KASP molecular marker related to stem diameter of potato plant and application of KASP molecular marker

Abstract

The invention belongs to the field of plant genetic breeding, and discloses a KASP molecular marker obviously related to the stem diameter of a potato plant and application of the KASP molecular marker. According to the present invention, the SNP molecular marker significantly related to the stem diameter is accurately positioned at the potato 11 # chromosome chr112783819 through the whole genome association analysis (GWAS), the nucleotide polymorphism of the SNP molecular marker is T / C, the TT genotype phenotype is large in stem diameter, and the CC genotype phenotype is small in stem diameter, and the KASP molecular marker primer group based on the site is developed, comprising a forward primer for specifically recognizing T and C alleles and a universal reverse primer. By detecting the genotype of the site through PCR, the genotype can be efficiently detected, the method has great value in the field of potato molecular marker-assisted breeding, germplasm resources with excellent stem diameter can be rapidly screened, the breeding process of lodging-resistant, high-yield and mechanically-planted new potato varieties is accelerated, the breeding period is shortened, and the breeding cost is reduced; powerful technical support is provided for the development of the potato industry.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic breeding, in particular to a KASP molecular marker related to potato plant stem thickness and application thereof. Background Art

[0002] Potato (Solanum tuberosum L.) is the fourth largest food crop after rice, wheat, and maize, and is widely cultivated in diverse climates and ecological regions. Its tubers are rich in starch, protein, vitamins, and various minerals, and have multiple uses as food, vegetables, and feed, possessing extremely high economic and nutritional value. In the current context of global food security and sustainable agricultural development, research to improve potato yield and quality is of great significance. Plant growth stability and stress resistance are important factors determining field performance and ultimate yield. Stem diameter, a key morphological indicator of plant growth, is closely related to lodging resistance, nutrient transport efficiency, and mechanized harvesting performance. Potato lodging not only limits photosynthesis efficiency but also increases the risk of disease infection, ultimately leading to a decrease in yield and quality. Studies have shown that plants with larger stems provide greater mechanical support, maintaining the upright position of the aboveground portion, while also enhancing resistance to natural disasters such as wind and rain. In addition, thick stems have a higher diameter and number of ducts, which helps improve the efficiency of water and nutrient transport and provide more sufficient nutrient supply for tuber enlargement.

[0003] Potato stem diameter is regulated by both genetic and environmental factors. Genetically, it is primarily controlled by quantitative trait genes, involving multiple metabolic pathways such as cell wall synthesis, lignin and cellulose metabolism, and hormone signaling. Environmental factors, such as soil nutrients, water supply, light intensity, and temperature, also play an important regulatory role in the development of stem diameter. Furthermore, the interaction between genotype and environment can significantly influence the phenotype and stability of stem diameter. Therefore, systematically identifying key genes associated with stem diameter and developing corresponding molecular markers to lay the foundation for molecular breeding have become both hot topics and challenges in current research.

[0004] With the rapid development of high-throughput sequencing technology, not only has the sequencing cost been greatly reduced, but the resolution of genomic variation detection has also been significantly improved, making genome-wide association study (GWAS) an important method for analyzing the genetic basis of complex quantitative traits. By analyzing the association between phenotype and genotype, GWAS can locate genes or gene regions related to target traits across the entire genome, and is particularly suitable for the study of complex traits controlled by multiple genes. In recent years, GWAS has made significant progress in the study of important plant traits. In potato research, due to its complex tetraploid genetic background and highly heterogeneous genomic structure, the application of GWAS still faces challenges. Especially in research related to stem thickness, there are currently few publicly reported results, and the work of related gene mining and molecular marker development is still in its infancy.

