RNA inhibitor for inhibiting LPA gene expression and application thereof

Abstract

The invention provides an RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof, the RNA inhibitor is formed by a positive-sense strand and an antisense strand with the strand length of 15-30 through base pairing, the strand length is preferably 19-23, at least 85% of base complementation exists between the positive-sense strand and the antisense strand, and the positive-sense strand and the antisense strand are preferably 19-23. The-OH at the 2'site of part or all nucleotide glycosyls of the positive-sense strand and / or the antisense strand can be substituted by fluorine or methoxyl, and phosphate bonds among three adjacent nucleotides of at least one of the tail ends of the positive-sense strand and / or the antisense strand can be sulfated. The structure of the RNA inhibitor can also contain carrier structures 5 'MVIP and 3' MVIP. The RNA inhibitor provided by the invention interferes with the translation template function of LPA mRNA, continuously and efficiently inhibits LPA gene expression, and can be used for treating and / or preventing diseases related to increase of the level of LP (a).

Description

RNA inhibitor for inhibiting LPA gene expression and its application

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to the Chinese patent application with application number 202211304230.8 filed with the State Intellectual Property Office of China on October 24, 2022, entitled “An RNA inhibitor for inhibiting LPA gene expression and its application”, the entire contents of which are incorporated into this application by reference. Technical Field

[0003] The present invention belongs to the field of biomedicine, and particularly relates to an RNA inhibitor for inhibiting LPA gene expression and an application thereof. Background Art

[0004] RNAi

[0005] RNAi (RNA interference) was discovered in 1998 by Andrew Z. Fire and others while conducting antisense RNA inhibition experiments in Caenorhabditis elegans. This process was named RNA interference (RNAi). This discovery was named one of the top ten scientific advances of 2001 by Science magazine and ranked first among the top ten scientific advances of 2002. Since then, siRNA, which acts through RNA interference, has garnered widespread attention as a potential gene therapy drug. In 2006, Andrew Z. Fire and Craig C. Mello were awarded the Nobel Prize in Physiology or Medicine for their contributions to the study of RNAi mechanisms. RNAi can be triggered by double-stranded RNA (dsRNA) in many organisms, including animals, plants, and fungi. During the RNAi process, an endonuclease called Dicer cuts or "dices" long dsRNA into smaller fragments of 21 to 25 nucleotides. These small fragments, called small interfering RNA (siRNA), have their antisense strands (Guide strands) loaded onto the Argonaute protein (AGO2). AGO2 loading occurs in the RISC-loading complex, a ternary complex composed of Argonaute protein, Dicer, and dsRNA binding protein (TRBP for short). During the loading process, the positive strand (Passenger strand) is cleaved and expelled by AGO2. AGO2 then uses the antisense strand to bind to mRNA containing a completely complementary sequence and then catalyzes the cleavage of these mRNAs, causing the mRNA to split and lose its role as a translation template, thereby preventing the synthesis of related proteins. After cleavage, the cleaved mRNA is released, and the RISC-loading complex loaded with the antisense strand is recycled for another round of cleavage.

[0006] According to statistics, over 80% of disease-related proteins in the human body cannot be targeted by currently available small-molecule drugs or biopharmaceuticals, making them undruggable proteins. Gene therapy, which aims to treat diseases through gene expression or silencing, is considered by the industry to be the third generation of therapeutics, following small-molecule and biopharmaceutical drugs. This approach treats diseases at the genetic level, unhindered by the constraints of undruggable proteins. As the most mainstream type of gene therapy, RNAi targets diseases at the mRNA level, offering greater efficacy than small-molecule and biopharmaceutical drugs that target proteins. RNAi allows the design of highly specific and potent inhibitory siRNA sense and antisense strands based on specific gene sequences. These single-stranded sequences are synthesized through solid-phase synthesis. The sense and antisense strands are then combined in a specific annealing buffer according to base pairing principles to form siRNA. Finally, siRNA is delivered to the target site in the body via a vector system, where it degrades the target mRNA, disrupting its function as a translation template and thereby preventing the synthesis of the associated protein.

[0007] siRNA delivery system

[0008] siRNA is unstable in blood and tissues and easily degraded by nucleases. To improve siRNA stability, modifications can be made to the sense and / or antisense strands of the siRNA. However, these chemical modifications provide only limited protection from nuclease degradation and may ultimately affect siRNA activity. Therefore, a suitable delivery system is needed to ensure the safe and efficient passage of siRNA across the cell membrane. Due to its large molecular weight, high negative charge, and high water solubility, siRNA cannot successfully cross the cell membrane and enter the cell on its own.

[0009] Liposomes, with their basic structure consisting of a hydrophilic core and a phospholipid bilayer, possess a phospholipid bilayer similar to biological membranes and possess high biocompatibility. This is why liposomes once became the most popular and widely used siRNA delivery vehicle. Liposome-mediated siRNA delivery primarily involves encapsulating siRNA within the liposome, protecting it from nuclease degradation and enhancing its efficiency across cell membrane barriers, thereby promoting cellular uptake. Examples include anionic liposomes, pH-sensitive liposomes, immunoliposomes, fusogenic liposomes, and cationic lipids. While some progress has been made, liposomes themselves are prone to inflammatory responses, necessitating the use of multiple antihistamines and hormones, such as cilitidine and dexamethasone, prior to administration to mitigate potential acute inflammatory reactions. Therefore, liposomes are not suitable for all therapeutic areas in clinical practice, particularly in the treatment of chronic diseases, where the potential for cumulative toxicity from long-term use is a potential safety concern. Therefore, a safer and more effective delivery system for siRNA is needed.

[0010] The asialoglycoprotein receptor (ASGPR) in the liver is a receptor specifically expressed on hepatocytes and is a highly efficient endocytic receptor. Because galactose residues are exposed at the penultimate end of various glycoproteins after enzymatic or acidic hydrolysis of sialic acid in the body, ASGPR specifically binds to galactosyl groups, hence its name, the galactose-specific receptor. Monosaccharides and polysaccharides such as galactose, galactosamine, and N-acetylgalactosamine all have a high affinity for ASGPR. The primary physiological function of ASGPR is to mediate the clearance of substances such as asialoglycoproteins and lipoproteins from the blood, and it is closely associated with the development and progression of liver diseases such as viral hepatitis, cirrhosis, and liver cancer. The discovery of this characteristic of ASGPR has played a significant role in the diagnosis and treatment of liver diseases (Ashwell G, Harford J, Carbohydrate-specific Receptors of the Liver, Ann Rev Biochem 1982 51:531-554). Liver-derived disease therapeutic drugs containing galactose or galactosamine and their derivatives in their structures can specifically bind to ASGPR, thereby having active liver targeting and requiring no other carrier system for delivery.

[0011] LPA, apo(a) and Lp(a)

[0012] LPA is the name of the gene encoding apolipoprotein (a) (apo(a)). It is primarily expressed in the liver, with expression restricted to humans and non-primates. The hydrophilic apolipoprotein component, apolipoprotein (a), is attached to apo(B)-100 via a disulfide bond, forming the lipoprotein (a) (Lp(a)) particle together with the lipid core. Lp(a) particles are specialized, large cholesterol-rich lipoproteins with a surface coated with cholesterol and phospholipids and embedded with apolipoprotein (a) and apo(B)-100, as described above. Lp(a) can enter and deposit on blood vessel walls, promoting atherosclerosis. Lp(a) is structurally homologous to plasminogen (PLG) and can compete with plasminogen for binding sites on fibrin, thereby inhibiting fibrinogen hydrolysis and promoting thrombosis. Therefore, Lp(a) is closely associated with atherosclerosis and thrombosis. Studies have shown that Lp(a) levels in the blood are an independent risk factor for cardiovascular disease, stroke, and atherosclerotic stenosis.

[0013] Elevated Lp(a) levels are primarily genetic and do not significantly change with diet, exercise, or other lifestyle changes. An Lp(a) level greater than 300 mg / L in humans is considered elevated. Elevated Lp(a) levels often indicate a significantly increased risk of atherosclerosis and thrombosis, making Lp(a) testing crucial for early identification of atherosclerosis risk. Approximately 330 million people in China suffer from cardiovascular disease, yet public awareness, treatment, and control rates of dyslipidemia remain low. Awareness of the risks of Lp(a) is even lower. Most hospitals do not routinely include this test in their lipid profiles, and there are currently no targeted therapeutic drugs available in clinical settings, both domestically and internationally. Therefore, there is an urgent need for a drug that effectively inhibits LPA gene expression.

[0014] Summary of the Invention

[0015] In one aspect, the present invention provides an RNA inhibitor or a pharmaceutically acceptable salt thereof for inhibiting LPA gene expression.

[0016] In some embodiments, the RNA inhibitor of the present invention is formed by base pairing of a sense strand and an antisense strand with a chain length of 15-30, preferably 19-23, and at least 85% base complementarity between the sense strand and the antisense strand; the -OH group at the 2' position of the nucleotide sugar group of some or all of the sense strands and / or antisense strands may be substituted, wherein the substituent group is fluorine or methoxy, and the phosphate bond between three adjacent nucleotides at at least one of the ends of the sense strand and / or antisense strand may be thiolated.

[0017] In some embodiments, the RNA inhibitor or a pharmaceutically acceptable salt thereof of the present invention, wherein the antisense strand forms a complementary region with a target sequence, wherein the target sequence is multiple regions at different positions of LPA mRNA, and the multiple regions have at least 15 consecutive identical nucleotides.

