.). The procedure was as follows: Use a clean scalpel blade to excise the gel containing the target DNA fragment, place it in a 1.5 ml microcentrifuge tube, and weigh it. Based on the weight and concentration of the gel, add 200 µl of Diffusion Buffer per 100 mg of PAGE gel (if the gel is less than 100 mg, make up to 100 mg with water). Use a pipette to break up any gel fragments soaked in the solution. Centrifuge the solution at 10,000 rpm for 10 minutes. Transfer the supernatant to a clean 1.5 ml microcentrifuge tube and add 5 volumes of Binding Buffer II followed by 3 volumes of 100% isopropanol, mixing thoroughly. Pipette the entire solution into the adsorption column, let it stand at room temperature for 2 minutes, and then centrifuge at 8,000 rpm for 30 seconds. Discard the liquid from the collection tube and place the adsorption column in the same collection tube. Add 500 µl of Wash Solution to the adsorption column and centrifuge at 10,000 rpm for 1 minute. Discard the liquid from the collection tube and place the adsorption column in the same collection tube. Repeat this process once. Place the empty adsorption column and collection tube in a centrifuge and centrifuge at 12,000 rpm for 2 minutes. Place the adsorption column in a clean 1.5 ml centrifuge tube, add 30 μl of ddH2O to the center of the adsorption membrane, let it sit at room temperature for 1–2 minutes, and centrifuge at 12,000 rpm for 1 minute. Store the purified product at -20°C or use it for subsequent experiments.

[0050] Subsequently, 30 μL of the purified product was sent for sequencing analysis. The sequence data were visualized using Chromas software.

[0051] Sanger sequencing results Figure 4 (b) The results for 0% of samples are PCR product sequencing results. The mutant base T is represented by a red peak; the wild-type base C is represented by a blue peak. 5% of samples contained approximately 15,000 copies of the mutant plasmid, and 0.01% contained approximately 30 copies. Sanger sequencing results further confirmed that the wild-type DNA fragment served as an "endogenous primer," selectively enriching the mutant template and achieving genotype conversion under the continuous cleavage of the restriction enzyme.

[0052] The comparison results of 5% mutation abundance sample with genotype conversion and non-genotype conversion are as follows Figure 5 The results show that under genotype conversion, the mutant base T (red peak) can be effectively detected, and under the non-genotype conversion bar, there is only a single peak of the wild type (blue peak), further illustrating the effectiveness of genotype conversion.

[0053] Example 2 Performance of primer-free genotype conversion strategy in gDNA with different mutation abundances To test the performance of a primer-free genotype conversion strategy in the complex background of gDNA, we spiked different concentrations of mutant plasmid into extracted genomic DNA (gDNA) and performed a primer-free genotype conversion strategy, consisting of a three-step reaction: PCR, restriction enzyme digestion, and genotype conversion. The results were then compared with the gold standard method, allele-specific amplification polymerase chain reaction (ARMS-PCR).

[0054] Preparation of gDNA with different mutation abundances: Genomic DNA (gDNA) was obtained from human 293 cells. gDNA was extracted from human 293 cells using a Cellular DNA Rapid Extraction Kit (Beijing Aidlab) according to the manufacturer's protocol. The concentration of the extracted gDNA was determined using a micro-spectrophotometer (QUAWELL, USA). Mutant plasmids were added to the extracted gDNA to prepare gDNA containing varying mutation abundances.

[0055] gDNA with varying mutation abundances was preamplified using a PCR reaction system consisting of 7.5 μL Taq-Plus PCR Master Mix (2×) (Jiangsu Yugong Life Science Co., Ltd.), 0.3 μL PCR-GS-F (10 μM), 0.3 μL PCR-GS-R (10 μM), 3 μL gDNA samples with varying mutation abundances (maintaining the same copy number as the plasmid mixture), and 3.9 μL ddH₂O. The PCR reaction system was placed in a Biometra PCR Thermal Cycler (Analytical Instruments Jena, Germany) and denatured at 95°C for 5 min, followed by 40 cycles of 94°C for 30 s, 55°C for 30 s, and an extension at 72°C for 45 s to obtain PCR products.

