Primer of MEP1B gene molecular marker related to pig average daily gain character and application of primer

Abstract

The invention relates to a primer of an MEP1B gene molecular marker related to the average daily gain character of pigs and application of the primer, and belongs to the technical field of biology. The MEP1B gene molecular marker is located at the 116042900th basic group of chromosome 6 of a pig reference genome Sscrofa11.1 version and has C / T polymorphism, and the average daily gain of the TT genotype of the site is obviously higher than that of a CC genotype pig. According to the present invention, the forward and reverse primer pair is used to amplify the fragment containing the molecular marker site, and the amplification product is subjected to Sanger sequencing so as to rapidly and accurately identify the genotype of the individual; the molecular marker can be used as a genetic marker for pig breeding to breed pigs with proper weight; the method can be used for efficiently and accurately detecting the average daily gain character of the pigs, and has an important value for breeding and production of the pigs.

Description

Technical Field

[0001] The invention relates to a primer for a MEP1B gene molecule marker related to the average daily weight gain trait of pigs and application thereof, belonging to the field of biotechnology. Background Art

[0002] In modern pig farming, average daily gain (ADG) and age at 100 kg (AGE) are important indicators for assessing pig growth performance and economic profitability. A high ADG means pigs can reach their target weight in a shorter time, shortening the rearing cycle and reducing feed and labor costs, thereby improving pig farm profitability. To achieve this, pig farms must optimize feed formulations, strengthen scientific management, and ensure the health of their pigs. AGE, as a measure of the growth cycle, directly impacts production efficiency, meat quality, and carcass value. A reasonable AGE helps maintain optimal growth rates and high-quality meat. Excessively long AGEs can lead to slower growth and reduced meat quality, impacting carcass value; while too short AGEs can compromise meat quality. Therefore, meticulous feeding management and effective disease control are crucial to ensuring an appropriate AGE.

[0003] By optimizing feeding management, improving feed utilization, and selecting superior pig breeds, pig farms can simultaneously increase ADG and control AGE. This not only boosts overall profitability but also meets market demand for high-quality pork. These measures lay a solid foundation for the transformation and upgrading of the pig farming industry, driving it towards efficiency, environmental protection, and sustainability.

[0004] Therefore, using molecular markers to accurately identify genotypes associated with average daily gain and applying them to early breeding selection can speed up the breeding cycle, reduce time and feeding costs, and improve resource utilization. Summary of the Invention

[0005] The purpose of the present invention is to address the defects of the existing technology and propose a primer for the MEP1B gene molecular marker related to the average daily gain trait of pigs and its application, which can quickly and accurately evaluate the average daily gain of pigs at different growth stages.

[0006] The MEP1B gene is associated with weight gain. Studies have shown that MEP1B plays an important regulatory role in weight gain and is related to pig growth and development, suggesting that the MEP1B gene may be closely linked to weight gain.

[0007] The present invention measured the average daily weight gain of pigs, performed whole-genome SNP genotyping using second-generation sequencing technology, and screened the MEP1B gene molecular marker significantly correlated with the average daily weight gain trait of pigs through whole-genome association analysis, providing new gene and molecular marker resources for the selection and breeding of pigs for the average daily weight gain trait.

[0008] The present invention solves the technical problem through the following technical solution: First, a molecular marker of the MEP1B gene related to the average daily weight gain of pigs is provided. The nucleotide sequences of the SNP primers corresponding to the molecular marker are shown in SEQ ID NO: 1 and SEQ ID NO: 2. The molecular marker site is located at base 116042900 on chromosome 6 of the pig reference genome Sscrofa11.1 version, and the base mutation is C or T. The sequence is shown at base 251 in SEQ ID NO: 3 or SEQ ID NO: 4.