[0018] In some embodiments, the RNA inhibitor or pharmaceutically acceptable salt thereof of the present invention forms a complementary region with a target sequence, wherein the target sequence is multiple regions at different positions in LPA mRNA, wherein the multiple regions have at least 15 consecutive nucleotides in common, and the target sequence is selected from any one of the nucleotide regions between 312-332, 654-674, 996-1016, 1338-1358, 1680-1700, 2022-2042, and 2364-2384 in LPA mRNA (NM_005577.4). The starting positions of these regions may vary depending on the version number of the LPA mRNA, for example, the region between nucleotides 654-674 in LPA mRNA NM_005577.4.

[0019] In some embodiments, the RNA inhibitor or pharmaceutically acceptable salt thereof of the present invention forms a complementary region with a target sequence, wherein the target sequence is multiple regions at different positions in LPA mRNA, wherein the multiple regions have at least 15 consecutive nucleotides in common, and the target sequence is selected from any one of the nucleotide regions between 493-512, 1861-1880, and 2203-2222 in LPA mRNA (NM_005577.4). The starting positions of these regions may vary depending on the version number of LPA mRNA, for example, the starting position of the nucleotide region between 1861-1880 in LPA mRNA NM_005577.4.

[0020] In some embodiments, the antisense strand of the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof is selected from the following sequences:

[0021] 5'ucguauaacaauaaggagcug 3' SEQ ID NO.25

[0022] 5'auaacucuguccauuaccaug 3' SEQ ID NO.21

[0023] or a sequence having at least 15 consecutive nucleotides identical to the antisense strand, or a sequence differing from the antisense strand by one, two or three nucleotides,

[0024] Wherein, g = guanylate, a = adenylate, u = uridylate, and c = cytidylate.

[0025] In some embodiments, the sense strand of the RNA inhibitor or a pharmaceutically acceptable salt thereof is selected from the following sequences:

[0026] 5'cagcuccuuauuguuauacga 3' SEQ ID NO.11

[0027] 5'ugguaauggacagaguuauca 3' SEQ ID NO.8

[0028] or a sequence that is identical to the above-mentioned sense strand for at least 15 consecutive nucleotides, or a sequence that differs from the above-mentioned sense strand by one, two, or three nucleotides,

[0029] Wherein, g = guanylate, a = adenylate, u = uridylate, and c = cytidylate.

[0030] In some embodiments, the sense strand of the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof is SEQ ID NO. 11, or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two, or three nucleotides; and the antisense strand is SEQ ID NO. 25, or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two, or three nucleotides:

[0031] Sense strand: 5'cagcuccuuauuguuauacga 3' SEQ ID NO.11

[0032] Antisense strand: 5'ucguauaacaauaaggagcug 3' SEQ ID NO.25;

[0033] Alternatively, the sense strand is SEQ ID NO. 8, or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two, or three nucleotides; and the antisense strand is SEQ ID NO. 21, or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two, or three nucleotides:

[0034] Sense strand: 5'ugguaauggacagaguuauca 3' SEQ ID NO.8

[0035] Antisense strand: 5'auaacucuguccauuaccaug 3' SEQ ID NO.21;

[0036] Wherein, g = guanylate, a = adenylate, u = uridylate, and c = cytidylate.

[0037] In some embodiments, the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, wherein the sense strand is SEQ ID NO. 270 or a sequence differing therefrom by one, two, or three nucleotides, and the antisense strand is SEQ ID NO. 278 or a sequence differing therefrom by one, two, or three nucleotides:

[0038] Sense strand: 5'CsAsGCUCCUfUfAfUUGUUAUACsGsA 3' SEQ ID NO.270

[0039] Antisense strand: 5'UsfCsGfUAfUAACAAfUAfAGfGAfGCsfUsG 3' SEQ ID NO.278;

[0040] Alternatively, the sense strand is SEQ ID NO. 239 or a sequence differing therefrom by one, two or three nucleotides, and the antisense strand is SEQ ID NO. 344 or a sequence differing therefrom by one, two or three nucleotides:

[0041] Sense strand: 5'UsGsGUfAAfUfGfGACAGAGUUAUsCsA 3' SEQ ID NO.239

[0042] Antisense strand: 5'AsfUsAfACdTCfUGUCCAfUUfACCAsUsG 3' SEQ ID NO.344;

[0043] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidine; fGs = 2'-fluoro-3'-thioguanylate, fAs = 2'-fluoro-3'-thioadenylate, fUs = 2'-fluoro-3'-thiouridylate, fCs = 2'-fluoro-3'-thiocytidine, dT = 2'-deoxythymidylate.

[0044] In some embodiments, the sense or antisense strand of the RNA inhibitors described herein can accommodate no more than three mismatched nucleotides, for example, within 5, 4, 3, or 2 nucleotides of the 5' end and / or 3' end.

[0045] In the above technical approach, preferably, the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof further contains carrier structures 5'MVIP and 3'MVIP, and the structure of the RNA inhibitor is as shown in Formula Ia, Ib or Ic:

[0046] in,

[0047] The vector structure includes 5'MVIP (5'MultiValent Import Platform) and 3'MVIP (3'MultiValent Import Platform);

[0048] The 5'MVIP is composed of a transfer point R1, a connecting chain D, a linker B, a side chain L, and a liver-targeting specific ligand X. It is connected to the 5' end of the sense chain or the 5' end of the antisense chain through the transfer point R1. Its structure is shown in Formula I:

[0049] (XL) n -BD-R1-

[0050] I

[0051] The 3'MVIP is composed of a transfer point R2, a connecting chain D, a linker B, a side chain L, and a liver-targeting specific ligand X. It is connected to the 3' end of the sense chain or the 3' end of the antisense chain through the transfer point R2. Its structure is shown in Formula II:

[0052] (XL) m -BD-R2-

[0053] II

[0054] in,

[0055] n and m are each independently any integer from 0 to 4, preferably an integer from 1 to 3, and n+m=an integer from 2 to 6, preferably n+m=2, 3 or 4, more preferably 4;

[0056] The transition point R1 is a heterocyclic or carbocyclic structure containing N, S or O as shown below:

[0057] Alternatively, the R1 is -NH(CH2) x CH2O-, wherein x is any integer from 3 to 12, preferably any integer from 4 to 6;

[0058] The transition point R2 is a heterocyclic or carbocyclic structure containing N, S or O as shown below:

[0059] Alternatively, the transition point R2 is -NH(CH2)x1 CH(OH)(CH2) x2 CH2O-, wherein x1 is any integer from 1 to 4, and x2 is any integer from 0 to 4;

[0060] The liver-targeting specific ligand X is selected from a structure used to enhance the uptake of RNA inhibitors by hepatocytes, and is the same or different within each of 5'MVIP and 3'MVIP or between 5'MVIP and 3'MVIP, and is selected from monosaccharides and their derivatives, preferably N-acetylgalactosamine and its derivatives, and more preferably selected from the following structures:

[0061] Wherein, W is selected from -OH, -NHCOOH and -NHCO(CH2) q One or two of CH3, wherein q is an integer from 0 to 4;

[0062] The branched chain L is the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP, and is selected from one or more of the following structures:

[0063] wherein r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, and Z is H, an alkyl group or an amide group, wherein the alkyl group is, for example, a C1-C5 alkyl group;

[0064] The linker B is the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP, and is selected from the following structures:

[0065] wherein A1 and A2 are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl or thiophosphoryl, and r is any integer from 0 to 4;

[0066] The connecting chain D is the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP, and is selected from the following structures:

[0067] Wherein, each p is independently any integer from 1 to 20; s is any integer from 2 to 13; Z1 and Z2 are the same or different substituent groups, such as C3-C 10 alkyl.

[0068] In some embodiments, the 5'MVIP is selected from any one of 5'MVIP01 to 5'MVIP22 in Table 11.

[0069] In some embodiments, the 3'MVIP is selected from any one of 3'MVIP01 to 3'MVIP27 in Table 12.

[0070] In some embodiments, in the RNA inhibitor or a pharmaceutically acceptable salt thereof according to the present invention, the 5'MVIP is 5'MVIP01 or 5'MVIP09 as shown below, and the 3'MVIP is 3'MVIP01, 3'MVIP09 or 3'MVIP17 as shown below:

[0071] In some embodiments, the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, wherein the combination of the sense strand 5'MVIP and the antisense strand 3'MVIP is 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17 or 5'MVIP09 / 3'MVIP09, or the combination of the sense strand 5'MVIP and the antisense strand 3'MVIP is 5'MVIP01 / 3'MVIP09 or 5'MVIP09 / 3'MVIP01.

[0072] On the other hand, the present invention also provides the use of the above-mentioned RNA inhibitor or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating and / or preventing diseases associated with elevated LP(a) levels, wherein the diseases associated with elevated LP(a) levels include hepatovascular diseases, including inflammatory diseases, cardiovascular and cerebrovascular diseases, and metabolic diseases, wherein the cardiovascular and cerebrovascular diseases include hyperLP(a)emia, hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease, and aortic valve stenosis.

[0073] In another aspect, the present invention provides a pharmaceutical composition comprising the above-mentioned RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof and optional pharmaceutically acceptable excipients, wherein the pharmaceutically acceptable excipients may be pharmaceutically acceptable excipients, carriers and / or diluents. The pharmaceutical composition is in the form of an oral agent, an intravenous injection, or a subcutaneous or intramuscular injection, preferably a subcutaneous injection.