[0056] The PCR product was digested with Pst I according to the manufacturer's instructions for LightNing™ Pst I (Jiangsu Yugong Life Science Co., Ltd.). The reaction system consisted of adding 15 μL of the product to be digested (PCR product from the previous step), 2 μL of 10× CutOne Buffer, 1 μL of Pst I, and 12 μL of ddH2O. The reaction was incubated at 37°C for 2 h to obtain the pre-digested product.

[0057] The primer-free conversion system includes: 12.5 μL RPA reagent (Hangzhou Zhongce Biotechnology Co., Ltd.), 2 μL PstⅠ, 10 μL pre-enzyme digestion product, 1.25 μL activator (Mg 2+Specific steps: preheat the enzyme-digested PCR product at 95°C for 3 minutes, store it at -20°C for a short time, add 10 μL of the preheated product, 2 μL of PstⅠ, 1.25 μL of activator (MgCl2) to the RPA reagent. 2+ ), and react at 39°C for 2 h.

[0058] The products were subjected to native polyacrylamide gel electrophoresis (PAGE). The sample buffer and sample solution were added to an electrophoresis tank containing a 12% native PAGE gel. Electrophoresis was performed using a DYY-7C electrophoresis analyzer (Six One Biotechnology Co., Ltd., Beijing, China) at a constant current of 16 mA for 45 minutes. Afterwards, the gel was stained with Gel Green and imaged using a Molecular Imager Chemi Doc™ XRS+ imaging system (Bio-Rad, Hercules, CA, USA).

[0059] The results are as follows Figure 6 As shown in Figure 6a, the sensitivity of gDNA samples with varying mutation abundances decreased slightly compared to mixed plasmid samples, with the effective detection range being 0.1%-5% mutation abundance (Figure 6a). However, samples with 0% (pure wild-type) mutation abundance still did not produce a significant extension at 136 bp, demonstrating the method's good specificity.

[0060] The 136 bp band was similarly excised and recovered from the gel and further verified by Sanger sequencing. The product of the present invention was sent to Shanghai Sangon Biotechnology Co., Ltd. for Sanger sequencing. The excised product from a 12% polyacrylamide gel (PAGE) was recovered using a UNIQ-10 column-based PAGE gel DNA recovery kit (Shanghai Sangon Biotechnology Co., Ltd.). The procedure was the same as in Example 1.

[0061] Sanger sequencing results Figure 6 As shown in b. Figure 6 In b, 0% represents the PCR product sequencing results. The mutant base T is represented by a red peak, and the wild-type base C is represented by a blue peak. 5% of the sample contained approximately 15,000 copies of the mutant plasmid, and 0.1% of the sample contained approximately 300 copies of the mutant plasmid. These results demonstrate that the method of the present invention can effectively detect mutation abundances as low as 0.1% in the complex background of gDNA.

[0062] Example 3 Sensitivity of the gold standard method ARMS-PCR The specific steps of ARMS-PCR are as follows: First, the present invention carefully screened primers for ARMS-PCR. The last base at the 3' end of the upstream primer must be completely complementary to the mutant base and mismatched with the wild-type base. To enhance recognition of the mutant, a mismatch (G→C) was introduced at the second base of the 3' end to enhance selectivity for the mutant. Based on this principle, four primer pairs were screened, and the sequences are as follows:

[0063] First, four pairs of primers were used to amplify the wild-type and mutant plasmids respectively to ensure the specificity of the primers for the mutants. The ARMS-PCR reaction system included: 10 μL Taq-Plus PCR Master Mix (2×) (Jiangsu Yugong Life Science Co., Ltd.), 0.4 μL PCR-ARMS-F (10 μM), 0.4 μL PCR-ARMS-R (10 μM), 1 μL wild-type / mutant plasmid sample (~3×10 5 The PCR reaction system was placed in a Biometra PCR thermal cycler (Analytical Instruments Jena, Germany) and denatured at 95°C for 5 min, followed by 40 cycles of: 94°C for 30 s, 55°C for 30 s, and extension at 72°C for 45 s to obtain ARMS-PCR products.

