SNP molecular genetic marker of WNT6 gene related to chicken feed conversion rate and application of SNP molecular genetic marker
By developing the WNT6 gene SNP molecular genetic marker at the 22401119 site of the rs733687399 sequence on chicken chromosome 7, the problem of difficulty in improving feed conversion rate in yellow-feathered broiler breeding was solved, and low feed consumption and efficient breeding effects were achieved.
Patent Information
- Application Number
- CN202511111420.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-08
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2045-08-08
AI Technical Summary
Existing technologies are unable to effectively explain the molecular basis of chicken feed conversion efficiency, resulting in high feed costs in yellow-feathered broiler breeding and difficulty in significantly improving feed conversion efficiency through genetic selection.
A SNP molecular genetic marker of the WNT6 gene, which is related to the feed conversion rate of chickens, was developed. The marker is located at position 22401119 of the rs733687399 sequence on chromosome 7 of chickens. By screening and applying this SNP molecular genetic marker, yellow-feathered broiler chickens with low feed conversion rates were selected, thereby reducing feed consumption during the production process.
By screening and applying the SNP molecular genetic marker of the WNT6 gene, the feed consumption of yellow-feathered broilers was significantly reduced, the economic benefits and competitiveness of the enterprise were improved, and an efficient genetic breeding process was achieved.
Smart Images

Figure CN120648818A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of animal genetic breeding and molecular biology, and in particular to a SNP molecular genetic marker of the WNT6 gene associated with the feed conversion rate of chickens and an application thereof. Background Art
[0002] Chicken is the most consumed meat product in the world, boasting advantages such as low fat, high protein, and low price, leading to increasing global demand. Feed is a crucial component of yellow-feathered broiler breeding, accounting for approximately 70% of total feed costs. Improving growth and feeding traits is crucial for controlling feed costs. Feed conversion rate (FCR) is a key feed trait in poultry farming, representing the ratio of kilograms of standard feed to kilograms of weight gain. Understanding the molecular basis of FCR is essential for improving feed conversion efficiency in yellow-feathered broilers. Previous studies have demonstrated that genetic selection can explain 85% to 90% of phenotypic improvements and plays a dominant role in the underlying genetic architecture of feed conversion rate. With the development of low-cost and high-throughput sequencing, various marker genotyping platforms have provided alternatives to array-based genotyping, with single nucleotide polymorphism (SNP) arrays being the most common choice in livestock and poultry.
[0003] Genome-wide association studies (GWAS) have been shown to accurately identify genes underlying economically important traits in chickens. Using imputed whole-genome sequence data, GWAS can fully utilize all markers and detect variants associated with traits without being affected by linkage disequilibrium between SNPs and underlying genes. Over the past decade, the development of chicken SNP panels has provided powerful tools for GWAS, enabling the detection of small, associated chromosomal regions and the performance of single-marker GWAS to identify genomic regions and candidate genes with additive, additive-dominant, dominant, and sex-interaction effects associated with FCR traits. Studies have shown that the WNT6 protein upregulates and amplifies the expression of Pax3 and Pax7 within the dorsal somite. Both Pax3 and Pax7 act on satellite cells during muscle development, promoting their growth and fusion, leading to myofiber hypertrophy and promoting muscle development. The development of WNT6-based SNP molecular markers associated with feed conversion efficiency in chickens could broaden the selection options for yellow-feathered broilers with low feed conversion rates and accelerate genetic selection efforts. Summary of the Invention
[0004] In order to solve the above technical problems, the purpose of the present invention is to provide a SNP molecular genetic marker of the WNT6 gene related to the feed conversion rate of chickens and its application.
[0005] The technical solution of the present invention to solve the above technical problems is as follows: In a first aspect of the present invention, a SNP molecular genetic marker of the WNT6 gene related to the feed conversion rate of chickens is provided. The SNP molecular genetic marker is located at position 22401119 of the rs733687399 sequence on chicken chromosome 7, and the position is a T>G mutation.