[0074] In another aspect, the present invention also provides a method for treating and / or preventing a disease, condition, or syndrome associated with elevated LP(a) levels, comprising administering to a subject or patient in need thereof a therapeutically effective amount of an RNA inhibitor that inhibits LPA gene expression, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the RNA inhibitor or a pharmaceutically acceptable salt thereof and, optionally, a pharmaceutically acceptable excipient, wherein the therapeutically effective amount is 1.0 mg / kg to 10 mg / kg of the RNA inhibitor or a pharmaceutically acceptable salt thereof. The administration (dosage) to the subject or patient includes oral, intravenous, subcutaneous or intramuscular injection, rectal, or intraperitoneal administration. Those skilled in the art will readily appreciate other aspects and advantages of the present application from the detailed description below. The detailed description below only shows and describes exemplary embodiments of the present application. As those skilled in the art will appreciate, the disclosure of the present application enables those skilled in the art to modify the disclosed embodiments without departing from the spirit and scope of the invention to which the present application relates. Accordingly, the drawings and descriptions in the specification of the present application are merely illustrative and not restrictive. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] The specific features of the inventions of this application are set forth in the appended claims. The features and advantages of the inventions of this application can be better understood by referring to the exemplary embodiments described in detail below and the accompanying drawings. A brief description of the drawings is as follows:

[0076] FIG1 is a graph showing the inhibitory effects of the RNA inhibitors in Table 3 on LPA mRNA levels in Huh7 cells at different concentrations, as prepared in Example 2 of the present application;

[0077] Figure 2 is a high-resolution mass spectrum of ERCd-01-c2 synthesized in 3.1.15 of Example 3 of the present application;

[0078] FIG3 is a high-resolution mass spectrum of 3'MVIP17-c1 synthesized in 3.1.2.6 of Example 3 of the present application;

[0079] FIG4 is a high-resolution mass spectrum of 5'MVIP09-ERCd-PFP-c2 synthesized in 3.2.1.2 of Example 3 of the present application;

[0080] FIG5 is a graph showing the inhibitory effects of the RNA inhibitors in Table 4 on LPA mRNA levels in Huh7 cells at different concentrations, as prepared in Example 5 of the present application;

[0081] FIG6 is a graph showing the inhibitory effects of the RNA inhibitors in Table 5 on LPA mRNA levels in Huh7 cells at different concentrations, as prepared in Example 6 of the present application;

[0082] FIG7 is a graph showing the inhibitory effects of the RNA inhibitors in Table 6 on LPA mRNA levels in Huh7 cells at different concentrations, as prepared in Example 7 of the present application;

[0083] FIG8 is a graph showing the inhibitory effects of the RNA inhibitors in Table 7 on LPA mRNA levels in Huh7 cells at different concentrations, as prepared in Example 8 of the present application;

[0084] FIG9 is a graph showing the inhibitory effects of the RNA inhibitors in Table 8 on LPA mRNA levels in Huh7 cells at different concentrations, as prepared in Example 9 of the present application;

[0085] FIG10 is a graph showing the effect of the RNA inhibitor in Example 10 of the present application on reducing LDL-c levels in cynomolgus monkey plasma;

[0086] FIG11 is a graph showing the effect of the RNA inhibitor in Example 10 of the present application on reducing Lp(a) levels in cynomolgus monkey plasma. DETAILED DESCRIPTION

[0087] The following describes the embodiments of the present invention through specific embodiments. People skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification.

[0088] Definition of terms

[0089] In the present application, the term "LPA" includes human LPA and cynomolgus monkey LPA, wherein the human LPA mRNA sequence can be found, for example, in GenBank NM_005577.4.

[0090] As used herein, a "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during LPA gene transcription, including mRNAs that are products of RNA processing of the primary transcript. In some embodiments, the target portion of the sequence will be at least long enough to serve as a substrate for RNA inhibitor-directed degradation at or near the portion of the nucleotide sequence of the mRNA molecule formed during LPA gene transcription. A "target sequence" is typically about 15-30 nucleotides in length.

[0091] In this application, the term "region" refers to the starting position to the ending position of the target sequence in the LPA mRNA stored in GenBank. For example, the "region" 312-332 refers to the nucleotides from position 312 to position 332 in the LPA mRNA (NM_005577.4). These "regions" may vary in position due to updates to the LPA mRNA sequence stored in GenBank, but the number and types of nucleotides covered by the region will not change.

[0092] As used herein, the term "RNA inhibitor" generally refers to an agent comprising RNA, as defined herein, that mediates targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. This directs sequence-specific degradation of mRNA through a process known as RNA inhibition, thereby regulating (e.g., inhibiting) LPA gene expression in cells (e.g., cells in a subject, such as a mammalian subject).

[0093] In some embodiments, the RNA inhibitor can be a single-stranded siRNA (ssRNA inhibitor) introduced into a cell or organism to inhibit the target mRNA (i.e., the LPA gene). The single-stranded RNA inhibitor binds to the RISC endonuclease Argonaute 2, which then cleaves the target mRNA. Single-stranded siRNAs are generally 15 to 30 nucleotides in length and are chemically modified.

[0094] In some embodiments, the "RNA inhibitor" used herein is double-stranded RNA and is referred to herein as a "double-stranded RNA inhibitor," "double-stranded RNA (dsRNA, DS) molecule," "dsRNA agent," or "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules having a duplex structure comprising two antiparallel and substantially complementary nucleic acid strands, referred to as having "sense" and "antisense" orientations relative to the target mRNA. In some embodiments of the present application, double-stranded RNA (dsRNA) triggers degradation of the target mRNA through a post-transcriptional gene silencing mechanism (referred to herein as RNA inhibition or RNA interference).

[0095] The duplex structure can be any length that triggers specific degradation of LPA mRNA via the RISC pathway, and can be in the range of about 15 to 36 base pairs in length, for example, about 15-30 base pairs in length, for example, about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 36 base pairs in length. In certain embodiments, the RNA inhibitor of the present application is a dsRNA of 15-30 nucleotides that interacts with the target sequence to guide the cleavage of LPA mRNA.

[0096] Typically, most of the nucleotides in the sense and antisense strands of a dsRNA molecule are ribonucleotides, but as described in detail herein, may also include one or more non-ribonucleotides, for example, deoxyribonucleotides or modified nucleotides. In addition, the RNA inhibitors described herein may include chemically modified ribonucleotides, and may have modified nucleotides in multiple regions. The term "modified nucleotides" as used herein refers to nucleotides that independently have modified sugar moieties, modified internucleotide linkages, or modified nucleobases, or any combination thereof. Therefore, the term "modified nucleotides" encompasses substitutions, additions, or removals of, for example, functional groups or atoms of internucleotide linkages, sugar moieties, or nucleobases. Modifications applicable to the RNA inhibitors of the present application include all types of modifications disclosed herein or known in the art.

[0097] In this application, the term "nucleotide sequence" generally refers to a series or sequence of nucleotides, whether modified or unmodified, described as a series of letters using standard nucleotide nomenclature and the symbol table for modified nucleotides described in this application. The nucleotide sequence described in this application is a polymer composed of phosphodiester bonds (or related structural variants or synthetic analogs thereof), including naturally occurring nucleotide polymers, but it should be understood that the scope of the term also includes various analogs, including but not limited to: peptide nucleic acids (PNA), phosphoramidates, phosphorothioates, methylphosphonates and 2'-O-methyl ribonucleic acids. Typically, there are about 15-30 nucleotides, but the term can also refer to molecules of any length.

[0098] In some embodiments, the nucleotide sequence comprises one or more unmodified ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or one or more modified nucleotides. The term "modified nucleotide sequence" generally refers to a series or sequence of nucleotides comprising at least one modification and / or at least one modified internucleotide linkage.

[0099] In this application, the term "modified nucleotide" generally means a nucleotide comprising at least one chemical modification compared to a naturally occurring RNA or DNA nucleotide. For example, 2'-deoxy-thymidylate 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-O-long chain alkyl-modified nucleotides (such as hexadecyl), morpholino nucleotides, phosphoramidate nucleotides, non-natural nucleobase nucleotides, 5'-phosphorothioate nucleotides, and nucleotides attached to a cholesterol derivative or dodecanoic acid didecylamide group.

[0100] Modified nucleotides contain modified sugar groups and / or modified nucleobases.

[0101] In this application, the term "nucleobase" or "base" generally refers to a heterocyclic pyrimidine or purine compound, which is a component of all nucleic acids and includes adenine, guanine, cytosine, thymine and uracil. Nucleotides can include modified nucleotides or nucleotide mimetics, abasics or alternative replacement moieties. The term "unmodified nucleobase" or "naturally occurring nucleobase" generally refers to the naturally occurring heterocyclic nucleobases of RNA or DNA: the purine bases adenine and guanine; and the pyrimidine bases thymine, cytosine and uracil. "Modified nucleobase" generally refers to any nucleobase that is not a naturally occurring nucleobase.

[0102] In this application, the term "sugar group" generally refers to a naturally occurring sugar group or a modified sugar group of a nucleotide. The term "naturally occurring sugar group" generally refers to a ribofuranosyl group as found in naturally occurring RNA or a deoxyribofuranosyl group as found in naturally occurring DNA. "Modified sugar group" refers to a substituted sugar group or sugar surrogate, for example, a fluoro or methoxy substitution at the 2' position of the sugar group.

[0103] In this application, the term "internucleotide linkage" generally refers to a covalent linkage between adjacent nucleotides in a nucleotide sequence. "Naturally occurring internucleotide linkage" means a 3' to 5' phosphodiester linkage. "Modified internucleotide linkage" means any internucleotide linkage other than a naturally occurring internucleotide linkage.

[0104] In this application, the term "antisense strand" (AS) generally refers to the strand of an RNA inhibitor (e.g., dsRNA) that includes a region that is substantially complementary to a target sequence. As used herein, the term "region of complementarity" generally refers to the region on the antisense strand that is substantially complementary to a sequence defined herein (e.g., a target sequence).