[0009] The present invention further provides an application of a molecular marker of the MEP1B gene associated with pig average daily gain, wherein the SNP primer is used to detect the pig average daily gain trait. Specifically, the method for detecting the SNP genotype associated with the pig average daily gain trait by PCR amplification combined with Sanger sequencing comprises the following steps: The first step is to provide a DNA sample of a pig to be tested, and perform PCR amplification using a DNA specific primer pair designed for the MEP1B gene molecular marker to obtain an amplified product. The pig DNA sample to be tested contains the SNP molecular marker at base 116042900 of porcine chromosome 6.

[0010] The second step is to perform Sanger sequencing on the PCR products.

[0011] The third step is to determine the SNP molecular marker genotype at base 116042900 of pig chromosome 6 based on the sequencing results of the second step.

[0012] Wherein, the deoxyribonucleotide sequence of the DNA specific primer pair described in the first step is: Upstream primer: 5'-ATTTTGCCAGGGACCAGATCA-3' (SEQ ID NO: 1) Downstream primer: 5'- AAAAGCTTCTGTTCCCACTTTG -3' (SEQ ID NO: 2) The amplified product in the first step is 204 bp in length, including the 116,042,900th base of porcine chromosome 6.

[0013] The final concentration of the reaction system (25 μl) is: 50 ng of pig DNA to be tested 2 x Accurate Taq Master Mix 12.5μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl.

[0014] The reaction conditions of the PCR amplification are as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 4°C.

[0015] In the third step, the judgment criterion is that the average daily weight gain of individuals with T / T genotype at the SNP site is higher.

[0016] The present invention discovered that at a specific locus in the MEP1B gene, pigs with a specific genotype have significantly higher average daily weight gain than individuals with other genotypes. Specifically, pigs with the T / T genotype have higher average daily weight gain than those with the T / C and C / C genotypes, while pigs with the T / C genotype have higher average daily weight gain than those with the C / C genotype. This discovery provides new genetic markers and selection methods for pig breeding and production.

[0017] To rapidly and accurately identify pig average daily gain, the present invention uses genomic DNA from the pig being tested as a template and employs specific primers for PCR amplification. These primers are designed based on a single nucleotide polymorphism (SNP) site in the MEP1B gene associated with the target trait, accurately amplifying a DNA fragment containing the SNP site. The PCR amplification product is then subjected to Sanger sequencing, and the SNP molecular marker genotype of the pig's MEP1B gene can be determined from the sequencing results.

[0018] In breeding practice, based on breeding goals, breeders can select pigs with higher average daily weight gain by eliminating individuals with the T / C and C / C genotypes and retaining individuals with the T / T genotype. This method is not only efficient and rapid, but also significantly improves the uniformity of the average daily weight gain of the pig herd, providing a scientific basis for early pig breeding.

[0019] Furthermore, the detection method disclosed in the present invention is simple and easy to use, and can be widely implemented under laboratory conditions, greatly facilitating pig breeding and production practices. This discovery is not only of great value for pig breeding, but also provides a useful reference and reference for the genetic improvement of other livestock. Furthermore, the detection method disclosed in the present invention is simple and easy to use, and can be implemented in the laboratory. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the Manhattan plot of the longitudinal trait association analysis of the average daily weight gain of pigs in four periods.

[0021] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the three genotypes. DETAILED DESCRIPTION

[0022] The following examples are applicable to pig breeding.

[0023] Example 1 In this example, the average daily weight gain of 500 Large White pigs was measured, and whole-genome SNP genotyping was performed using second-generation sequencing technology. The MEP1B gene molecular marker significantly associated with average daily weight gain was screened through whole-genome association analysis. The results are as follows: Figure 1 shown.

[0024] In this example, the following experiments were conducted to identify and apply the MEP1B gene molecular marker related to the average daily gain of pigs.

[0025] 1. Phenotypic and genotypic testing (1) Experimental materials and average daily weight gain phenotype determination 500 Large White pigs were selected as experimental animals and raised under the same feeding conditions with free access to food and water throughout the whole process. The average daily weight gain of the 500 pigs was recorded as the phenotypic data of the average daily weight gain of the pigs.

