Molecular marker closely linked with purple pericarp character of eggplant and application of molecular marker

Abstract

The invention discloses a molecular marker closely linked with the purple pericarp character of eggplants and application of the molecular marker. Belongs to the technical field of biology. The molecular marker is a SmMYB1-Indel molecular marker, and can be used for detecting the polymorphism or genotype of SmMYB1 in an eggplant genome so as to identify or assist in identifying whether anthocyanin is synthesized in eggplant peel. The SmMYB1-Indel molecular marker is characterized in that insertion of 6bp occurs at 164bp to 169bp of a first exon of the SmMYB1, and the insertion of the 6bp occurs at 164bp to 169bp of the first exon of the SmMYB1. The molecular marker provided by the invention has relatively high stability and can be simply, conveniently and quickly used for screening the purple peel type of the eggplant in the seedling stage of the eggplant, and the backcross transformation method can be used for quickly culturing an improved variety of the purple peel eggplant variety.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more particularly to a molecular marker tightly linked to the purple peel trait of eggplant and application thereof. Background Art

[0002] Anthocyanins are naturally occurring water-soluble pigments. Their antioxidant activity not only protects plants against biotic and abiotic stresses, but also plays a role in human health, including anti-diabetes, anti-cancer, anti-inflammatory, anti-bacterial, anti-obesity, and cardiovascular disease prevention. The higher the anthocyanin content in a plant, the higher its cultivation and economic value.

[0003] Anthocyanin is the main pigment that determines the color of eggplant peel. Anthocyanin belongs to flavonoids. In plant tissues, it forms stable anthocyanins by glycosidic bonds with sugars, playing a key role in fruit coloring. Anthocyanins are positively correlated with eggplant fruit color. The higher the content, the darker the peel color. Therefore, the content of anthocyanins is a key indicator for evaluating the color intensity of eggplant peel.

[0004] The synthesis and accumulation of anthocyanins are finely regulated by multiple transcription factors, among which SmMYB1 (also known as SmMYB113) is a key regulatory factor that has been extensively studied. SmMYB1 belongs to the R2R3-MYB family of transcription factors, which play a central role in the biosynthesis of plant secondary metabolites, particularly in the accumulation of anthocyanins. Studies have shown that SmMYB1 binds to the promoters of SmCHS and SmDFR in vivo, promoting the synthesis of anthocyanins and increasing their accumulation in eggplant.

[0005] To date, there have been few reports on the screening of superior alleles of the SmMYB1 gene and the development of its molecular markers in eggplant. In summary, how to provide an Indel molecular marker tightly linked to the purple peel trait of eggplant and its application is an urgent problem that needs to be solved by those skilled in the art. Summary of the Invention

[0006] In light of this, the present invention provides a molecular marker tightly linked to the purple peel trait in eggplant and its application. Detecting superior alleles of the SmMYB1 gene allows for rapid and efficient screening and identification of purple peel trait in eggplants during the seedling stage, accelerating eggplant breeding. The molecular marker tightly linked to the purple peel trait developed in this invention is of great significance for improving the appearance quality of eggplant fruit and revealing the molecular mechanisms of anthocyanin accumulation and metabolism in eggplant.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] The invention discloses a SmMYB1-Indel molecular marker which is tightly linked to the purple peel trait of eggplant. The SmMYB1-Indel molecular marker is located at 164bp to 169bp of the first exon of eggplant SmMYB1 and has a nucleic acid sequence of TAGAGC.

[0009] Application of the above-mentioned SmMYB1-Indel molecular marker in at least one of the following (1) or (2):

[0010] (1) Identify whether anthocyanins are synthesized in eggplant peel;

[0011] (2) Select purple-skinned eggplants.

[0012] The primer pair used to amplify the above-mentioned SmMYB1-Indel molecular marker, the nucleic acid sequence of the primer pair is shown as SEQ ID NO.5 to SEQ ID NO.6.

[0013] The use of the above primer pair in any of the following (1) to (3):

[0014] (1) Identify whether anthocyanins are synthesized in eggplant peel;

[0015] (2) Screening purple-skinned eggplants;

[0016] (3) Prepare a kit for detecting the color of eggplant peel.

[0017] A kit for detecting eggplant peel color comprises the above primer pair.

[0018] Application of the above-mentioned kit in screening purple-skin eggplants.

[0019] A molecular marker-assisted breeding method for purple-skin eggplants comprises using the above-mentioned kit to detect target eggplants.