[0105] In this application, the term "sense strand" (S) generally refers to a strand of an RNA inhibitor (e.g., dsRNA) comprising a region substantially complementary to that of the "antisense strand" (AS). The "sense" strand is sometimes referred to as the "sense" strand, the "passenger" strand, or the "anti-guide" strand. The antisense strand targets the desired mRNA by virtue of the sequence of the sense strand, while the sense strand may target different targets or be degraded. Therefore, if the antisense strand is incorporated into RISC, the correct target is targeted. The incorporation of the sense strand can result in off-target effects. These off-target effects can be limited by using modifications or using 5' end caps on the sense strand.

[0106] In this application, the term "complementary" refers to the ability of two nucleotide sequences to hybridize under certain conditions, form base pair hydrogen bonds, and form a duplex or double helix structure. For example, the hybridization of an RNA inhibitor antisense strand with an RNA inhibitor sense strand or LPA mRNA forms Watson-Crick base pairs or non-Watson-Crick base pairs, and includes natural or modified nucleotides or nucleotide mimetics. "Complementary" does not necessarily require nucleobase complementarity on every nucleoside. On the contrary, some mismatches can be tolerated.

[0107] In this application, the term "mismatch" refers to when the region of complementarity is not completely complementary to the target sequence. The mismatch can be in the interior or terminal regions of the molecule. Generally, the most tolerated mismatch is in the terminal region, for example, within 5, 4, 3 or 2 nucleotides of the 5' end and / or 3' end, and no more than 3 mismatches.

[0108] In this application, the term "ligand" generally refers to any compound or molecule that can covalently or otherwise chemically bind to a biologically active substance (such as dsRNA). In some embodiments, the ligand can interact directly or indirectly with another compound, such as a receptor. The receptor that interacts with the ligand can be present on the cell surface, or alternatively can be an intracellular and / or intercellular receptor. The interaction between the ligand and the receptor can result in a biochemical reaction, or can be simply a physical interaction or binding.

[0109] In this application, the term "pharmaceutically acceptable" generally refers to one or more non-toxic substances that do not inhibit the effectiveness of the biological activity of the active ingredient. Such preparations may generally contain salts, excipients, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. Such pharmaceutically acceptable preparations may also generally include compatible solid or liquid fillers, diluents, or encapsulating materials suitable for administration to humans. When used in medicine, the salt should be a pharmaceutically acceptable salt, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts, and these are not excluded from the scope of this application. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, etc. Pharmaceutically acceptable salts can also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium salts, potassium salts, or calcium salts.

[0110] In this application, the term "lipid nanoparticle" or "LNP" generally refers to a vesicle comprising a lipid layer that encapsulates a pharmacologically active molecule (e.g., dsRNA). LNP is described, for example, in Chinese Patent No. CN103189057B, the entire contents of which are incorporated herein by reference.

[0111] Detailed Description of the Invention

[0112] In one aspect, the present invention provides an RNA inhibitor or a pharmaceutically acceptable salt thereof for inhibiting LPA gene expression.

[0113] In some embodiments, the target sequence of the RNA inhibitor or a pharmaceutically acceptable salt thereof comprises multiple regions of LPA mRNA NM_005577.4 (SEQ ID NO.1):

[0114] SEQ ID NO.1:

[0115] Wherein, g = guanylate, a = adenylate, t = thymidylate, and c = cytidylate.

[0116] In some embodiments, the target sequence of the RNA inhibitor or a pharmaceutically acceptable salt thereof according to the present invention comprises the nucleotide regions indicated by the double underline and the single underline in SEQ ID NO. 1.

[0117] In some embodiments, the target sequence of the RNA inhibitor or a pharmaceutically acceptable salt thereof of the present invention is a sequence comprising nucleotides 301-2401 in SEQ ID NO. 1 and having at least 15 consecutive nucleotides identical thereto.

[0118] In some embodiments, the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, wherein the antisense strand forms a complementary region with a target sequence, and the target sequence is any one of nucleotide regions between 312-332, 654-674, 996-1016, 1338-1358, 1680-1700, 2022-2042 and 2364-2384 in SEQ ID NO.1.

[0119] In some embodiments, the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof, wherein the antisense strand forms a complementary region with a target sequence, and the target sequence is any one of the nucleotide regions between 493-512, 1861-1880, and 2203-2222 in SEQ ID NO.1.

[0120] In some embodiments, the target sequence of the RNA inhibitors described herein is at least 15 consecutive nucleotides in these regions.

[0121] In some embodiments, the target sequence of the RNA inhibitor of the present invention is at least 30 consecutive nucleotides extending before and after these regions.

[0122] In some embodiments, the target sequence of the RNA inhibitor described in the present invention is: cagctcc ttattgttat acga (SEQ ID NO. 2), wherein g = guanylate, a = adenylate, t = thymidylate, and c = cytidylate.

[0123] In some embodiments, the target sequence of the RNA inhibitor described in the present invention is: tggtaatggacagagttat (SEQ ID NO. 3), wherein g = guanylate, a = adenylate, t = thymidylate, and c = cytidylate.

[0124] In some embodiments, the target sequence of the RNA inhibitor of the present invention is a target sequence that differs from SEQ ID NO. 2 by one, two, or three nucleotides.

[0125] In some embodiments, the target sequence of the RNA inhibitor of the present invention is a target sequence having at least 15 consecutive nucleotides identical to SEQ ID NO.2.

[0126] In some embodiments, the target sequence of the RNA inhibitor of the present invention is a target sequence that differs from SEQ ID NO. 3 by one, two, or three nucleotides.

[0127] In some embodiments, the target sequence of the RNA inhibitor of the present invention is a target sequence having at least 15 consecutive nucleotides identical to SEQ ID NO.3.

[0128] In some embodiments, the target sequence of the RNA inhibitor of the present invention may be a sequence of 15-30 nucleotides in any region other than those described above in SEQ ID NO. 1.

[0129] In some embodiments, the RNA inhibitors described herein include double-stranded ribonucleic acid (dsRNA) molecules for inhibiting LPA gene expression in cells, such as cells of a subject (e.g., a mammal, such as a human susceptible to LPA-related disorders, such as high LP(a) levels). The antisense strand of the dsRNA includes a region of complementarity that is substantially complementary, and typically completely complementary, to the target sequence described above. The sense strand includes a region complementary to the antisense strand such that, when combined under appropriate conditions, the two strands hybridize and form a duplex structure. Typically, the duplex structure is 15 to 30 base pairs in length. Similarly, the region of complementarity to the target sequence is 15 to 30 nucleotides in length.

[0130] In some embodiments, the RNA inhibitor of the present invention is formed by base pairing of a sense strand and an antisense strand with a chain length of 15-30, wherein the chain length is preferably 19-23.

[0131] In some embodiments, the sense and antisense strands of the RNA inhibitors of the present invention are at least 85% base complementary;

[0132] In some embodiments, the sense strand of the RNA inhibitor of the present invention is selected from the sequences in Table 1, as shown in Table 1 below:

[0133] Table 1

[0134] Wherein, g = guanylate, a = adenylate, u = uridylate, and c = cytidylate.

[0135] In some embodiments, the antisense strand of the RNA inhibitor of the present invention is selected from the sequences in Table 2, as shown in Table 2 below:

[0136] Table 2

[0137] Wherein, g = guanylate, a = adenylate, u = uridylate, c = cytidylate, t = thymidylate.

[0138] In some embodiments, the base pairs of the sense strand in Table 1 and the corresponding antisense strand in Table 2 are complementary to form dsRNA, which may be partially complementary or completely complementary. The partial complementarity may be at least 85% base pairing.

[0139] In some embodiments, the RNA inhibitor of the present invention is selected from the following Table 3:

[0140] Table 3 RNA inhibitors

[0141] In some embodiments, the RNA inhibitor can be administered to cell lines for sequence screening via cell transfection or liposome-nucleic acid nanoparticles, methods well known to those skilled in the art. Patents US9233971B2, US9080186B2, CN102985548B, and CN103189057B regarding methods for preparing lipid compounds and liposome-nucleic acid nanoparticles are incorporated herein in their entirety.

[0142] In some embodiments, the amphoteric lipids in the lipid compound are preferably macrocyclic lipid compounds D1C1, T1C1, T1C6, T4C4, B2C1, B2C6, B2C7 and M10C1.

[0143] As is well known to those skilled in the art, dsRNAs having a duplex structure of approximately 20 to 23 base pairs, for example, 21 base pairs, have been found to be particularly effective in inducing RNA inhibition (Elbashir et al., EMBO 2001, 20: 6877-6888). However, others have found that shorter or longer RNA duplex structures are also effective (Chu and Rana (2007) RNA 14: 1714-1719; Kim et al. (2005) Nat Biotech 23: 222-226). It is reasonable to expect that duplexes containing a sequence in Tables 1, 2, and 3 with a few nucleotides added or subtracted at one or both ends may be similarly effective compared to the dsRNAs described. Thus, inhibitory dsRNAs having a sequence of at least 15, 16, 17, 18, 19, 20, 21 or more consecutive nucleotides derived from a sequence in Tables 1, 2, and 3 that differ by no more than about 5, 10, 15, 20, 25, or 30% in their ability to inhibit LPA gene expression from a dsRNA comprising the entire sequence are included within the scope of this application.