[0005] Previous studies have shown that genes closely associated with stem diameter are often involved in the lignin metabolism pathway. Lignin is a crucial component of plant cell walls and plays a decisive role in their mechanical strength and stress resistance. Plants with larger stem diameters typically exhibit higher lignin content, and lignin biosynthesis is regulated by a series of key enzyme genes, such as cinnamyl alcohol dehydrogenase (CAD) and lignin synthase (Laccase). Furthermore, genes involved in the cell wall cellulose synthesis pathway, such as the cellulose synthase (CesA) family, also play a crucial role in stem diameter formation. Genome-wide association studies (GWAS) combined with functional validation of genes can efficiently identify functional genes associated with stem diameter and reveal their mechanisms of action, thus providing strong support for molecular design breeding. In GWAS studies of potato stem diameter, several candidate genes related to lignin and cellulose metabolism have been identified. However, this research remains at the association analysis stage, with functional validation and molecular marker development lagging behind. The development of molecular markers based on functional genes, particularly KASP (Kompetitive Allele Specific PCR) markers, which are closely associated with important quantitative traits, can significantly improve breeding efficiency and shorten breeding cycles. KASP molecular markers are an efficient, sensitive, and low-cost genotyping technology widely used in crop genetic improvement. Compared with traditional marker technologies, KASP markers offer the advantages of high specificity, high throughput, and ease of automation, making them particularly suitable for genetic identification and gene mapping studies of diverse germplasm resources. Developing KASP markers based on key loci discovered by GWAS allows for rapid screening and aggregation of target traits, thereby accelerating the breeding process. Using non-synonymous mutation sites identified by the stem thickness GWAS, specific primers were designed and a KASP detection system was established. This not only distinguishes different genotypes at the molecular level but can also be combined with phenotypic data for precise screening of potato germplasm resources. KASP markers can also be used for genetic diversity analysis and variety identification within germplasm resources, providing a scientific basis for potato variety improvement.

[0006] The development of KASP molecular markers related to the stem thickness trait in potato plants will not only promote the in-depth integration of basic research and breeding practice, but also provide new ideas for potato germplasm innovation and industrial development. With the further development of potato whole-genome sequencing and epigenetic research, combined with the integrated analysis of multi-omics data and functional genomics research, more comprehensive and precise theoretical support will be provided for the genetic analysis and molecular marker development of the stem thickness trait. Summary of the Invention

[0007] The purpose of the present invention is to provide a KASP molecular marker significantly associated with the stem diameter of potato plants and its application. Through the GWAS method, a SNP site significantly associated with the stem diameter of potato plants was identified, and based on this site, a KASP molecular marker and related detection methods were developed. These markers can be used to quickly screen potato germplasm with excellent stem diameter, providing important support for potato molecular breeding.

[0008] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are adopted:

[0009] The present invention provides a KASP molecular marker related to the stem thickness of potato plants. The KASP molecular marker is located at chr11_2783819 of potato chromosome No. 11, and the nucleotide polymorphism is T or C, wherein the phenotype of polymorphism T is a larger stem thickness; the phenotype of polymorphism C is a smaller stem thickness;

[0010] If the genotype of the KASP molecular marker is TT, the potato plant stem is larger; if the genotype of the KASP molecular marker is CC, the potato plant stem is smaller; if the genotype of the KASP molecular marker is TC, the potato plant stem is of an intermediate level.

[0011] Furthermore, the present invention also provides a primer set for detecting KASP molecular markers, comprising:

[0012] Forward primer 1: 5'- GAAGGTGACCAAGTTCATGCT TTGTGGAGTTTGCCACACAGATC[T]-3';

[0013] Forward primer 2: 5'- GAAGGTCGGAGTCAACGGATT TTGTGGAGTTTGCCACACAGATC[C]-3';

[0014] Universal reverse primer: 5′-ACAACAGGATATCTGGTGACTCC-3′;

[0015] Among them, GAAGGTGACCAAGTTCATGCT is the universal tag of FAM fluorescent linker sequence; GAAGGTCGGAGTCAACGGATT is the universal tag of HEX fluorescent linker sequence.

[0016] Furthermore, the present invention provides applications of the KASP molecular marker and primer set, specifically including but not limited to any of the following applications:

[0017] (1) Identify and select potato varieties with larger stems;

[0018] (2) Molecular marker-assisted breeding of potato plant stem thickness;

[0019] (3) Improve potato germplasm resources;

[0020] (4) Cultivate new potato varieties suitable for mechanized cultivation.

[0021] The present invention also provides a method for identifying the stem thickness of potato plants. The detection principle is to use the DNA of the potato to be tested as a template, use a primer set that can detect KASP molecular markers to perform PCR amplification, and judge the potato's genetic typing and plant stem thickness phenotype based on the fluorescence detection results after amplification.