[0020] Further, the following steps are included:

[0021] (1) performing PCR amplification on the genomic DNA of the test material using the above primers to obtain a PCR amplification product;

[0022] (2) PAGE gel electrophoresis was used to detect the polymorphism of the PCR amplification products, and the color type of the eggplant peel in the test material was determined based on the electrophoresis detection results.

[0023] Furthermore, the electrophoresis detection result judgment standard is: when the amplified product fragment is a single fragment of 149bp, the plant to be tested is a homozygous purple-skin eggplant; when the amplified product fragment is two fragments of 143bp and 149bp, the plant to be tested is a heterozygous purple-skin eggplant; when the amplified product fragment is a single fragment of 143bp, the plant to be tested is a homozygous non-purple-skin eggplant.

[0024] It can be seen from the above technical solutions that, compared with the prior art, the present invention has the following beneficial effects:

[0025] (1) The indel region provided by the present invention is located between 164 and 169 bp of the first exon of eggplant SmMYB1. The polymorphism is the presence or absence of a six-base insertion. When a six-base insertion is present, the eggplants are purple-skinned. Using the indel region described in the present invention, purple-skinned eggplants can be separated from non-purple-skinned eggplants.

[0026] (2) The present invention uses the SmMYB1-Indel molecular marker primer pair to detect the allelic variation of the SmMYB1 gene related to anthocyanin synthesis in eggplant. The sample can be identified by simple DNA extraction, PCR-specific amplification, PAGE gel electrophoresis or agarose gel electrophoresis, which is convenient for detecting and screening purple-skinned eggplant varieties or lines, and can greatly accelerate the breeding process of high-quality eggplant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0028] Figure 1 The peel color, anthocyanin content, and SmMYB1 expression of different eggplant varieties in Example 1 of the present invention are shown in Figure 1, wherein A is a schematic diagram for comparing the peel colors of four different eggplant varieties; B is the anthocyanin content of four different eggplant varieties; and C is the expression level of SmMYB1 in the peel of four different eggplant varieties.

[0029] Figure 2 This is a sequence alignment of 164bp to 169bp of the first exon of the eggplant SmMYB1 gene in Example 3 of the present invention, wherein 76 is purple-black eggplant; 54 is white eggplant; 44 is light purple eggplant; 64 is light purple eggplant; 133 is green eggplant;

[0030] Figure 3The phenotypic diagram of the segregating traits of the genetic population parents, F1 and F2 in Example 5 of the present invention;

[0031] Figure 4 These are the electrophoretic bands of the PCR products of the SmMYB1-Indel molecular marker in the P1, P2, F1, and F2 populations in Example 5 of the present invention, wherein P1 represents the purple-skinned eggplant line '76', P2 represents the white eggplant line '54', F1 is the first generation of hybridization between P1 and P2, F2 is the self-pollinated offspring of the F1 generation, and the F2 purple-skinned population and the F2 non-purple-skinned population represent purple-skinned and non-purple-skinned plants randomly selected from the F2 population, respectively;

[0032] Figure 5 This is the electrophoresis band of the PCR product of the SmMYB1-Indel molecular marker in the natural eggplant population in Example 5 of the present invention. DETAILED DESCRIPTION

[0033] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0034] The reagents required for the present invention are conventional experimental reagents, purchased from commercial channels; the experimental methods not mentioned are conventional experimental methods and will not be described in detail here.

[0035] Purple peel eggplant standard: the peel can synthesize anthocyanin, and the peel color is purple;

[0036] The standard for non-purple peel eggplant: Anthocyanins cannot be synthesized in the peel regardless of darkness, weak light or normal light conditions, and the peel is white (white eggplant) or green (green eggplant).

[0037] Example 1

[0038] Analysis of SmMYB1 expression levels in eggplant types with different peel colors

[0039] Two purple peels (No. 44 and 76), one white peel (No. 54) and one green peel (No. 133) were selected as the laboratory high-generation inbred lines ( Figure 1 A), anthocyanin content was determined ( Figure 1 B), it was found that the darker the purple color of eggplant peel, the higher the anthocyanin content, and the expression trend of SmMYB1 was significantly correlated with the anthocyanin content among varieties ( Figure 1C). Based on the conclusion drawn from previous studies that SmMYB1 is a key factor regulating anthocyanin synthesis in eggplant, it is speculated that the expression level of SmMYB1 directly determines the anthocyanin content. Therefore, we further analyzed whether the coding sequence of SmMYB1 differs among different varieties.