[0144] The dsRNA described herein may further include one or more single-stranded nucleotide overhangs, for example, 1, 2, 3, or 4 nucleotides. The nucleotide overhangs may comprise nucleotide / nucleoside analogs or combinations thereof, including deoxynucleotides. The overhangs may be on the sense strand, the antisense strand, or a combination thereof. In addition, the nucleotides of the overhangs may be present at the 5' end, the 3' end, or both ends of the antisense or sense strand of the dsRNA. The overhangs may be formed by one strand being longer than the other, or by two strands of the same length being staggered. When the overhang is on the antisense strand, it may form a mismatch or complement with the LPA mRNA or may be another sequence. For example, the overhang is located at the 3' end of the sense strand, or alternatively, at the 3' end of the antisense strand.

[0145] The dsRNA may also have blunt ends, meaning that there are no unpaired nucleotides at that end of the dsRNA, i.e., no nucleotide overhangs. Blunt ends can be located at the 5' end of the antisense strand and the 3' end of the sense strand, or vice versa, or double-ended blunt ends, which are double-stranded dsRNAs along their entire length, i.e., there are no nucleotide overhangs at either end of the molecule.

[0146] In some embodiments, the sense strand or antisense strand of the dsRNA has a nucleotide overhang at the 3' end, the overhang containing 1, 2, 3, or 4 nucleotides, and the 5' end is blunt.

[0147] In some embodiments, overhangs are present at the 3' ends of both the sense and antisense strands, and the overhangs contain 1, 2, 3, or 4 nucleotides.

[0148] In some embodiments, the dsRNA is 19, 21, or 23 nucleotides in length and is double-stranded throughout its entire length, ie, there are no nucleotide overhangs at either end of the molecule.

[0149] In some embodiments, the dsRNA is 21 nucleotides in length, and both the sense and antisense strands have a 2-nucleotide overhang at the 3' end.

[0150] To enhance the in vivo stability of the RNA inhibitors described herein, the sense and antisense strands of the RNA inhibitors may be modified without affecting their activity or even enhancing their activity. The nucleotides therein may have modifying groups, and the entire strand or a portion thereof may be modified. In some embodiments, one or more nucleotides in the sense and / or antisense strands are modified to form modified nucleotides.

[0151] In some embodiments, the sense and antisense strands of the RNA inhibitors (e.g., dsRNA) described herein are unmodified. In other embodiments, the sense and antisense strands of the RNA inhibitors described herein are chemically modified or coupled as known in the art and as described herein to enhance stability or other advantageous properties. In other embodiments of the present application, all or substantially all nucleotides of the RNA inhibitors described herein may be modified, i.e., the strands of the RNA inhibitors contain no more than 5, 4, 3, 2, or 1 unmodified nucleotides.

[0152] The sense and antisense strands of the RNA inhibitors described herein can be synthesized and / or modified using methods known in the art, such as those described in "Current protocols in nucleic acid chemistry", Beaucage, SL et al. (eds.), John Wiley & Sons, Inc., New York, NY, USA, which is incorporated herein by reference. Modifications include, for example, terminal modifications, such as 5'-terminal modifications (phosphorylation, coupling, reverse connection) or 3'-terminal modifications (coupling, DNA nucleotides, reverse connection, etc.); base modifications, such as the use of stabilized bases, destabilized bases, or the removal of bases (abasic nucleotides) or coupled bases; sugar modifications (e.g., 2'-position or 4'-position) or sugar replacement; or backbone modifications, including modification or replacement of phosphodiester linkages. In the RNA inhibitors provided herein, neither the sense nor the antisense strands of the RNA inhibitors need be uniformly modified, and one or more modifications may be incorporated into their individual nucleotides.

[0153] In some embodiments, the modified nucleotide is selected from the group consisting of: deoxyribonucleotides, nucleotide mimetics, abasic nucleotides, 2'-modified nucleotides, 3' to 3' linked (inverted) nucleotides, nucleotides containing non-natural bases, bridged nucleotides, peptide nucleic acids (PNA), unlocked nucleobase analogs, locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabino nucleotides, 5'-Me / 2'-fluoro nucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides and cyclopropylphosphonate-containing nucleotides.

[0154] In some embodiments, the 2'-modified nucleotides include 2'-O-methyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl nucleotides, 2'-amino nucleotides and / or 2'-alkyl nucleotides.

[0155] In some embodiments, the 2' position of the nucleotide sugar moiety at at least two or more even-numbered positions starting from the 5' end of the antisense strand is fluorine.

[0156] In some embodiments, all 2' positions of the nucleotide sugar groups at even-numbered positions starting from the 5' end of the antisense strand are fluorine.

[0157] In some embodiments, at least one of the 2' positions of the sugar moieties at positions 2, 4, 6, 8, 12, and 14 from the 5' end of the antisense strand is fluorine. For example, the 2' positions of the sugar moieties at positions 2, 4, 6, 8, 12, and 14 from the 5' end of the antisense strand are all fluorine.

[0158] In some embodiments, except for the 2nd, 6th, 8th, 10th, 14th, and 16th nucleotides starting from the 5' end of the antisense strand, at least one of the 2' positions of the sugar groups of the remaining nucleotides is a methoxy group.

[0159] In some embodiments, except for the 2nd, 4th, 6th, 8th, 14th, and 16th nucleotides starting from the 5' end of the antisense strand, at least one of the 2' positions of the sugar groups of the remaining nucleotides is a methoxy group.

[0160] In some embodiments, except for the 2nd, 4th, 6th, 8th, 14th, 16th, 18th, and 20th nucleotides starting from the 5' end, at least one of the 2' positions of the sugar groups of the remaining nucleotides of the antisense strand is a methoxy group.

[0161] In some embodiments, at least two or more nucleotide sugar groups at odd-numbered positions starting from the 5' end of the sense strand have fluorine at the 2' position.

[0162] In some embodiments, the 2' positions of the nucleotide sugar groups at odd-numbered positions starting from the 5' end of the sense strand are all fluorine.

[0163] In some embodiments, at least one of the 2' positions of the sugar groups of the 5th, 7th, 8th, and 9th nucleotides starting from the 5' end of the sense strand is fluorine. For example, the 2' positions of the sugar groups of the 5th, 7th, 8th, and 9th nucleotides starting from the 5' end of the sense strand are all fluorine.

[0164] In some embodiments, except for the 5th, 7th, 8th, and 9th nucleotides starting from the 5' end of the sense strand, at least one of the 2' positions of the sugar groups of the remaining nucleotides is a methoxy group.

[0165] In some embodiments, at least one of the 2' positions of the sugar groups of the 7th, 9th, 10th, and 11th nucleotides from the 5' end of the sense strand is fluorine. For example, the 2' positions of the sugar groups of the 7th, 9th, 10th, and 11th nucleotides from the 5' end of the sense strand are all fluorine.

[0166] In some embodiments, except for the 7th, 9th, 10th, and 11th nucleotides starting from the 5' end of the sense strand, at least one of the 2' positions of the sugar groups of the remaining nucleotides is a methoxy group.

[0167] In some embodiments, at least one of the 2' positions of the sugar groups of the nucleotides at positions 3, 5, 7, 9, 10, 11, 13, and 15 starting from the 5' end of the sense strand is fluorine. For example, the 2' positions of the sugar groups of the nucleotides at positions 3, 5, 7, 9, 10, 11, 13, and 15 starting from the 5' end of the sense strand are all fluorine.

[0168] In some embodiments, except for nucleotides 3, 5, 7, 9, 10, 11, 13, and 15 starting from the 5' end, at least one of the 2' positions of the sugar groups of the remaining nucleotides of the sense strand is a methoxy group.

[0169] In some embodiments, except for the 7th, 8th, 9th, and 10th nucleotides starting from the 5' end of the sense strand, at least one of the 2' positions of the sugar groups of the remaining nucleotides is a methoxy group.

[0170] For example, the -OH at the 2' position of some or all of the nucleotide sugar groups of the sense chain and / or antisense chain can be substituted, wherein the substituent group is fluorine or methoxy, preferably the 2' position of the nucleotide sugar groups at positions 9, 10, and 11 from the 5' end of the sense chain is fluorine and the 2' position of the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, and 20 from the 5' end of the antisense chain is fluorine, and the 2' position of the remaining nucleotide sugar groups are all methoxy, or preferably the 2' position of the nucleotides at positions 5, 7, 8, and 9 from the 5' end of the sense chain is fluorine and the 2' position of the nucleotide sugar groups at positions 2, 4, 8, 14, and 16 from the 5' end of the antisense chain is fluorine, and the 2' position of the remaining nucleotide sugar groups are all methoxy.

[0171] In some embodiments, there are at least two consecutive phosphorothioate bonds between nucleotides in the sense strand and / or antisense strand.

[0172] In some embodiments, at least two consecutive phosphorothioate bonds exist between three consecutive nucleotides at at least one end of the sense strand and / or the antisense strand.

[0173] For example, there are at least two consecutive phosphorothioate bonds between three consecutive nucleotides at the 5' end and the 3' end of the sense strand and the antisense strand.

[0174] For another example, the 2' position of the sugar group of the nucleotides at positions 9, 10, and 11 from the 5' end of the sense strand is fluorine, and the 2' position of the sugar group of the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, and 20 from the 5' end of the antisense strand is fluorine, and the 2' position of the sugar group of the remaining nucleotides is methoxy, and there are at least two consecutive phosphorothioate bonds between three consecutive nucleotides at the 5' and 3' ends of the sense and antisense strands.

[0175] In some embodiments, the 2' position of some nucleotides in the sense strand is fluorine or methoxy, and at least three phosphate bonds between adjacent nucleotides at the end of the antisense strand can be thiolated. From the 5' end of the sense strand, the 2' position of nucleotides 5, 7, 8, 9 or 3, 5, 7, 8, 9, 11, 13, and 15 is fluorine, and the 2' position of the remaining nucleotides is methoxy, and at least three phosphate bonds between adjacent nucleotides at the end of the antisense strand can be thiolated.

