Method for rapidly identifying male parent source of banana filial generation
Through the PCR amplification and sequencing comparison method of mitochondrial-specific primers nad1/2-3F and nad1/2-3R, the problem of unclear paternal origin in banana hybrid breeding was solved, rapid and accurate paternal identification was achieved, breeding efficiency was improved and the breeding cycle was shortened.
Patent Information
- Application Number
- CN202510763419.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-09
- Publication Date
- 2025-09-16
AI Technical Summary
In banana hybrid breeding, it is difficult to identify the origin of the paternal parent, especially when multiple paternal parents are involved in the hybridization and insect pollination occurs. It is difficult to accurately and quickly determine the paternal origin of the hybrid offspring, resulting in low breeding efficiency.
Mitochondrial-specific primers nad1/2-3F and nad1/2-3R were used for PCR amplification. Mitochondrial DNA was amplified and sequenced, and the paternal origin was determined by multiple sequence alignment. Polymorphic sites in the mitochondrial sequence were used for identification.
It has achieved rapid and accurate identification of the paternal origin of banana hybrid offspring, improved breeding efficiency, reduced workload and shortened the breeding cycle.
Smart Images
Figure CN120648835A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of banana cultivation, in particular to a method for rapidly identifying the male parent origin of banana hybrid offspring. Background Art
[0002] Bananas (Musa spp.) belong to the genus Musa, family Musaceae, order Musaceales, class Monocotyledons. Most cultivated banana species have evolved from two wild species, M. balbisiana and M. acuminata, and their interspecific hybridization.
[0003] During meiosis, a process of sexual reproduction in triploid plants, chromosome pairing is disrupted, resulting in an abnormal chromosome number in gametes, making them less viable and highly sterile. However, triploids are not completely sterile. During meiosis, some plants may produce a small number of fertile gametes due to abnormal chromosome segregation, recombination, or abortion, though the probability is relatively low. Existing banana varieties are primarily developed through breeding methods such as bud mutation selection, mutagenesis, and ploidy breeding. However, with the increasing severity of pests and diseases, researchers have gradually realized that hybridization offers the greatest potential for bananas. This method utilizes the residual female fertility of a very small number of cultivated banana varieties through interspecific or distant hybridization with wild diploid bananas, which have highly fertile pollen, to create new varieties. Hybridization significantly broadens the genetic base of new banana varieties, combining the advantageous traits of both parents and producing traits that surpass both parents. This plays a crucial role in enhancing stress resistance and promoting varietal diversification.
[0004] During banana hybrid breeding, each female parent is paired with a wild male parent with complementary traits, depending on the breeding objectives. Due to the low fertility of the female parent, a massive amount of cross-pollination is typically required to obtain a population of hybrid offspring containing a sufficient number of individuals. Consequently, long work cycles, a high workload, and low efficiency are drawbacks of banana hybrid breeding. Obviously, in such a complex breeding process, it is difficult to isolate pollination and label offspring for tracking and tracing the origins of different hybrid combinations. In practice, to reduce the workload, the parental origins of each hybrid offspring are often identified only after obtaining and selecting superior individuals from the population. Regarding maternal parent identification, since cultivars with minimal fertility are rare and the traits of their hybrid offspring tend to be more maternal, the maternal origin can be directly determined by the phenotypic traits of the offspring. As for the identification of the paternal source, firstly, there are multiple paternal parents used in the hybridization process, and there is a possibility of insect-coal-powder contamination when not bagged; secondly, its morphological characteristics are usually not easy to show in the offspring. Therefore, it is particularly important to accurately and quickly identify the paternal source of the hybrid offspring. Summary of the Invention
[0005] The object of the present invention is to provide a method for quickly identifying the paternal origin of banana hybrid offspring, so as to solve the problems raised in the above background technology.
[0006] To achieve the above object, the present invention provides the following technical solutions:
[0007] A method for rapidly identifying the male parent origin of banana hybrid offspring comprises the following steps:
[0008] 1.1. Extract total DNA from leaves of banana hybrid progeny and candidate male parents;
[0009] 1.2. PCR amplification of the DNA was performed using mitochondrial-specific primers: nad1 / 2-3F (5'→3'): GCATTACGATCTGCAGCTCA and nad1 / 2-3R (5'→3'): GGAAGCCGATTAGTTTCTGC; the amplified product size was 1100-2000 bp;
[0010] 1.3. Sequence the PCR amplification product to obtain the mitochondrial target region sequence; 1.4. Perform multiple sequence alignment of the mitochondrial sequences of the hybrid offspring with those of the candidate fathers, and determine the paternal origin through specific polymorphic sites;
[0011] The candidate male parents include 9 diploid wild banana materials: Musa acuminatassp. banksii, Pisang lilin, M.acuminata ssp.SH-3142, M.acuminata ssp.malaccensis, M.itinerans, M.nagensium, ITC0997, M.balbisiana and M.cheesmanii.