[0064] The products were subjected to native polyacrylamide gel electrophoresis (PAGE). The sample buffer and sample solution were added to an electrophoresis tank containing a 12% native PAGE gel. Electrophoresis was performed using a DYY-7C electrophoresis analyzer (Six One Biotechnology Co., Ltd., Beijing, China) at a constant current of 16 mA for 45 minutes. Afterwards, the gel was stained with Gel Green and imaged using a Molecular Imager Chemi Doc™ XRS+ imaging system (Bio-Rad, Hercules, CA, USA).

[0065] The results are as follows Figure 7 As shown in Figure a, the primer pair ARMS-PCR-Fb / ARMS-PCR-Ra was able to maximally inhibit wild-type amplification, while all other primer pairs were able to detect wild-type amplification products. Therefore, ARMS-PCR-Fb / ARMS-PCR-Ra was selected as the optimal primer pair.

[0066] Next, in order to test the performance of ARMS-PCR, the present invention uses ARMS-PCR-FbRa to amplify gDNA with different mutation abundances. The specific steps are as follows: The ARMS-PCR reaction system consisted of 10 μL Taq-Plus PCR Master Mix (2×) (Jiangsu Yugong Life Science Co., Ltd.), 0.4 μL PCR-ARMS-Fb (10 μM), 0.4 μL PCR-ARMS-Ra (10 μM), 3 μL gDNA samples of varying mutation abundance, and 6.2 μL ddH₂O. The PCR reaction system was placed in a Biometra PCR Thermal Cycler (Analytical Instruments Jena, Germany) and denatured at 95°C for 5 min, followed by 40 cycles of 94°C for 30 s, 55°C for 30 s, and an extension at 72°C for 45 s to generate ARMS-PCR products.

[0067] The products were subjected to native polyacrylamide gel electrophoresis (PAGE). The sample buffer and sample solution were added to an electrophoresis tank containing a 12% native PAGE gel. Electrophoresis was performed using a DYY-7C electrophoresis analyzer (Six One Biotechnology Co., Ltd., Beijing, China) at a constant current of 16 mA for 45 minutes. Afterwards, the gel was stained with Gel Green and imaged using a Molecular Imager Chemi Doc™ XRS+ imaging system (Bio-Rad, Hercules, CA, USA).

[0068] The results are as follows Figure 7 As shown in b, ARMS-PCR detected gDNA with a mutation abundance of 0.1%, while no effective target bands were detected in gDNA with a mutation abundance of 0.01% and 0%.

[0069] In summary, the method of the present invention achieves comparable sensitivity to the gold standard ARMS-PCR method and can effectively distinguish pure wild-type samples with good specificity. Compared with ARMS-PCR, the advantage of the present method is that it does not require elaborate primer design and screening, making it more applicable for detecting ctDNA of varying lengths in real samples.

[0070] Example 4 Performance of primer-free genotype conversion strategy in real samples To test the performance of the primer-free genotype conversion strategy in clinical samples, we selected 10 clinical samples. We first tested these samples using the gold standard ARMS-PCR method. We then performed a primer-free genotype conversion assay, which involves a three-step reaction: PCR, enzyme digestion, and genotype conversion. The results were compared for consistency.