[0006] The beneficial effect of the present invention is that there are differences in feed conversion rates between yellow-feathered broiler chickens of different genotypes. The present invention screened and obtained an effect genetic marker affecting the feed conversion rate of yellow-feathered broiler chickens through association analysis between the feed conversion rate of yellow-feathered broiler chickens and whole-genome SNP genetic markers. The genetic marker is located at the 22401119 site of the rs733687399 sequence of the WNT6 gene on chicken chromosome 7 and is named chr7-22401119. When applied to the breeding of yellow-feathered broiler chickens, it can effectively select yellow-feathered broiler chicken individuals with low feed conversion rates, effectively reduce feed consumption in the production process, and improve the economic benefits and competitiveness of the enterprise. The chr7-22401119 genetic marker involved, that is, the mutation site with the SNP number chr7-22401119, can be found in the NCBI chicken genome database (bGalGal1.mat.broiler.GRCg7b).
[0007] Furthermore, G>T mutation indicates different mutant alleles at a site, G is the allele with a high frequency, T is the allele with a low frequency, and the symbol > indicates the frequency of the allele.
[0008] Furthermore, the mutation site and upstream and downstream sequences of the SNP molecular genetic marker are shown in SEQ ID NO. 1, wherein K is the mutation site, and when K is G, it is a chicken with low feed conversion rate; SEQ ID NO.1: 5'-TGGAGCAGGGGCTGGGAGGACGTGGGGGGCCCCAGGAGAGCAGCGCCAGGGCG GTGGGAGCCTTGGCTGGGATTTCTCAGAGGTTGCGGGTGGTTTTGGGTGCTGCAGTCTGAGCTTTCCCTCACTCAGCCAGGCCGGTATCCGGGTTTCCCATCCTCCCCCTATCTGTATTACTACAAACTTTCCTAAAAAGCTTTTTKTTGTTGTTGTTGTTTTGGTTTTTTGGCC AAAACATTCTATTTTTGGTCTCTGTCCAGAGGGGATTTTTTTCCCCCAAGTTTGATTGAATTAATCTGTCTGGCTGTTTTTCAGCTCAAGCAATTGAAGGGAAAATTGTGCTCTTCCCGTTCGAAAAACAAATAAATAAAAATGAAGCCATTAACATCGCAGCATTCGGGCA-3'.
[0009] Furthermore, a method for determining the above-mentioned SNP molecular genetic marker is provided, and the specific steps are as follows: (1) Cultivate healthy yellow-feathered broiler chickens, select the yellow-feathered broiler chickens with the lowest and highest feed conversion rates, and collect blood for preservation; (2) Extract DNA and measure DNA quality; (3) Identify SNP molecular genetic markers associated with feed conversion efficiency traits in yellow-feathered broiler chickens.
[0010] In a second aspect of the present invention, a primer is provided for detecting the above-mentioned SNP molecular genetic marker, wherein the forward primer sequence is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.3; SEQ ID NO.2: 5'-TGGAGCAGGGCTGG-3'; SEQ ID NO. 3: 5'-TGCCCGAATGCTGCG-3'.
[0011] The third aspect of the present invention provides a kit for detecting SNP molecular genetic markers, comprising the above-mentioned primers.
[0012] Furthermore, the kit also includes 2×Taq Master Mix.
[0013] A fourth aspect of the present invention provides the use of the above-mentioned SNP molecular genetic markers or primers or kit in screening chicken individuals or parents with low feed conversion rates.
[0014] The fifth aspect of the present invention provides a method for screening chickens with low feed conversion rate, wherein the above-mentioned SNP molecular markers of the individuals to be screened are amplified and sequenced by PCR technology, and homozygous individuals with the SNP molecular marker genotype of GG are screened as chickens with low feed conversion rate.