[0026] (2) Extraction of genomic DNA ① Place 25 mg of left and right ear tissue in a centrifuge tube, add it to a 1.5 ml centrifuge tube, add 400 µl of Buffer Digestion, and vortex to mix. Incubate at 65°C in a water bath for 1 hour until the cells are completely lysed.

[0027] ② Add 20 μL of Proteinase K solution, shake to mix, and place in a 56°C water bath for overnight digestion.

[0028] ③ Add 500 µl of Buffer PA, mix thoroughly by inversion, and place in a -20°C refrigerator for 5 min.

[0029] ④ Centrifuge at 10,000 rpm for 5 min at room temperature and transfer the supernatant (500-550 µl) to a new 1.5 ml centrifuge tube.

[0030] ⑤ Add an equal volume of isopropanol, invert 5-8 times to mix thoroughly, and let stand at room temperature for 2-3 minutes. Centrifuge at 10,000 rpm for 5 minutes at room temperature and discard the supernatant.

[0031] ⑥ Add 1 ml of 75% ethanol, rinse by inversion for 1-3 minutes, centrifuge at 10,000 rpm for 2 minutes, and discard the supernatant.

[0032] ⑦Repeat step 6.

[0033] ⑧Open the lid and invert at room temperature for 5-10 minutes until the remaining ethanol is completely evaporated.

[0034] ⑨ Dissolve the resulting DNA in 50-100 µl of TE Buffer. The extracted DNA can be used immediately for the next step or stored at -20°C.

[0035] ⑩ Determine the concentration. After checking the mass and concentration using a spectrophotometer, dilute the sample to 50 ng / μL and store at -20°C for later use.

[0036] (3) PCR amplification The fragment containing the 116,042,899th base of chromosome 6 was amplified using the genomic DNA extracted as a template.

[0037] Upstream primer: 5'-ATTTTGCCAGGGACCAGATCA-3' (SEQ ID NO: 1) Downstream primer: 5'- AAAAGCTTCTGTTCCCACTTTG -3' (SEQ ID NO: 2) The final concentration of the reaction system (25 μl) is: DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl.

[0038] The reaction conditions for PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; storage at 4°C; 10 μl was taken for agarose detection, and a single target band with a length of 450 bp was amplified to obtain a SNP molecular marker at base site 116042900 of porcine chromosome 6.

[0039] The sequence of the amplified product is shown in SEQ ID NO: 3 AGGAATCCTTTGGTACCTCTGCAATCACATTCCAAAATGTGGCCTTCCCTGGCAGGCAGCCTCAATTCCTTTAGGACAGTATAAATGAACAAGCTCCAGATTTGCCAGGGACCAGATCACAGCATCATTTAATTATTTTGAGCTCTGCCCTAATTGTGTTTCACGTTACCTGTGATTCCCTACCACCAGAAGCTATGATGATGTTAAACATAATCCATGAATATAACTTGCTTTTTCAGATGACGGAACCTATTTTTGGGACAGGCCTTCCAAAGTGGGAACAGAAGCTTTTTTCCCAAATGGAACTCAATTTAAAAGAAGTAGAGGCTATGGATCCAGTTCCTTTATAACCTATGAGAGGCTGAAGAGCAGGGATTTTATCAAAGGAAATGATGTTTACATCCTACTGACAGTGGAAGGTATGTCAATAAAAATAGTTTCATCTAAGCT, or as shown in SEQ ID NO: 4, AGGAATCCTTTGGTACCTCTGCAATCACATTCCAAAATGTGGCCTTCCCTGGCAGGCAGCCTCAATTCCTTTAGGACAGTATAAATGAACAAGCTCCAGATTTGCCAGGGACCAGATCACAGCATCATTTAATTATTTTGAGCTCTGCCCTAATTGTGTTTCACGTTACCTGTGATTCCCTACCACCAGAAGCTATGATGATGTTAAACATAATCCATGAATATAACTTGCTTTTTCAGATGACGGAACTTATTTTTGGGACAGGCCTTCCAAAGTGGGAACAGAAGCTTTTTTCCCAAATGGAACTCAATTTAAAAGAAGTAGAGGCTATGGATCCAGTTCCTTTATAACCTATGAGAGGCTGAAGAGCAGGGATTTTATCAAAGGAAATGATGTTTACATCCTACTGACAGTGGAAGGTATGTCAATAAAAATAGTTTCATCTAAGCT。

[0040] (4)Sanger sequencing and genotyping The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peaks of different genotypes were obtained as shown in the following figure. Figure 2 shown.