[0022] The specific steps include:

[0023] S1. Extract DNA from young potato leaves to be tested as a DNA template;

[0024] S2, PCR amplification of the DNA template using the primer set;

[0025] S3. Determine the genotype of the potato to be tested based on the fluorescent signal of the PCR amplification result: if the color of the fluorescent signal is consistent with the color of the fluorescent linker of forward primer 1, the genotype is TT, and the phenotype of the potato to be tested is a large stem thickness; if the color of the fluorescent signal is consistent with the color of the fluorescent linker of forward primer 2, the genotype is CC, and the phenotype of the potato to be tested is a small stem thickness; if the color of the fluorescent signal is different from the color of the fluorescent linkers of forward primer 1 and forward primer 2, the genotype is TC, and the phenotype of the potato to be tested is an intermediate stem thickness.

[0026] Furthermore, the PCR amplification reaction system includes: 5 μL of KASP 2×PCR mix, 0.5 μL of primer mixture, and 4.5 μL of DNA template (50 ng / μL), with a total volume of 10 μL. The primer mixture includes a forward primer and a universal reverse primer, each at 10 μM. The PCR amplification program is as follows: pre-denaturation at 95°C for 15 minutes; denaturation at 95°C for 20 seconds, annealing from 61°C to 55°C for 60 seconds, with the annealing temperature decreasing by 0.6°C each time, for 10 cycles; denaturation at 95°C for 20 seconds, annealing at 55°C for 60 seconds, for 35 cycles; and fluorescence quantitative PCR at 30°C for 60 seconds, collecting the fluorescence signal for result determination.

[0027] Compared with the prior art, the beneficial effects of the present invention include at least:

[0028] Using whole-genome association analysis, it was identified that the potato chr11_2783819 locus was significantly associated with plant stem thickness, providing a molecular target for the genetic analysis of the stem thickness trait; the developed KASP marker can quickly detect genotypes through fluorescent quantitative PCR, eliminating the need for complex phenotypic identification and shortening the breeding cycle; the primer set has high specificity and low detection cost, making it suitable for large-scale germplasm resource screening; combining molecular markers with conventional breeding can accurately select lodging-resistant and high-yield potato varieties, improve adaptability to mechanized planting, and reduce production costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the specific implementation of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the specific implementation or the description of the prior art.

[0030] Figure 1 This is a bar chart showing the frequency distribution of stem thickness phenotypes of 130 potato samples used for association analysis over two years and at three points.

[0031] Figure 2 These are the Manhattan plots and QQ plots of the genome-wide association analysis of potato stem thickness.

[0032] Figure 3 This is the result of genotyping using KASP molecular markers.

[0033] Figure 4 It is a box plot of the stem thickness phenotype of plants with three genotypes in 94 validation populations. DETAILED DESCRIPTION

[0034] The following embodiments of the technical solution of the present invention are described in detail in conjunction with the embodiments. The following embodiments are only used to more clearly illustrate the technical solution of the present invention and are therefore only used as examples and cannot be used to limit the scope of protection of the present invention.

[0035] It should be noted that, unless otherwise specified, the technical or scientific terms used in this application should have the common meanings understood by those skilled in the art to which the present invention belongs.

[0036] Example 1: Identification of SNPs associated with stem thickness

[0037] Experimental materials, location and field layout:

[0038] The experimental materials were 130 potato accessions collected from the International Potato Center, Europe, North America, and China. In 2021 and 2022, these accessions were planted in pilot sites across different ecological zones in Gansu Province, including Gejiacha in Anding District, Luming in Weiyuan County, and Yongchang in Yongchang County. The field trials employed a randomized block design with 10 replicates per variety (line), with a plot spacing of 0.1 m, a ridge spacing of 1.1 m, and a plant spacing of 0.75 m.