[0176] In some embodiments, the 2' position of some nucleotides in the sense strand is fluorine or methoxy, and at least three phosphate bonds between adjacent nucleotides at the end of the antisense strand can be thiolated. From the 5' end of the sense strand, the 2' position of nucleotides 9, 10, 11, or 3, 5, 7, 8, 9, 11, 13, 15, and / or 17 is fluorine, and the 2' position of the remaining nucleotides is methoxy, and at least three phosphate bonds between adjacent nucleotides at the end of the antisense strand can be thiolated.

[0177] In some embodiments, the sense strand and antisense strand of the RNA inhibitor of the present invention are selected from the following Table 4:

[0178] Table 4 Sequence-modified RNA inhibitors

[0179] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidine; fGs = 2'-fluoro-3'-thioguanylate, fAs = 2'-fluoro-3'-thioadenylate, fUs = 2'-fluoro-3'-thiouridylate, fCs = 2'-fluoro-3'-thiocytidine, T = 2'-deoxy-thymidylate, dT = 2'-deoxy-thymidylate. In some embodiments, the sense strand and antisense strand of the RNA inhibitor of the present invention are selected from the following Table 5:

[0180] Table 5 Sequence-modified RNA inhibitors

[0181] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidine; fGs = 2'-fluoro-3'-thioguanylate, fAs = 2'-fluoro-3'-thioadenylate, fUs = 2'-fluoro-3'-thiouridylate, fCs = 2'-fluoro-3'-thiocytidine, dT = 2'-deoxythymidylate.

[0182] In some embodiments, the sense strand and antisense strand of the RNA inhibitor of the present invention are selected from the following Table 6:

[0183] Table 6 Sequence-modified RNA inhibitors

[0184] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidine; fGs = 2'-fluoro-3'-thioguanylate, fAs = 2'-fluoro-3'-thioadenylate, fUs = 2'-fluoro-3'-thiouridylate, fCs = 2'-fluoro-3'-thiocytidine, T = 2'-deoxythymidylate, dT = 2'-deoxythymidylate.

[0185] In some embodiments, the sense strand and antisense strand of the RNA inhibitor of the present invention are selected from the following Table 7:

[0186] Table 7 Sequence-modified RNA inhibitors

[0187] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidine; fGs = 2'-fluoro-3'-thioguanylate, fAs = 2'-fluoro-3'-thioadenylate, fUs = 2'-fluoro-3'-thiouridylate, fCs = 2'-fluoro-3'-thiocytidine, dT = 2'-deoxythymidylate.

[0188] In some embodiments, the sense strand and antisense strand of the RNA inhibitor of the present invention are selected from the following Table 8:

[0189] Table 8 Sequence-modified RNA inhibitors

[0190] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidine; fGs = 2'-fluoro-3'-thioguanylate, fAs = 2'-fluoro-3'-thioadenylate, fUs = 2'-fluoro-3'-thiouridylate, fCs = 2'-fluoro-3'-thiocytidine, dT = 2'-deoxythymidylate.

[0191] In some embodiments, the sense strand or antisense strand of the RNA inhibitor described in the present invention has a sequence of at least 15 consecutive nucleotides identical to the sense strand or antisense strand in Tables 4 to 8, or a sequence that differs by one, two, or three nucleotides.

[0192] In some embodiments, the distribution, targeting, or stability of an RNA inhibitor is altered by introducing a ligand for a target tissue receptor into the vector. For example, a specific ligand can provide enhanced affinity for a selected target (e.g., a molecule, cell or cell type, compartment (e.g., a cell or organ compartment, body tissue, organ, or region)) compared to a species in which the ligand is not present.

[0193] Ligands can include naturally occurring substances such as proteins (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulins); carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine, or hyaluronic acid); or lipids. Ligands can also be recombinant or synthetic molecules, such as synthetic polymers, for example, synthetic polyamino acids.

[0194] The ligand can also include a targeting group, such as a cell or tissue targeting agent that binds to a specified cell type such as a kidney cell, such as a lectin, glycoprotein, lipid or protein, such as an antibody. The targeting group can be thyrotropin, melanocyte stimulating hormone, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyamino acids, multivalent galactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipid, cholesterol, steroid, bile acid, folic acid, vitamin B12, vitamin A, biotin or RGD peptide or RGD peptide mimetic. In some embodiments, the ligand is a multivalent galactose, such as N-acetyl-galactosamine.

[0195] The sense and antisense strands of the RNA inhibitors of the present invention can be conveniently and routinely prepared by the well-known techniques of solid phase synthesis. Any other method known in the art for such synthesis, such as liquid phase synthesis or fermentation, can be used additionally or alternatively.

[0196] In some embodiments, in addition to commercially available and conventionally used standard nucleoside phosphoramidite monomers and non-standard nucleoside phosphoramidite monomers, the sense strand and antisense strand comprised by the RNA inhibitor of the present application can be synthesized by an automatic synthesizer using a phosphoramidite method derived from carrier-nucleoside phosphoramidite monomers.

[0197] In some embodiments, the ligand of the present invention is coupled to the 5' end and / or 3' end of the antisense strand, and / or the 5' end and / or 3' end of the sense strand via a carrier structure.

[0198] For example, the carrier structure can be coupled to the 5' end and / or the 3' end of the sense strand; or the carrier structure can be coupled to the 5' end of the antisense strand and the carrier structure can be coupled to the 3' end of the sense strand; or the carrier structure can be coupled to the 3' end of the antisense strand and the ligand can be coupled to the 5' end of the sense strand.

[0199] In some embodiments, the carrier structure includes 5'MVIP and 3'MVIP, wherein the 5'MVIP is coupled to the 5' end of the sense strand and / or antisense strand, and the 3'MVIP is coupled to the 3' end of the antisense strand and / or sense strand. The structure of the 5'MVIP is shown in Formula I, and the structure of the 3'MVIP is shown in Formula II.

[0200] (XL) n -BD-R1-,

[0201] I

[0202] (XL) m -BD-R2-,

[0203] II

[0204] in,

[0205] X is a liver-targeting specific ligand;

[0206] L is a branched chain;

[0207] B is the connector;

[0208] D is the connecting chain;

[0209] R1 and R2 are transfer points;

[0210] The 5'MVIP is connected to the 5' end of the sense strand or the 5' end of the antisense strand through the transfer point R1, and the 3'MVIP is connected to the 3' end of the sense strand or the 3' end of the antisense strand through the transfer point R2. n and m are each independently any integer from 0 to 4, and n+m=an integer from 2 to 6, preferably n+m=2, 3 or 4, and more preferably 4.

[0211] In some embodiments, the connection between R1 or R2 and the sense strand or antisense strand is through phosphate or modified phosphate, and R1 or R2 is preferably connected to the sense strand or antisense strand through phosphate or phosphorothioate.

[0212] In some embodiments, m or n may be 0, ie, there is no 3'MVIP or 5'MVIP.

[0213] In some embodiments, when n=0 (ie, there is no 5'MVIP), the structure of the 3'MVIP may be:

[0214] In some embodiments, when n=1, the structure of the 3'MVIP can be:

[0215] In some embodiments, when n=2, the structure of the 3'MVIP can be:

[0216] In some embodiments, when n=3, the structure of the 3'MVIP can be:

[0217] In some embodiments, when n=4, the structure of the 3'MVIP can be:

[0218] In some embodiments, n refers to the sum of n's in 5'MVIPs placed at the 5' ends of both the sense and antisense strands of the RNA inhibitor, and m refers to the sum of m's in 3'MVIPs placed at the 3' ends of both the sense and antisense strands of the RNA inhibitor.

[0219] In some embodiments, the R1 and R2 structures contain -NH-, -S- and / or -O-, and R1 and R2 are connected to the connecting chain D and the 5' end and 3' end of the sense chain and / or antisense chain respectively through the -NH-, -S- or -O- in the structure, and R1 and R2 are the same or different.

[0220] In some embodiments, R1 and R2 are optionally straight carbon chains, or straight carbon chains with amide, carboxyl or alkyl side chains, or cyclic structures, wherein the cyclic structure includes a saturated or unsaturated aliphatic carbocyclic group, or a five-membered or six-membered heterocyclic group or aromatic hydrocarbon group containing sulfur, oxygen or nitrogen atoms.

[0221] In some embodiments, the R1 and / or R2 is -E1(CH2) x CH2E2-, wherein x is any integer from 3 to 12, and the groups E1 and E2 can be -NH-, -S- or -O-, respectively.

[0222] In some embodiments, the R1 and / or R2 is -E1(CH2) x1 CH(OH)(CH2) x2 E2-, wherein x1 or x2 is each independently any integer from 3 to 10, and E1 and E2 can be -NH-, -S- or -O-.

[0223] In some embodiments, R1 is a heterocyclic or carbocyclic structure containing N, S or O as shown below:

[0224] In some embodiments, the transition point R1 is -NH(CH2) x CH2O-, wherein x is any integer from 3 to 12, preferably any integer from 4 to 6, can be introduced by the following two phosphoramidite monomers.