[0071] Selection and preparation of clinical samples: The mutations detected in this study are common in colorectal cancer, gastric cancer, colorectal cancer, and adenomatous polyps. Therefore, blood samples were collected from five patients with colon cancer, two with rectal cancer, one with colorectal cancer, one with adenomatous polyps, and one with thyroid malignancy. cfDNA was extracted from plasma and serum using the MolPure® Magnetic Circulating Cell-Free DNA Kit (Shanghai Yisheng Biotechnology Co., Ltd.) for testing. The specific steps are as follows: Whole blood was collected from the patient using a blood collection tube containing anticoagulant. Plasma was separated from the whole blood sample by centrifugation at 1500g at 4°C for 15 minutes. Then, 2 mL of plasma sample was transferred to a 15 mL centrifuge tube and mixed with 100 μL of proteinase K. After inversion, 100 μL of lysis buffer was added. After brief vortexing, the tube was incubated at 60°C for 20 minutes, inverting 2-3 times to mix thoroughly. After cooling to room temperature (5-10 minutes), 2.5 mL of binding buffer and 60 μL of magnetic beads (vortex thoroughly) were added to the tube. The tube was briefly vortexed and incubated at room temperature at medium speed for 10 minutes. The tube was transferred to a magnetic rack and allowed to stand for approximately 5 minutes until the beads were completely adsorbed to the tube wall. The supernatant was carefully aspirated. Add 800 μL of Wash Buffer A to the above centrifuge tube and vortex for 20 seconds to thoroughly disperse the magnetic beads. Transfer the magnetic beads and Wash Buffer A to a clean 1.5 mL centrifuge tube, retaining the 15 mL centrifuge tube for rinsing in Step 5. Place the 1.5 mL centrifuge tube in a magnetic rack and let it sit for approximately 1 minute. Once the solution has clarified, aspirate the supernatant and transfer it to the 15 mL centrifuge tube retained in the previous step for rinsing. Transfer the remaining 1.5 mL centrifuge tube to the 1.5 mL centrifuge tube containing the magnetic beads. Once the solution has clarified, carefully aspirate and discard the supernatant. Add 800 μL of Wash Buffer A to the 1.5 mL centrifuge tube, vortex for 20 seconds, centrifuge briefly, and transfer the centrifuge tube to a magnetic rack. Once the solution has clarified, carefully aspirate and discard the supernatant. Add 1 mL of Wash Buffer B to the centrifuge tube, vortex for 1 minute, centrifuge briefly, and transfer the centrifuge tube to a magnetic rack. Once the solution has clarified, carefully aspirate and discard the supernatant. Repeat this process. After a brief centrifugation, place the tube on a magnetic rack and carefully remove any remaining liquid. Leave the tube uncovered at room temperature for 2–5 minutes to allow the ethanol to evaporate completely. Add 40 μL of eluent to the air-dried tube and vortex for 5 minutes. After a brief centrifugation, place the tube on a magnetic rack until the beads are completely adsorbed. Collect the eluent to obtain the desired cfDNA.

[0072] First, ARMS-PCR was used to test 10 samples. The specific steps are as follows: The ARMS-PCR reaction system consisted of 10 μL Taq-Plus PCR Master Mix (2×) (Jiangsu Yugong Life Science Co., Ltd.), 0.4 μL PCR-ARMS-Fb (10 μM), 0.4 μL PCR-ARMS-Ra (10 μM), 3.0 μL clinical sample, and 6.2 μL ddH₂O. The PCR reaction system was placed in a Biometra PCR Thermal Cycler (Analytical Instruments Jena, Germany) and denatured at 95°C for 5 min, followed by 40 cycles of 94°C for 30 s, 55°C for 30 s, and an extension at 72°C for 45 s to generate the ARMS-PCR product.

[0073] The products were subjected to native polyacrylamide gel electrophoresis (PAGE). The sample buffer and sample solution were added to an electrophoresis tank containing a 12% native PAGE gel. Electrophoresis was performed using a DYY-7C electrophoresis analyzer (Six One Biotechnology Co., Ltd., Beijing, China) at a constant current of 16 mA for 45 minutes. Afterwards, the gel was stained with Gel Green and imaged using a Molecular Imager Chemi Doc™ XRS+ imaging system (Bio-Rad, Hercules, CA, USA).

[0074] The results are as follows Figure 8 As shown in a, only sample 4 was detected with an obvious target product, indicating that sample 4 had a mutation.