[0040] Example 2

[0041] Amplification of the SmMYB1 gene promoter sequence

[0042] The genomic DNA of the four eggplant species was extracted using the conventional CTAB method, and the SmMYB1 coding region sequence was amplified using the upstream primer SmMYB1-F and the downstream primer SmMYB1-R. The nucleotide sequences of these primers are shown in SEQ ID No. 1 to SEQ ID No. 2, respectively:

[0043] Upstream primer SmMYB1-F: 5′-ATGAATAATCCTCCTATAATCTGTACGTC-3′, SEQ ID No. 1.

[0044] Downstream primer SmMYB1-R: 5′-ATCAAGTAGATTCCATAAATCAATATCAG C-3′, SEQ ID No. 2.

[0045] After amplification, agarose gel electrophoresis was performed, and the amplified fragment was recovered, ligated into the pEASY-blunt Simple vector (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), and sequenced. By comparison with the eggplant genome database (https: / / solgenomics.net / organism / Solanum_melongena / genome), two allelic variant types of the SmMYB1 gene in eggplant were identified, and the sequences are shown as SEQ ID No. 3 and SEQ ID No. 4, respectively.

[0046] SEQ ID No. 3

[0047] ATGAATAATCCTCCTATAATCTGTACGTCTGTGCGAGTGAGGAAAGGTTCATGGACTGAAGAAGAAGATTTACTCTTGAGGAAATGTATGGAAAAATATGGTGAAGGCAAGTGGCATCTTGTTCCTGCAGGTCTGAATAGATGCAGAAAAAGTTGTAGGCTGAGGTGGTTGAATTATTTAAGGCCACATATCAAGAGAGGTGACTTTGCTTCGGATGAAGTGGATCTCATCTTGAGGCTTCATAAGCTCTTAGGCAACAGATGGTCACTTATTGCTGGTAGACTTCCGGGAAGGACCGCAAACGATGTAAAGAACTACTGGAACACTAACCTTCTA AGGAAGTTCACTATTGCTCCTCAAAAGATTAATAATACATGCAAAGACATCATTAGTACGAATGAAATAATAAGACCTCAACCTCGGAAATACTTGTCAAGCATAAAGAAGAATAATTTGACAAACAATAATGTAATTGTAGACAAGGAAGAACGCTGCAAAGAAATAACAAGTGACAAGCAAACTACCGATGCATCGATGGATAACGGAGATCAATGGTGGAAAAGTTTACTGGAAAATTTCAATGACGACGCTGTTGAAGGAGAAGAAGAAGCTGTAACTAATTATGAAAAAACACTAACAAGTTTATTACATGAGGAAATATCATCACCACCATTAAATGGTGGAGGCAACTCCATGCAACAAGAACAATGTGATAATTGGGATGATTTTTCTGCTGATATTGATTTATGGAATCTACTTGAT, SEQ ID No.4。

[0048] Example 3

[0049] Analysis of sequence polymorphisms in the coding region of the SmMYB1 gene

[0050] DNA was extracted from three purple peels (numbers 44, 64, and 76), one white eggplant (number 54), and one green eggplant (number 133) using the conventional CTAB method. The coding sequence of SmMYB1 was cloned and sequenced using the upstream primer SmMYB1-F and the downstream primer SmMYB1-R. Sequence alignment was performed using DNAMAN. The results are as follows: Figure 2 As shown: The coding sequence of SmMYB1 differs only between purple-skin eggplant and non-purple-skin eggplant. In purple-skin eggplant, there is a 6-base insertion (GCTCTA) in the coding sequence of SmMYB1. Figure 2 ), the nucleic acid sequence of the SmMYB1-Indel molecular marker is as follows:

[0051] Nucleic acid sequence of the SmMYB1-Indel molecular marker: TAGAGC.

[0052] Example 4

[0053] Development of molecular markers for the SmMYB1 gene

[0054] Based on the InDel region in the SmMYB1 coding sequence, a SmMYB1-Indel molecular marker primer pair was designed. The nucleic acid sequences of the primer pair are shown in SEQ ID NO.5 to SEQ ID NO.6:

[0055] SmMYB1-Indel-F: 5'-TGCATCTATTCAGACCTGCACATT-3', SEQ ID NO.5;

[0056] SmMYB1-Indel-R: 5'-GAAAAATATGGTGAAGGCAAGTGG-3', SEQ ID NO. 6.