[0041] (5) Pig genome 60K SNP chip genotyping and genome-wide association analysis Whole-genome genotyping of pigs was performed according to the company's standard procedures. SNP genotyping was performed on individual pigs with recorded average daily gain using the "Zhongxin No. 1" pig 50K SNP array. All SNP marker detection results were quality-controlled. Genome-wide association analysis revealed that genomically significant SNPs were concentrated on porcine chromosome 6.

[0042] 2. Correlation Analysis 500 Large White pigs with clear records of average daily gain (ADG) phenotypes were selected and recorded. Statistical tests were performed using the ANOVA function in R 4.2 statistical plotting software, using a pairwise mean comparison model to compare the genotypes and ADG of the experimental pigs. P < 0.05 indicated significant differences. The results showed that the average ADG of individuals with the T / T genotype was 832 g, higher than the 760 g of individuals with the T / C genotype and the 753 g of individuals with the C / C genotype (P < 0.05). Molecular markers of the porcine MEP1B gene were significantly associated with ADG, as shown in Table 1. Based on actual breeding goals, individuals with the T / T genotype can be selected to select pigs with higher ADG, thereby improving overall ADG and uniformity, and enhancing breeding efficiency.

[0043] Table 1 MEP1B genotype frequencies

[0044] In addition to the above embodiments, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the scope of protection required by the present invention.

Claims

1. A primer for a molecular marker of the MEP1B gene associated with the average daily gain trait of pigs, characterized by: The nucleotide sequences of the primers are shown in SEQ ID NO: 1 and SEQ ID NO:

2. The molecular marker site is located at base 116042900 of chromosome 6 of the pig reference genome Sscrofa11.1 version, and the base mutation is C or T.

2. The use of primers for the MEP1B gene molecular marker associated with the average daily gain trait of pigs according to claim 1, characterized in that: The primers are used to detect the average daily weight gain of pigs. The detection method includes the following steps: The first step is to perform PCR amplification on a pig DNA sample to be tested using the SNP primers shown in SEQ ID NO: 1-2 to obtain an amplified product. The amplified product is 204 bp in length and contains base 116,042,900 of pig chromosome 6. The second step is to perform Sanger sequencing on the PCR products; The third step is to determine the SNP molecular marker genotype of the 116042900th base of chromosome 6 of the pig reference genome Sscrofa11.1 version based on the sequencing results of the second step.

3. The use of primers for the MEP1B gene molecular marker associated with the average daily gain trait of pigs according to claim 2, characterized in that: In the first step, the PCR reaction system is based on 25 μl. 50 ng of pig DNA to be tested 2 x Accurate Taq Master Mix 12.5μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl.

4. The use of primers for the MEP1B gene molecular marker associated with the average daily gain trait of pigs according to claim 3, characterized in that: The reaction conditions for PCR amplification in the first step are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 4°C.

5. The use of primers for the MEP1B gene molecular marker associated with the average daily gain trait of pigs according to claim 2, characterized in that: The nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO:

4.

6. The use of primers for the MEP1B gene molecular marker associated with the average daily gain trait of pigs according to claim 2, characterized in that: The judgment standard of the third step is that the average daily weight gain of pigs with T / T genotype at the SNP site is higher than that of individuals with T / C and C / C genotypes, and the average daily weight gain of pigs with T / C genotype is higher than that of individuals with C / C genotype.

Images