[0015] Furthermore, a method for screening chickens with low feed conversion rate based on the above-mentioned kit for detecting SNP molecular genetic markers comprises the following steps: (1) Blood was collected from the wing vein of the individual to be tested, anticoagulated with EDTA, and stored at -20°C for DNA extraction; (2) The kit contains 2×Taq Master Mix, forward and reverse primers; (3) Sequencing the PCR products using the Sanger sequencing method; (4) Select homozygous individuals with GG genotype at position 22401119 on chromosome 7.
[0016] Furthermore, the PCR system was a 20 μL system, including 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O to 20 μL.
[0017] Furthermore, the PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; 35 cycles of denaturation at 94°C for 15 s, annealing at 56°C for 10 s, and extension at 72°C for 30 s; and extension at 72°C for 5 min.
[0018] The present invention has the following beneficial effects: (1) The present invention provides a SNP molecular genetic marker chr7-22401119, which is significantly correlated with the feed conversion rate trait of yellow-feathered broiler chickens and can be used in the breeding of yellow-feathered broiler chickens. In the breeding process, yellow-feathered broiler chickens with low feed conversion rates are selected, which can effectively reduce feed consumption in the production process and improve the economic benefits and competitiveness of the enterprise.
[0019] (2) The present invention provides a primer and a kit for identifying the SNP molecular genetic marker chr7-22401119, which can be used to efficiently screen yellow-feathered broiler chickens with individuals or parents having excellent feed conversion rate traits. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 Manhattan plot for SNP molecular genetic markers; Figure 2 This is the genotype sequencing diagram of SNP molecular genetic markers. DETAILED DESCRIPTION
[0021] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples are only used to explain the present invention and are not intended to limit the scope of the invention. In the embodiments, if specific conditions are not specified, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be purchased commercially.
[0022] Example 1: Screening of SNP molecular genetic markers The screening process of SNP molecular genetic markers specifically includes the following steps: 1872 healthy yellow-feathered broiler chickens were selected and fed a full diet for 49 days. The daily feed intake, initial test body weight, and final body weight of each chicken were recorded, and the feed conversion rate was calculated using the following formula: ; Where, FCR is feed conversion rate; W f is feed consumption; W a To increase the weight of living organisms.
[0023] The lower the FCR value, the lower the feed conversion rate, which means that less feed is consumed for the same production capacity during the production process, that is, feed is saved. DNA was extracted from each sample, and the DNA sample was quality tested. The DNA concentration was tested using QubitFluorometer, and the DNA fragment size and degradation degree were tested using agarose gel electrophoresis. The test results showed that 99 samples were unqualified, and the qualified 1,773 yellow-feathered chicken breeder DNA samples were used for subsequent library construction and sequencing. Simplified genome sequencing was performed using high-throughput production measurement technology. The sequencing data was quality controlled and filtered to remove low-quality sequencing reads and possible false-positive BNP. Feed conversion rate was used as a phenotype and associated with SNP data. GWAS analysis was performed using the EMMAX program (http: / / genetics.cs.ucla.edu / emmax / index.html.), and the analysis model is as follows: y=Xb+Zu+m+e In the model, y represents the true value of the trait record, X represents the fixed effect association matrix, b represents the fixed effect vector, the fixed effect includes batch effect and three principal component effects, Z represents the additive genetic effect association matrix, u represents the individual additive genetic effect vector, e represents the residual, u~N(0, Gσ 2 α ), e~N(0, Iσ 2 ε α), G represents the genomic kinship matrix, I represents the identity matrix, σ 2 α , σ 2 εrepresent the additive genetic effect variance and residual variance, respectively, and m represents the SNP marker effect.