[0057] The criteria for judging the electrophoresis test results are: when the amplified product fragment is a single fragment of 149bp, the plant to be tested is a homozygous purple-skin eggplant; when the amplified product fragment is two fragments of 143bp and 149bp, the plant to be tested is a heterozygous purple-skin eggplant; when the amplified product fragment is a single fragment of 143bp, the plant to be tested is a homozygous non-purple-skin eggplant.

[0058] Example 5

[0059] Application and validation of SmMYB1-Indel molecular markers

[0060] 1) Construction of F2 population

[0061] The high-generation pure inbred varieties of white eggplant line '54' (P2, white eggplant 101) and purple-skin eggplant line '76' (P1, Changza 8) cultivated and preserved in our laboratory were selected as hybrid parents to construct a segregating population ( Figure 3 The F1 generation now has purple peel. Self-pollination of the F1 generation produced a segregating F2 population with purple, green, and white peel colors at a segregation ratio of 10.5:2.1:1, and a segregation ratio of 3.4:1 between purple and non-purple. Therefore, the purple peel color trait in eggplant is a dominant trait controlled by a single gene, while the non-purple peel color trait is recessive.

[0062] 2) SmMYB1-Indel molecular marker scanning F2 segregating population

[0063] The DNA of individual seedlings of the above-mentioned P1, P2, F1, and F2 populations was used as a template and the SmMYB1-Indel molecular marker primer pair developed above was used for PCR amplification. The electrophoresis and silver staining results were statistically analyzed. Figure 4 As shown, the SmMYB1-Indel molecular marker was tightly linked to purple-skin eggplant in the F2 population with an accuracy of 100%.

[0064] 3) Scanning natural eggplant populations using SmMYB1-Indel molecular markers

[0065] The genomic DNA of 84 eggplant natural population materials at the seedling stage was extracted using the conventional CTAB method. The InDel region in the SmMYB1 coding sequence was amplified by PCR using the SmMYB1-Indel molecular marker primer pair. The electrophoresis and silver staining results were statistically analyzed. Figure 5 As shown, the SmMYB1-Indel molecular marker was closely linked to the purple peel eggplant-type trait in natural population materials, with an accuracy rate of 97.62%.

[0066] Table 1 Comparison of field resource trait observation results and molecular marker detection results in 84 eggplant natural population materials

[0067]

[0068]

[0069]

[0070] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0071] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A SmMYB1-Indel molecular marker tightly linked to the purple peel trait of eggplant, characterized in that: The SmMYB1-Indel molecular marker is located at 164bp to 169bp of the first exon of eggplant SmMYB1, and its nucleic acid sequence is TAGAGC.

2. Use of the SmMYB1-Indel molecular marker according to claim 1 in at least one of the following (1) or (2): (1) Identify whether anthocyanins are synthesized in eggplant peel; (2) Select purple-skinned eggplants.

3. A primer pair for amplifying the SmMYB1-Indel molecular marker according to claim 1, characterized in that: The nucleic acid sequences of the primer pairs are shown in SEQ ID NO.5 to SEQ ID NO.

6.

4. Use of the primer pair according to claim 3 in any one of the following (1) to (3): (1) Identify whether anthocyanins are synthesized in eggplant peel; (2) Screening purple-skinned eggplants; (3) Prepare a kit for detecting the color of eggplant peel.

5. A kit for detecting the color of eggplant peel, characterized in that: Comprising the primer pair according to claim 3.

6. Use of the kit according to claim 5 in screening purple peel eggplants.

7. A molecular marker-assisted breeding method for purple-skinned eggplant, characterized in that: The target eggplant is detected using the kit according to claim 5.

8. The method according to claim 7, characterized in that The steps include: (1) performing PCR amplification on the genomic DNA of the test material using the primers described in claim 3 to obtain a PCR amplification product; (2) PAGE gel electrophoresis was used to detect the polymorphism of the PCR amplification products, and the color type of the eggplant peel in the test material was determined based on the electrophoresis detection results.

9. The method according to claim 8, characterized in that The electrophoresis detection result judgment standard is: when the amplified product fragment is a single fragment of 149bp, the plant to be tested is a homozygous purple-skin eggplant; when the amplified product fragment is two fragments of 143bp and 149bp, the plant to be tested is a heterozygous purple-skin eggplant; when the amplified product fragment is a single fragment of 143bp, the plant to be tested is a homozygous non-purple-skin eggplant.

Images