[0039] Phenotypic data collection:

[0040] At peak flowering, the stem diameter of each potato plant was measured (the second internode from the plant base was used as the standard). Stem diameter was measured using a digital vernier caliper. Each sample was measured three times, and the average value was taken as the phenotypic data. The mean of the three-point phenotypic data from two years and the best linear unbiased estimations (BLUE) were used for subsequent association analysis, such as Figure 1 As shown, 21-LM means the pilot project in Luming in 2021; 21-YC means the pilot project in Yongchang in 2021; 21-GJC means the pilot project in Gejiacha in 2021; 22-LM means the pilot project in Luming in 2022; 22-YC means the pilot project in Yongchang in 2022; 22-GJC means the pilot project in Gejiacha in 2022. Figure 1 The results show that the stem diameter distribution of each experimental group generally follows a normal distribution trend, with a higher number of samples with intermediate stem diameters (approximately between 10 and 14 mm) and a lower number of samples with thinner stems (close to 6 mm) and thicker stems (close to 22 mm). The peak position and curve shape of the stem diameter distribution varied between experimental groups from different years and locations. For example, the peaks of some groups were more skewed toward the smaller stem diameter range, indicating that plants with smaller stem diameters accounted for a higher proportion of these groups. In contrast, the peaks of some groups (such as 21-YC and 22-YC) were more skewed toward the larger stem diameter range, indicating that plants with larger stem diameters were more numerous in these groups. This suggests that environmental factors in different years and locations may affect the stem diameter of potato plants.

[0041] Genotype data acquisition:

[0042] All germplasm resources were resequenced using high-throughput sequencing technology, and the generated raw data were aligned to the potato reference genome DM v6.1 using Sentieon software. After quality control and filtering, 229,836,620 high-quality SNP sites were ultimately obtained.

[0043] Genome-wide association study (GWAS):

[0044] GWAS analysis was performed using the R package GAPIT, combined with a mixed linear model (MLM) to correct for the effects of population structure and genetic background on the phenotype. 10 Under the condition of (P)=6, the SNP site chr11_2783819 was found to be significantly associated with stem thickness. Figure 2 shown.

[0045] Example 2: Development of KASP molecular markers

[0046] Primer design:

[0047] Primers were designed using Primer-BLAST based on the genomic sequence (±100 bp) near the SNP site chr11_2783819. Considering the polymorphism of the SNP site and the need for fluorescence detection, the primers consisted of three primers, of which the 5' ends of the two specific forward primers were connected to the FAM (blue, GAAGGTGACCAAGTTCATGCT) and HEX (red, GAAGGTCGGAGTCAACGGATT) fluorescent linker sequences, respectively.

[0048] Forward primer 1 (forward primer T allele):

[0049] 5'-GAAGGTGACCAAGTTCATGCTTTGTGGAGTTTGCCACACAGATC[T]-3';

[0050] Forward primer 2 (forward primer C allele):

[0051] 5'-GAAGGTCGGAGTCAACGGATTTTGTGGAGTTTGCCACACAGATC[C]-3';

[0052] Universal reverse primer: 5'-ACAACAGGATATCTGGTGACTCC-3'.

[0053] Primer performance verification:

[0054] The primers were applied to 10 randomly selected samples for PCR amplification to verify primer specificity and amplification efficiency. Amplification results were detected using a fluorescent quantitative PCR instrument to confirm that both allele primers produced stable fluorescent signals.

[0055] Example 3: SNP typing detection method, comprising the following steps:

[0056] S1. DNA extraction:

[0057] DNA was extracted from young potato leaves using the CTABB (hexadecyl trimethyl ammonium bromide) method as a DNA template. The specific steps are as follows: 0.2 g of fresh potato leaves were frozen and ground in liquid nitrogen; 800 μL of preheated CTAB buffer (containing β-mercaptoethanol) was added and the mixture was incubated in a 65°C water bath for 30 minutes; nucleic acids were extracted twice using chloroform:isoamyl alcohol (24:1) and the supernatant was collected after centrifugation; an equal volume of isopropanol was added to precipitate the DNA; the precipitate was washed twice with 70% ethanol, air-dried, and dissolved in 50 μL of dd H2O.

[0058] S2. PCR amplification:

[0059] The total volume of the PCR reaction system was 10 μL, including the following components: KASP 2× PCR mix: 5 μL; primer mix (forward primer and universal reverse primer, 10 μM each): 0.5 μL; DNA template (50 ng / μL): 4.5 μL;

[0060] Amplification was performed on a fluorescence quantitative PCR instrument with the following program settings: pre-denaturation at 95°C for 15 min; denaturation at 95°C for 20 s, annealing from 61°C to 55°C for 60 s, with the annealing temperature decreasing by 0.6°C each time, for 10 cycles; denaturation at 95°C for 20 s, annealing at 55°C for 60 s, for 35 cycles; fluorescence quantitative PCR at 30°C for 60 s.