[0024] According to the results of association analysis, a SNP molecular marker associated with the feed conversion rate trait of yellow-feathered broiler chickens was found. The molecular marker is located in the WNT6 gene on chromosome 7 of yellow-feathered broiler chickens, specifically at the 22401119 site of the rs733687399 sequence on chromosome 7 of yellow-feathered broiler chickens, and is named chr7-22401119. Figure 1 As shown in the Manhattan plot, the mutation site and upstream and downstream primer sequences of the SNP molecular genetic marker are shown in SEQ ID NO.1.
[0025] SEQ ID NO.1: 5'-TGGAGCAGGGGCTGGGAGGACGTGGGGGGCCCCAGGAGAGCAGCGCCAGGGCG GTGGGAGCCTTGGCTGGGATTTCTCAGAGGTTGCGGGTGGTTTTGGGTGCTGCAGTCTGAGCTTTCCCTCACTCAGCCAGGCCGGTATCCGGGTTTCCCATCCTCCCCCTATCTGTATTACTACAAACTTTCCTAAAAAGCTTTTTKTTGTTGTTGTTGTTTTGGTTTTTTGGCC AAAACATTCTATTTTTGGTCTCTGTCCAGAGGGGATTTTTTTCCCCCAAGTTTGATTGAATTAATCTGTCTGGCTGTTTTTCAGCTCAAGCAATTGAAGGGAAAATTGTGCTCTTCCCGTTCGAAAAACAAATAAATAAAAATGAAGCCATTAACATCGCAGCATTCGGGCA-3'.
[0026] K is a T>G mutation site. When K is G, chickens have a lower feed conversion rate. 5'- and -3' represent the 5' and 3' ends of the nucleotide sequence, respectively.
[0027] Example 2: Validation of SNP molecular genetic markers 1. The verification of SNP molecular genetic markers specifically includes the following steps: The SNP molecular genetic marker chr7-22401119 obtained in Example 1 was verified in another yellow-feathered broiler chicken population. A total of 1,773 healthy yellow-feathered broiler chickens were fed a full diet for 49 days. The daily feed intake, initial test weight, and final weight of each chicken were recorded, and the feed conversion rate was calculated. 150 individuals with low feed conversion rate (negative value) and high feed conversion rate (positive value) were selected, and blood was collected for DNA extraction.
[0028] Then, the extracted DNA was used as a template, and a forward primer and a reverse primer as shown in SEQ ID NO. 2-3 were added to carry out a PCR reaction.
[0029] SEQ ID NO.2: 5'-TGGAGCAGGGCTGG-3'; SEQ ID NO. 3: 5'-TGCCCGAATGCTGCG-3'.
[0030] The PCR reaction system was a 20 μL system, including 10 μL of 2× Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O to 20 μL.
[0031] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; 35 cycles of denaturation at 94°C for 15 s, annealing at 56°C for 10 s, and extension at 72°C for 30 s; and extension at 72°C for 5 min.
[0032] Finally, the PCR products were sequenced using the Sanger sequencing method.
[0033] 2. Results Analysis Analyze the sequencing results and record the corresponding genotype of each individual according to the sequencing peak graph of each sample (such as Figure 2 (As shown), for genotype TT, only one peak appeared at the corresponding site in the sequencing plot, indicating identical alleles (T). For genotype TG, two peaks appeared at the corresponding site in the sequencing plot, indicating different alleles (one G and one T). For genotype GG, only one peak appeared at the corresponding site in the sequencing plot, indicating identical alleles (both G). One-way analysis of variance (ANOVA) using SPSS 26.0 was used to analyze the relationship between SNP marker genotypes and alleles and feed conversion efficiency. The results are shown in Tables 1 and 2.