[0075] Next, perform primer-free genotype conversion detection. The specific steps are as follows: Clinical samples were preamplified using a PCR reaction system consisting of 7.5 μL Taq-Plus PCR Master Mix (2×) (Jiangsu Yugong Life Science Co., Ltd.), 0.3 μL PCR-GS-F (10 μM), 0.3 μL PCR-GS-R (10 μM), 3 μL clinical sample, and 3.9 μL ddH₂O. The PCR reaction system was placed in a Biometra PCR Thermal Cycler (Analytical Instruments Jena, Germany) and denatured at 95°C for 5 min, followed by 40 cycles of 94°C for 30 s, 55°C for 30 s, and an extension at 72°C for 45 s to obtain PCR products.

[0076] The PCR product was digested with Pst I according to the manufacturer's instructions for LightNing™ Pst I (Jiangsu Yugong Life Science Co., Ltd.). The reaction system consisted of adding 15 μL of the product to be digested (PCR product from the previous step), 2 μL of 10× CutOne Buffer, 1 μL of Pst I, and 12 μL of ddH2O. The reaction was incubated at 37°C for 2 h to obtain the pre-digested product.

[0077] The primer-free conversion system includes: RPA reagent (Hangzhou Zhongce Biotechnology Co., Ltd.), 2 μL PstⅠ, 10 μL pre-enzyme digestion product, 1.25 μL activator (Mg 2+ Specific steps: Preheat the PCR product at 95°C for 3 min and store it at -20°C for a short time. Add 10 μL of the preheated product, 2 μL of PstⅠ, 1.25 μL of activator (MgCl2) to the RPA reagent. 2+ ), and react at 39°C for 2 h.

[0078] The products were subjected to native polyacrylamide gel electrophoresis (PAGE). The sample buffer and sample solution were added to an electrophoresis tank containing a 12% native PAGE gel. Electrophoresis was performed using a DYY-7C electrophoresis analyzer (Six One Biotechnology Co., Ltd., Beijing, China) at a constant current of 16 mA for 45 minutes. Afterwards, the gel was stained with Gel Green and imaged using a Molecular Imager Chemi Doc™ XRS+ imaging system (Bio-Rad, Hercules, CA, USA).

[0079] The results are as follows Figure 8 As shown in Figure b, among the primerless genotype conversion results for 12 clinical samples, sample 4 showed a clear band at 136 bp, while no valid target bands were detected in the other samples. The 136 bp band in sample 4 was subsequently recovered by gel excision and further verified by Sanger sequencing.

[0080] The process is as follows: Use a clean scalpel blade to excise the gel containing the target DNA fragment, place it in a 1.5 ml microcentrifuge tube, and weigh it. Based on the weight and concentration of the gel, add 200 µl of Diffusion Buffer per 100 mg of PAGE gel (if the gel is less than 100 mg, make up to 100 mg with water). Use a pipette to break up any gel fragments soaked in the solution. Centrifuge the solution at 10,000 rpm for 10 minutes. Transfer the supernatant to a clean 1.5 ml microcentrifuge tube and add 5 volumes of Binding Buffer II followed by 3 volumes of 100% isopropanol, mixing thoroughly. Pipette the entire solution into the adsorption column, let it stand at room temperature for 2 minutes, and then centrifuge at 8,000 rpm for 30 seconds. Discard the liquid from the collection tube and place the adsorption column in the same collection tube. Add 500 µl of Wash Solution to the adsorption column and centrifuge at 10,000 rpm for 1 minute. Discard the liquid from the collection tube and place the adsorption column in the same collection tube. Repeat this process once. Place the empty adsorption column and collection tube in a centrifuge and centrifuge at 12,000 rpm for 2 minutes. Place the adsorption column in a clean 1.5 ml centrifuge tube, add 30 μl of ddH2O to the center of the adsorption membrane, let it sit at room temperature for 1–2 minutes, and centrifuge at 12,000 rpm for 1 minute. Store the purified product at -20°C or use it for subsequent experiments.