[0225] i. An -O- or -S- group in the R1 structure is used to synthesize the R1 phosphoramidite monomer, which is then incorporated into the 5' end of the sense or antisense strand of an RNA inhibitor via solid-phase synthesis. The -NH-, -S-, or -O- group in this structure is used to connect to the linker strand D in the 5'MVIP, thereby introducing the liver-targeting-specific ligand X into the 5' end of the sense or antisense strand of the RNA inhibitor. An exemplary structure of a monomer incorporated into the 5' end of the sense or antisense strand of an RNA inhibitor is as follows:

[0226] In some embodiments, the following structures are preferred:

[0227] ii. One -NH-, -S-, or -O- in the R1 structure is first connected to the connecting chain D, and the other -NH-, -S-, or -O- is used to form an ester with the phosphoramidite in the synthesis of the 5'MVIP phosphoramidite monomer. Examples of the structures of the sense chain or antisense chain 5'MVIP phosphoramidite monomer are as follows:

[0228] In some embodiments, the 5'MVIP phosphoramidite monomer of the sense chain or antisense chain preferably has the following structure:

[0229] When n in the general formula is 1-4, the linker B portion in the above monomer is branched 1 to 4 times to obtain the corresponding monomer compound. With the help of the above monomer compound, the liver-targeting specific ligand X is introduced into the 5' end of the sense chain or antisense chain through solid phase synthesis.

[0230] In some embodiments, the transition point R1 is -NH(CH2) x CH2O-, wherein x can be any integer from 3 to 12, preferably any integer from 4 to 6.

[0231] In some embodiments, the 5'MVIP phosphoramidite monomer structure is selected from the following structures:

[0232] In some embodiments, the transition point R2 is a heterocyclic or carbocyclic structure containing N, S, or O as shown below:

[0233] In some embodiments, the transition point R2 is -NH(CH2) x1 CH(OH)(CH2) x2 CH2O-, wherein x1 is any integer from 1 to 4, and x2 is any integer from 0 to 4.

[0234] The transfer point R2 described in the present application is formed by forming an ester or amide with -NH-, -S- or -O- in the R2 structure through succinic anhydride, and coupling with -NH- in the blank Solid Support to form a 3'MVIP solid spport, and then introducing 3'MVIP into the 3' end of the sense chain or antisense chain through the phosphoramidite solid phase synthesis method.

[0235] In some embodiments, the heterocyclic ring in the transition point R2 structure is a pyrrole ring or a piperidine ring, which is connected to the connecting chain D of 3'MVIP via the nitrogen heteroatom in the ring. The exemplary structure of the introduced 3'MVIP solid spport is as follows:

[0236] When m in the general formula is 1-4, the linker B portion in the above monomer is branched 1 to 4 times to obtain the corresponding Solid Support.

[0237] In some embodiments, the transition point R2 is -B4(CH2) x1 CH(OH)(CH2) x2CH2B5-, wherein x1 is any integer from 1 to 4, x2 is any integer from 0 to 4, B4 and B5 are respectively -NH-, -S- or -O-, and the exemplary structure of the introduced 3'MVIP solid spport is as follows:

[0238] When m in the general formula is 1-4, the linker B portion in the above monomer is branched 1 to 4 times to obtain the corresponding Solid Support.

[0239] In some embodiments, R2 is -NHCH2CH(OH)CH2O-, and the exemplary structure of the introduced 3'MVIP solid spport is as follows:

[0240] When m in the general formula is 1-4, the linker B portion in the above monomer is branched 1 to 4 times to obtain the corresponding Solid Support.

[0241] In some embodiments, the 3'MVIP solid support structure is as follows:

[0242] In some embodiments, the liver-targeting-specific ligand X is selected from structures used to enhance hepatocyte uptake of RNA inhibitors, and may include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptide mimetics. In the RNA inhibitors provided herein, the liver-targeting-specific ligands X introduced into the ends of the sense or antisense strands of the RNA inhibitors may be identical or different. For example, some may enhance liver targeting, some may modulate the in vivo pharmacokinetics of the RNA inhibitor, or some may possess in vivo lytic activity. In some embodiments, the liver-targeting-specific ligand X is selected from one or more monosaccharides and their derivatives listed below.

[0243] In some embodiments, the monosaccharide is selected from one or more of the following structures: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, ribose. The monosaccharide derivative is selected from mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives and other derivatives.

[0244] In some embodiments, the liver-targeting specific ligand X is selected from galactose, galactosamine, N-acetylgalactosamine and derivatives thereof, and its general structural formula is as follows:

[0245] Wherein, W1 is hydrogen or a hydroxyl protecting group, which may be the same or different; W is -OH, -NHCOOH or -NHCO(CH2) q CH3, wherein q is an integer from 0 to 4; W2 is -NH-, O, S or C.

[0246] In some embodiments, the liver-targeting specific ligand X is N-acetylgalactosamine and its derivatives.

[0247] In some embodiments, the liver-targeting specific ligand X is selected from the following structures:

[0248] Wherein, W is selected from -OH, -NHCOOH or -NHCO(CH2) q One or two of CH3, wherein q is an integer of 0-4.

[0249] In some embodiments, the liver-targeting specific ligand X in the same 5'MVIP or 3'MVIP structure may be the same or different.

[0250] In some embodiments, X between 5'MVIP and 3'MVIP may be the same or different.

[0251] In some embodiments, the branched chain L is a group containing -NH-, -C(=O)-, -O-, -S-, amide, phosphoryl, thiophosphoryl, C4-C 10 aliphatic carbocyclic group, phenyl group or a combination of these groups C4-C 18 Carbon chain.

[0252] In some embodiments, the branched chain L further has a hydroxyethyl or carboxylic acid side chain.

[0253] In some embodiments, the side chain L is a C7-C 18 Carbon chain.

[0254] In some embodiments, the side chain L is selected from one or more of the following structures:

[0255] Wherein, r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, and Z is H, an alkyl group or an amide group, such as a C1-C5 alkyl group.

[0256] In some embodiments, the structure of the linker B is related to the number of Xs that can be introduced. The linker B contains -NH-, C, O, S, amide, phosphoryl, or thiophosphoryl. When n or m is 1, it is a straight carbon chain. When n or m is 2, 3, or 4, the number of forks is 2, 3, or 4, respectively.

[0257] In some embodiments, the linker B is selected from the following structures:

[0258] wherein A1 and A2 are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl or thiophosphoryl, and r is an integer of 0-4.

[0259] In some embodiments, the linker B is selected from the following structures:

[0260] Wherein, r is any integer from 0 to 4.

[0261] In some embodiments, the linker B is selected from the following structures:

[0262] In some embodiments, the linker B is selected from the following structures:

[0263] In some embodiments, the connecting chain D is a group containing -NH-, C=O, O, S, amide, phosphoryl, thiophosphoryl, aromatic hydrocarbon, C4-C 10 aliphatic carbocyclic group, a five-membered or six-membered heterocyclic group containing 1 to 3 nitrogen atoms, or a combination of these groups; 18 Carbon chain.

[0264] In some embodiments, the connecting chain D further has a side chain of a hydroxymethyl group, a methyl tert-butyl group, a methylphenol group, or a C5-C6 aliphatic ring group.

[0265] In some embodiments, the connecting chain D is a C3-C ... 10 Carbon chain.

[0266] In some embodiments, the connecting chain D is a C3-C containing two C=O 10 Carbon chain.

[0267] In some embodiments, the connecting chain D is selected from the following structures:

[0268] Wherein, each p is independently any integer from 1 to 20; s is an integer from 2 to 13; Z1 and Z2 are the same or different substituent groups, such as C3-C 10 alkyl.

[0269] In some embodiments, the connecting chain D is selected from the following structures:

[0270] In some embodiments, the connecting chain D is selected from the following structures:

[0271] In some embodiments, the (XL) in the 5'MVIP structure n -BD- and 3'MVIP structures (XL) m -BD- is selected from one or more of the following structures:

[0272] In some embodiments, the X, L, B, and D are the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP.

[0273] In some embodiments, the (XL) in the 5'MVIP structure n -BD- is selected from the structures shown in Table 9:

[0274] Table 9 5'MVIP (XL) n -BD-Structure

[0275] In some embodiments, 5'MVIP may not exist, in which case m may be any integer from 2 to 4.

[0276] In some embodiments, (XL) in the 3'MVIP structure m -BD- is selected from the structures shown in Table 10:

[0277] Table 10 3'MVIP (XL) m -BD-Structure

[0278] In some embodiments, the carrier structure 5'MVIP (XL) nThe combinations of -BD- and R1 are shown in Table 11.

[0279] Table 11 5'MVIP Medium (XL) n -BD- and R1 combination

[0280] In some embodiments, 3'MVIP may not exist, in which case n may be any integer from 2 to 4.

[0281] In some embodiments, the carrier structure 3'MVIP (XL) m The combinations of -BD- and R2 are shown in Table 12.

[0282] Table 12 3'MVIP (XL) m -BD- combined with R2

[0283] In some embodiments, the 5'MVIP is selected from any one or more of 5'MVIP01 to 5'MVIP22 in Table 11.

[0284] In some embodiments, the 3'MVIP is selected from any one or more of 3'MVIP01 to 3'MVIP27 in Table 12.

[0285] In some embodiments, a 5'MVIP in Table 11 may be combined with any of the 3'MVIPs in Table 12, wherein n+m=2, 3, 4, 5, or 6.

[0286] In some embodiments, the sense strand in the RNA inhibitor can be a sequence selected from the following Table 13:

[0287] Table 13 Sense chain coupled with 5'MVIP09

[0288] In some embodiments, the sense strand of the RNA inhibitor described herein has a sequence of at least 15 consecutive nucleotides identical to the sense strand in Table 13, or a sequence that differs from the sense strand in Table 13 by one, two, or three nucleotides.