[0061] S3. Result determination:

[0062] The genotype was determined based on the fluorescence signal: blue was the TT genotype, with a larger stem thickness; red was the CC genotype, with a smaller stem thickness; and green was the TC genotype, with an intermediate stem thickness.

[0063] Example 4: Application of molecular marker-assisted breeding

[0064] Tag Filtering:

[0065] 94 high-generation lines planted in 2023 at the Luming Breeding Experiment Station in Wuzhu Town, Weiyuan County, Dingxi City, Gansu Province were selected and genotyped at the chr11_2783819 locus using the above method. The specific scheme is shown in Example 3. Samples with the genotype TT were selected as potential germplasm with excellent stem thickness. The results are as follows Figure 3 Shown: blue represents 27 high-generation lines carrying the TT genotype, red represents 56 high-generation lines carrying the CC genotype, and green represents 1 high-generation line carrying the TC genotype.

[0066] Field verification:

[0067] The selected high-quality plants were planted in the experimental field to evaluate the correlation between their stem diameter performance and the molecular marker screening results. Statistical data showed that the median stem diameter of plants with the TT genotype was significantly greater than that of the CC genotype, while the median stem diameter of the TC genotype was between the two. This indicates that different genotypes have a significant effect on the stem diameter of potato plants, and the TT genotype tends to make the stem diameter of plants larger. Figure 4 As shown ("*" indicates significant differences among different haplotypes (P<0.05)).

[0068] Promotion and application:

[0069] Combining molecular markers with conventional breeding methods, KASP marker-assisted selection (MAS) is widely promoted in breeding materials to improve the screening efficiency of varieties with thicker stems.

[0070] Finally, it should be noted that the above examples are merely specific embodiments of the present invention. Obviously, the present invention is not limited to the above examples and is subject to numerous variations. All variations that can be directly derived or conceived by a person of ordinary skill in the art from the disclosure of the present invention are considered to be within the scope of protection of the present invention.

Claims

1. A KASP molecular marker associated with potato plant stem diameter, characterized in that: The KASP molecular marker is located at chr11_2783819 of potato stain No. 11, and the nucleotide polymorphism is T / C.

2. A primer set for detecting the KASP molecular marker according to claim 1, characterized in that: include: Forward primer 1: 5'- GAAGGTGACCAAGTTCATGCTTTGTGGAGTTTGCCACACAGATC[T]-3'; Forward primer 2: 5'- GAAGGTCGGAGTCAACGGATTTTGTGGAGTTTGCCACACAGATC[C]-3'; Universal reverse primer: 5'-ACAACAGGATATCTGGTGACTCC-3'.

3. The KASP molecular marker according to claim 1 or the primer set according to claim 2 is used in any of the following applications: (1) Identify and select potato varieties with larger stems; (2) Molecular marker-assisted breeding of potato plant stem thickness; (3) Improve potato germplasm resources; (4) Cultivate new potato varieties suitable for mechanized cultivation.

4. A method for identifying the stem thickness of potato plants, characterized in that: The following steps are involved: S1. Extract DNA from young potato leaves to be tested as a DNA template; S2. performing PCR amplification on the DNA template using the primer set according to claim 2; S3. Determine the genotype of the potato to be tested based on the fluorescent signal of the PCR amplification result: if the genotype is TT, the phenotype of the potato to be tested is a large stem thickness; if the genotype is CC, the phenotype of the potato to be tested is a small stem thickness; if the genotype is TC, the phenotype of the potato to be tested is an intermediate stem thickness.

5. The method according to claim 4, characterized in that The PCR amplification reaction system includes: 5 μL of KASP 2×PCRmix, 0.5 μL of primer mixture, and 4.5 μL of 50 ng / μL DNA template. The primer mixture includes forward primer 1, forward primer 2, and universal reverse primer, all at a concentration of 10 μM.

6. The method according to claim 4, characterized in that The PCR amplification program was as follows: pre-denaturation at 95°C for 15 min; denaturation at 95°C for 20 s, gradient annealing at 61°C for 60 s, with the annealing temperature decreasing by 0.6°C each time, for 10 cycles; denaturation at 95°C for 20 s, annealing at 55°C for 60 s, for 35 cycles; fluorescence quantitative PCR at 30°C for 60 s, and collection of fluorescence signals.

Images