[0012] As a further solution of the present invention: wherein, the DNA extraction in step 1.1 adopts a modified CTAB method, specifically comprising:
[0013] Fresh healthy leaves were selected, ground with liquid nitrogen, and lysed with an extraction buffer containing 2% CTAB, 1% PVP, 100 mM Tris-HCl (pH 8.0), 20 mM EDTA, and 1.4 M NaCl. Total DNA was obtained after extraction with chloroform-isoamyl alcohol and precipitation with isopropanol.
[0014] As a further solution of the present invention: wherein, the PCR reaction system in step 1.2 is (50 μL):
[0015] ddH2O 33.75μL, 10× PCR Buffer 5μL, dNTP 5μL, forward primer 1μL, reverse primer 1μL, template DNA 4μL, LA Taq DNA polymerase 0.25μL.
[0016] As a further solution of the present invention: wherein, the PCR reaction parameters in step 1.2 are:
[0017] Pre-denaturation at 94°C for 4 min; denaturation at 94°C for 1 min, annealing at 57.5°C for 0.5 min, extension at 72°C for 2 min, for a total of 35 cycles; final extension at 72°C for 7 min.
[0018] As a further embodiment of the present invention, the method is used for rapid identification of the paternal origin of offspring in banana hybrid breeding.
[0019] As a further solution of the present invention: wherein, the primer combination is: nad1 / 2-3F (5'→3'): GCATTACGATCTGCAGCTCA and nad1 / 2-3R (5'→3'): GGAAGCCGATTAGTTTCTGC, which are used to amplify the mitochondrial nad1 / 2-3 region, and the product size is 1100-2000bp.
[0020] Compared with the prior art, the present invention has the following beneficial effects:
[0021] This method utilizes mitochondrial DNA molecular markers, using nad1 / 2-3 primers to sequence sequences amplified by PCR. Multiple sequence alignment allows for the differentiation and identification of different paternal materials, effectively resolving the issue of unclear parental origins in banana hybrid breeding, which arises from multiple, heterogeneous, and chaotic paternal parentage. Overall, this study optimizes hybrid parent selection strategies for banana hybrid breeding by rapidly identifying the paternal origins of banana hybrid offspring, further improving the phylogenetic relationships within the genus Musa, and is expected to be applied in banana hybrid breeding to shorten breeding cycles and improve efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 Schematic diagram of the multiple sequence alignment of 9 paternal materials in the present invention. DETAILED DESCRIPTION
[0023] See also Figure 1 A method for rapidly identifying the male parental origin of banana hybrid offspring comprises the following steps:
[0024] S100. Preparation of experimental materials. Nine diploid wild banana materials were selected: Musa acuminata ssp. banksii, Pisang lilin, M. acuminata ssp. SH-3142, M. acuminata ssp. malaccensis, M. itinerans, M. nagensium, ITC0997, M. balbisiana, and M. cheesmanii. Specific sources are shown in Table 1.
[0025] Table 1 Test materials
[0026] S101. DNA extraction (modified CTAB method): approximately 0.5 g of fresh leaves were placed in a mortar and ground into powder with liquid nitrogen.
[0027] Transfer the powder into a 1.5 mL centrifuge tube, add 600 μL of CTAB extraction buffer (containing 2% CTAB, 1% PVP, 100 mM Tris-HCl pH 8.0, 20 mM EDTA, 1.4 M NaCl) preheated to 65°C, gently invert to mix, and place in a 65°C water bath for 30 minutes, inverting to mix every 10 minutes.
[0028] After cooling to room temperature, an equal volume of chloroform-isoamyl alcohol (24:1) was added, mixed by inversion for 10 min, and centrifuged at 12000 rpm for 15 min.
[0029] Transfer the supernatant to a new centrifuge tube, add 2 / 3 volume of pre-cooled isopropanol, shake gently until the DNA precipitates, and centrifuge at 12000 rpm for 10 min.
[0030] The supernatant was discarded, and the precipitate was washed twice with 75% ethanol. After drying at room temperature, 50 μL TE buffer (containing 20 μg / mL RNase A) was added to dissolve the DNA and stored at -20°C until use.
[0031] S102. PCR amplification of the mitochondrial-specific region: Primer design is shown in Table 2.
[0032] Table 2 Mitochondrial primers
[0033]
[0034] The PCR reaction system (50 μL) is shown in Table 3
[0035] Table 3 PCR reaction system
[0036]
[0037] PCR reaction parameters are shown in Table 4 below
[0038] Table 4 PCR reaction parameters
[0039]
[0040]
[0041] Product detection: Take 5 μL of PCR product, run it on 1% agarose gel electrophoresis (120 V, 30 min), observe it under a UV imaging system, and confirm that a target band of 1000-2000 bp is amplified.
[0042] S103, Sequencing and Sequence Alignment:
[0043] Sequencing: Send the PCR product to a sequencing company (such as Boshang Biotechnology Co., Ltd.) for sequencing. Fragments below 800 bp are sequenced in a unidirectional manner, and fragments above 800 bp are sequenced in a bidirectional manner and then spliced together to obtain the complete mitochondrial target region sequence.