[0034] Table 1 Statistical table of the distribution differences of SNP molecular genetic marker genotypes between low feed conversion rate and high feed conversion rate
[0035] Table 2 Statistical table of the distribution differences of SNP molecular genetic marker alleles between low feed conversion rate and high feed conversion rate
[0036] The results in the table show that at the SNP molecular genetic marker chr7-22401119, both genotype and allele frequencies differed significantly between the low and high feed conversion rate groups (P < 0.01). In the low feed conversion rate group, the frequency of the G allele was higher than the T allele, and the frequency of the GG genotype was higher than the TT genotype, indicating that individuals with the GG genotype at position 201 exhibited a superior feed conversion phenotype compared to those with the TT genotype. This further demonstrates that the polymorphism at the screened SNP molecular genetic marker chr7-22401119 is significantly associated with feed conversion rate, making it a SNP locus associated with feed conversion rate and potentially useful for breeding yellow-feathered broilers for low feed conversion rates.
[0037] Example 3: Assisted molecular breeding method for feed conversion efficiency trait of yellow-feathered broiler chickens based on SNP molecular genetic marker chr7-22401119 The invention provides a kit for detecting a SNP molecular genetic marker chr7-22401119. The kit comprises 2×Taq Master Mix, forward and reverse primers as shown in SEQ ID NO. 2-3, and ddH2O.
[0038] The specific method includes the following steps: (1) Blood was collected from the wing vein of the yellow-feathered broiler chickens to be tested, anticoagulated with EDTA, and stored at -20°C for DNA extraction.
[0039] (2) PCR was performed on the DNA extracted product from step (1). The PCR reaction system was a 20 μL system, including 10 μL of 2×Taq Master Mix, 1 μL of forward and reverse primers, 1 μL of DNA template, and ddH2O to 20 μL. The PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 15 s, annealing at 56°C for 10 s, and extension at 72°C for 30 s, for 35 cycles; and extension at 72°C for 5 min.
[0040] (3) Sequence the PCR product from step (2) using the Sanger sequencing method.
[0041] (4) Genotyping was performed based on the sequencing results, and homozygous individuals with the SNP molecular genetic marker chr7-22401119 GG genotype were screened for breeding to reduce feed conversion rate, effectively reduce feed consumption and breeding costs; the individuals with this marker were selected to join the core breeding group, which can achieve rapid homozygosity of the alleles related to this trait and provide technical support for accelerating the progress of genetic selection.
[0042] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A SNP molecular genetic marker of the WNT6 gene associated with feed conversion efficiency in chickens, characterized in that: The SNP molecular genetic marker is located at position 22401119 of the rs733687399 sequence of chicken chromosome 7, and the position is a T>G mutation.
2. The SNP molecular genetic marker of the WNT6 gene associated with chicken feed conversion efficiency according to claim 1, characterized in that: The mutation site and upstream and downstream sequences of the SNP molecular genetic marker are shown in SEQ ID NO. 1, wherein K is the mutation site. When K is G, the chicken has a low feed conversion rate.
3. A primer for detecting the SNP molecular genetic marker according to claim 1 or 2, characterized in that: The forward primer sequence is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.
3.
4. A kit for detecting the SNP molecular genetic marker according to claim 1 or 2, characterized in that: Comprising the primer according to claim 3.
5. Use of the SNP molecular genetic marker according to claim 1 or 2, the primer according to claim 3, or the kit according to claim 4 in screening chicken individuals or parents with low feed conversion efficiency.
6. A method for screening chickens with low feed conversion rate, characterized in that: The SNP molecular markers of the individuals to be screened according to claim 1 or 2 are amplified and sequenced by PCR technology, and homozygous individuals with SNP molecular marker genotypes of GG are screened as low feed conversion rate chickens.
Citation Information
Patent Citations
Yellow feather broiler feed conversion efficiency related gene, SNP molecular marker and application
CN117551784A
ST3GAL4 gene SNP molecular marker related to feed conversion rate of yellow feather broilers and application of ST3GAL4 gene SNP molecular marker
CN119162341A
Adenosine triphosphatase sarcoplasmic / endoplasmic reticulum Ca2+ transporting 2 (ATP2A2) gene-based molecular marker for identifying chicken feed efficiency trait, and identification method and use thereof
US20250043365A1