[0081] Subsequently, 30 μL of the purified product was sent for sequencing analysis. The sequence data were visualized using Chromas software.

[0082] The results are as follows Figure 8 As shown in Figure c, a mixed peak of the wild-type base C (blue peak) and the mutant base T (red peak) can be seen at the mutation site in sample 4, confirming the presence of a mutation in sample 4.

[0083] In summary, the detection results of genotype conversion and ARMS-PCR are consistent, which fully confirms the accuracy of this technology and also indicates that it has great application potential in the field of clinical testing.

[0084] It should be noted that the above embodiments are merely examples for the purpose of clearly illustrating the present invention and are not intended to limit the embodiments of the present invention. A person skilled in the art would be able to make other variations or modifications based on the above description. It is not possible to enumerate all embodiments here. Any obvious variations or modifications arising from the technical solution of the present invention remain within the scope of protection of the present invention.

Claims

1. A primer-free isothermal amplification kit, characterized in that: The kit includes detection reagents, each of which includes reagent a, reagent b and reagent c; Each test reagent contains reagent a: 7.5 μL 2× Taq-Plus PCR Master Mix, 0.3 μL upstream primer, 0.3 μL downstream primer, and 4.9 μL ddH2O; Reagent b includes: 2 μL 10× CutOne Buffer, 1 μL PstⅠ, and 12 μL ddH2O; Reagent c includes: RPA reagent, 2 μL of Pst I with a concentration of 20 U / μL, 1.25 μL of Mg-containing 2+ activator.

2. The primer-free isothermal amplification kit according to claim 1, characterized in that The RPA reagent includes: 5 μg of Escherichia coli RecA protein, 2 μg of yeast Rad51 protein, 25 μg of single-stranded binding protein, 1 μg of Escherichia coli DNA polymerase I, 50 μg of dNTP, 125 μg of ATP, 25 μg of dithiothreitol, 400 μg of creatine phosphate, and 12.5 μL of 10% PEG 35000 solution.

3. The primer-free isothermal amplification kit according to claim 1, characterized in that The Mg-containing 2+ The activator is one or more of magnesium acetate, magnesium chloride and magnesium sulfate.

4. The primer-free isothermal amplification kit according to claim 1, characterized in that The upstream primer is: AAGATCCTGTGAGCGAAGTTCCAGCA (SEQ ID NO. 1); the downstream primer is: GAGGGAGATTTCGCTCCTGA (SEQ ID NO. 2).

5. Use of the primer-free isothermal amplification kit according to any one of claims 1 to 4 in the preparation of a single-base mutation site-related disease detection reagent.

6. The use according to claim 5, characterized in that Diseases associated with single-base mutation sites are one or more of colorectal cancer, gastric cancer, non-small cell lung cancer, melanoma, breast cancer, colorectal cancer, thyroid cancer, and adenomatous polyps.

7. A method for detecting single-base mutations by primer-free isothermal amplification for non-diagnostic purposes, characterized in that: The following steps are involved: (1) Extracting cfDNA from samples; (2) Perform PCR amplification on the sample cfDNA using reagent a; (3) Use reagent b to perform enzyme digestion reaction on the PCR product; (4) Use reagent c to perform primer-free genotype conversion on the enzyme-digested PCR product to obtain the product; (5) Detect the product and confirm that the single base mutation is contained in the product.

8. The method according to claim 7, characterized in that The PCR amplification process was as follows: denaturation at 95°C for 5 min, followed by 40 cycles of 94°C for 30 s, 55°C for 30 s, and extension at 72°C for 45 s; the Taq enzyme was then inactivated at 95°C for 15 min.

9. The method according to claim 7, characterized in that The temperature of the enzyme digestion reaction is 35-37°C, and the reaction time is 1.5-2.5h.

10. The method according to claim 7, characterized in that The steps for primer-free genotype conversion are as follows: preheat the enzyme-digested PCR product at 90-95°C for 2-3 minutes, add it to reagent C, and react at 38-40°C for 2-3 hours.

Images