[0044] Multiple sequence alignment: DNAMAN software was used to align the hybrid offspring sequences with the reference sequences of 9 candidate paternal parents, and the paternal origin was determined by the following specific polymorphic sites: Based on the amplified M. itinerans sequence, M. acuminata ssp. banksii has a G at position 824, which is different from the other paternal parents. Pisanglilin has a base deletion at position 293, which is different from the other paternal parents. M. acuminata ssp. SH-3142 has AA at positions 278-289, which is different from the other paternal parents. At positions 1528 and 1534, the bases of M. acuminata ssp. malaccensis are G and C, respectively, the bases of M. itinerans are G and A, respectively, and the bases of the other paternal parents are T and C, respectively. Therefore, the former two are distinguished from each other and the other paternal parents. The bases of M. nagensium are GC at positions 279-280, which is different from the other paternal parents. ITC0997 differs from other male lines by having C and T at positions 826 and 1198, respectively. M. balbisiana differs from other male lines by having A at position 1164. M. cheesmanii differs from other male lines by having A at position 1180.
[0045] This method extracts DNA from the leaves of the hybrid offspring when multiple paternal parents are involved in hybridization and there is a risk of insect-pollination in banana hybrid breeding. The mitochondrial sequences are amplified and compared using the above method to quickly exclude non-target paternal parents and determine the true paternal source. For example, if a certain offspring sequence is G at position 824, the paternal parent is M. acuminatassp. banksii. By accurately identifying the paternal parent, invalid screening caused by marker confusion in traditional breeding is avoided, and the workload of tracking hybrid combinations is reduced. For example, this method can identify the paternal parent of 100 offspring at one time, which is more than 80% more efficient than traditional morphological methods. Mitochondrial sequence polymorphism can be used to analyze the genetic relationship between different paternal parents. For example, the difference between M. acuminatassp. malaccensis and M. itinerans at position 1534 (C vs. A) indicates that the two belong to different genetic branches.
[0046] The above is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with this technical field, within the technical scope disclosed by the present invention, who makes equivalent replacements or changes based on the technical solutions and inventive concepts of the present invention, should be covered by the scope of protection of the present invention.
Claims
1. A method for rapidly identifying the male parental origin of banana hybrid offspring, characterized in that: The following steps are involved: 1.
1. Extract total DNA from leaves of banana hybrid progeny and candidate male parents; 1.
2. PCR amplification of the DNA was performed using mitochondrial-specific primers: nad1 / 2-3F (5'→3'): GCATTACGATCTGCAGCTCA and nad1 / 2-3R (5'→3'): GGAAGCCGATTAGTTTCTGC; the amplified product size was 1100-2000 bp; 1.
3. Sequence the PCR amplification product to obtain the mitochondrial target region sequence; 1.
4. Perform multiple sequence alignment of the mitochondrial sequences of the hybrid offspring with those of the candidate fathers, and determine the paternal origin through specific polymorphic sites; The candidate male parents include 9 diploid wild banana materials: Musa acuminata ssp. banksii, Pisang lilin, M. acuminata ssp. SH-3142, M. acuminata ssp. malaccensis, M. itinerans, M. nagensium, ITC0997, M. balbisiana and M. cheesmanii.
2. The method according to claim 1, characterized in that In step 1.1, DNA extraction is performed using a modified CTAB method, specifically comprising: Fresh healthy leaves were selected, ground with liquid nitrogen, and lysed with extraction buffer containing 2% CTAB, 1% PVP, 100 mM Tris-HCl (pH 8.0), 20 mM EDTA, and 1.4 M NaCl. Total DNA was obtained after chloroform-isoamyl alcohol extraction and isopropanol precipitation.
3. The method according to claim 1, characterized in that The PCR reaction system in step 1.2 is (50 μL): ddH2O 33.75μL, 10× PCR Buffer 5μL, dNTP 5μL, forward primer 1μL, reverse primer 1μL, template DNA 4μL, LA Taq DNA polymerase 0.25μL.
4. The method according to claim 1, wherein The PCR reaction parameters in step 1.2 are: Pre-denaturation at 94°C for 4 min; denaturation at 94°C for 1 min, annealing at 57.5°C for 0.5 min, extension at 72°C for 2 min, for a total of 35 cycles; final extension at 72°C for 7 min.
5. The method according to any one of claims 1 to 4, characterized in that The method is used for rapid identification of the paternal origin of offspring in banana hybrid breeding.
6. A mitochondrial primer combination for banana male parent identification, characterized in that: The primer combination is: nad1 / 2-3F (5'→3'): GCATTACGATCTGCAGCTCA and nad1 / 2-3R (5'→3'): GGAAGCCGATTAGTTTCTGC, which is used to amplify the mitochondrial nad1 / 2-3 region, and the product size is 1100-2000 bp.