[0289] In some embodiments, the antisense strand in the RNA inhibitor can be selected from the sequences in Table 14 below:

[0290] Table 14 Antisense strand coupled to 3'MVIP09

[0291] In some embodiments, the antisense strand of the RNA inhibitor described herein has a sequence of at least 15 consecutive nucleotides identical to the antisense strand in Table 14, or a sequence that differs from the antisense strand in Table 14 by one, two, or three nucleotides.

[0292] In some in vivo test embodiments, the RNA inhibitors described herein are selected from the sequences in Table 15:

[0293] Table 15 RNA inhibitors containing 5'MVIP09 / 3'MVIP09 combination

[0294] In some embodiments, the sense strand and antisense strand of the RNA inhibitor described in the present invention have a sequence of at least 15 consecutive nucleotides identical to the sense strand and antisense strand in Table 15, or differ from each sequence in Table 15 by one, two, or three nucleotides.

[0295] In some embodiments, the antisense strand of the RNA inhibitor of the present invention is:

[0296] UsfCsGfUAfUAACAAfUAfAGfGAfGCsfUsG (SEQ ID NO: 278), the 5' end and / or 3' end of which are connected to 5'MVIP and / or 3'MVIP of different structures, and the antisense strand of the connection vector structure is selected from the following Table 16:

[0297] Table 16 5'MVIP and / or 3'MVIP coupled antisense strand

[0298] In some embodiments, the antisense strand of the RNA inhibitor described herein has a sequence of at least 15 consecutive nucleotides identical to the antisense strand in Table 16, or a sequence that differs from the antisense strand in Table 16 by one, two, or three nucleotides.

[0299] In some embodiments, the antisense strand of the RNA inhibitor of the present invention can be obtained by coupling the antisense strands in Tables 5 to 8 with 5'MVIP and / or 3'MVIP.

[0300] In some embodiments, the antisense strand of the RNA inhibitor described in the present invention has a sequence of at least 15 consecutive nucleotides identical to the antisense strand in Tables 5 to 8, or a sequence that differs from the antisense strand in Tables 5 to 8 by one, two, or three nucleotides, coupled with 5'MVIP and / or 3'MVIP.

[0301] In some embodiments, the sense strand of the RNA inhibitor of the present invention is: CsAsGCUCCUfUfAfUUGUUAUACsGsA (SEQ ID NO: 270), the 5' end and / or 3' end of which is linked to a 5'MVIP and / or 3'MVIP of different structures, wherein the sense strand of the linker vector structure is selected from the following Table 17:

[0302] Table 17 5'MVIP and / or 3'MVIP coupled sense strand

[0303] In some embodiments, the sense strand of the RNA inhibitor described in the present invention has a sequence of at least 15 consecutive nucleotides identical to the sense strand in Table 17, or a sequence that differs from the sense strand in Table 17 by one, two, or three nucleotides.

[0304] In some embodiments, the sense strand of the RNA inhibitor of the present invention can be obtained by coupling the sense strands in Tables 5 to 8 with 5'MVIP and / or 3'MVIP.

[0305] In some embodiments, the sense strand of the RNA inhibitor described in the present invention has a sequence of at least 15 consecutive nucleotides identical to the sense strand in Tables 5 to 8, or is a sequence that differs from the sense strand in Tables 5 to 8 by one, two, or three nucleotides coupled to 5'MVIP and / or 3'MVIP.

[0306] In some embodiments, the RNA inhibitors described herein are formed by random pairing of the antisense strands in Table 16 or sequences differing from these antisense strands by one, two, or three nucleotides and the sense strands in Table 17 or sequences differing from these sense strands by one, two, or three nucleotides.

[0307] In some embodiments, the sense strand and / or antisense strand of the RNA inhibitor is identical to the sense strand and / or antisense strand in Table 19 for at least 15 consecutive nucleotides, or differs by one, two, or three nucleotides.

[0308] Patent CN113171371B examines in detail the effects of different X, L, B, D, R1 and R2 in the 5'MVIP and / or 3'MVIP structures on the RNA inhibitory activity, and the entire text of this patent is incorporated into this specification.

[0309] When X is galactose, galactosamine, N-acetylgalactosamine and its derivatives, among the RNA inhibitors provided by the present invention, N-acetylgalactosamine and its derivatives are preferably used as liver-targeting specific ligands:

[0310] The length of L significantly influences the efficacy of RNA inhibitors; the L chain should be neither too short nor too long. When containing -NH-, C=O, O, S, amide, phosphoryl, thiophosphoryl, aliphatic carbocyclic groups such as cyclohexane, or combinations of these groups, or within the same 5'MVIP or 3'MVIP structure, or when the L structures of 5'MVIP and 3'MVIP are different, the activity of the resulting RNA inhibitors is similar within the carbon chain length range of C7-C18.

[0311] In addition to the structural changes in linker B, when X, L, D, and R1 / R2 are consistent with those in the combination 5'MVIP09 / 3'MVIP09, A1 and A2 in the general formula of linker B are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl, or thiophosphoryl, r is any integer from 0 to 4, and when linker B is the same or different between 5'MVIP and 3'MVIP, the resulting RNA inhibitory activity is not much different.

[0312] When the MVIP structure and RNA inhibitor are the same, different connecting chains D will affect the activity of the RNA inhibitor, among which D1, D2, and D4 have similar effects and are better than D3.

[0313] Different transfer points R1 will affect the activity of RNA inhibitors, among which R1-1 as the transfer point has the best RNA inhibitor activity.

[0314] Different transfer points R2 will affect the activity of RNA inhibitors, among which R2-1 is the best when used as the transfer point.

[0315] In some embodiments, n+m in the RNA inhibitors described in the present invention are 2, 3, 4, 5 and 6 respectively. The positions where 5'MVIP and / or 3'MVIP are coupled include the 5' end and / or 3' end of the antisense chain, the 5' end and / or 3' end of the sense chain, the 5' end of the antisense chain and the 3' end of the sense chain, and the 5' end of the sense chain and the 3' end of the antisense chain.

[0316] In some embodiments, n+m in the RNA inhibitors of the present invention is 2, 3, 4, 5, and 6, respectively. The positions to which 5'MVIP and / or 3'MVIP are coupled include the 5' end and / or 3' end of the antisense strand in Tables 5-8, the 5' end and / or 3' end of the sense strand in Tables 5-8, the 5' end of the antisense strand and the 3' end of the sense strand in Tables 5-8, and the 5' end of the sense strand and the 3' end of the antisense strand in Tables 5-8. The obtained 5'MVIP and 3'MVIP combinations are shown in Table 18:

[0317] Table 18 5'MVIP and 3'MVIP combination list

[0318] In some embodiments, n and m are each independently any integer from 0 to 4, preferably each independently an integer from 1 to 3, and n+m=an integer from 2 to 6, preferably n+m=2, 3 or 4, more preferably 4.

[0319] In some embodiments, the RNA inhibitor is selected from Table 19:

[0320] Table 19 RNA inhibitors

[0321] In some embodiments, the sense strand and / or antisense strand of the RNA inhibitor has a sequence of at least 15 consecutive nucleotides identical to the sense strand and / or antisense strand in Table 19, or a sequence that differs from the sense strand and / or antisense strand in Table 19 by one, two, or three nucleotides.

[0322] In some embodiments, the RNA inhibitors described herein or pharmaceutically acceptable salts thereof are preferably prepared or synthesized in the form of sodium salts, triethylamine salts or other pharmaceutically acceptable salts.

[0323] In some embodiments, the RNA inhibitor described herein or a pharmaceutically acceptable salt thereof is more preferably a sodium salt or a triethylamine salt thereof.

[0324] On the other hand, the present application also provides a pharmaceutical composition comprising the above-mentioned RNA inhibitor or a pharmaceutically acceptable salt thereof.

[0325] In some embodiments, the present invention provides a pharmaceutical composition comprising the above-mentioned RNA inhibitor or a pharmaceutically acceptable salt thereof and an optional pharmaceutically acceptable excipient. The pharmaceutical composition comprising the above-mentioned RNA inhibitor provided by the present invention can be used to prevent and / or treat related disorders, such as hypertension. Such pharmaceutical compositions are formulated according to the mode of delivery. One example is a composition formulated for systemic administration by parenteral delivery, for example, subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical composition provided herein can be administered at a dose sufficient to inhibit LPA gene expression.

[0326] A pharmaceutically acceptable "excipient" or "vegetarian" is a pharmaceutically acceptable solvent, suspending agent, or any other pharmaceutically inert vehicle used to deliver one or more nucleic acids to an animal. Excipients can be liquid or solid and are selected based on the intended mode of administration to provide the desired volume, consistency, etc. when combined with the nucleic acid and other components of a given pharmaceutical composition. The RNA inhibitors described herein can be delivered in a manner that targets specific tissues (e.g., hepatocytes).

[0327] In some embodiments, the pharmaceutical composition of the present invention further comprises a delivery vehicle (such as nanoparticles, dendrimers, polymers, liposomes or cationic delivery systems).

[0328] In some embodiments, the delivery vehicle described herein comprises a liposome.

[0329] In some embodiments, the delivery vehicle of the present invention comprises nanolipids, which can form liposome-nucleic acid nanoparticles with nucleic acid molecules.

[0330] In some embodiments, the delivery vehicle described herein comprises the amphiphilic lipid compound M10C1.

[0331] The pharmaceutical compositions provided herein include, but are not limited to, solutions, emulsions, and formulations comprising liposomes. These compositions can be produced from a variety of components, including, but not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semisolids. Such formulations include those targeted to the liver. The pharmaceutical formulations of the present application, which can be conveniently presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of combining the active ingredient with a pharmaceutically acceptable excipient or vehicle.

[0332] use

[0333] On the other hand, the present application provides a method for reducing LPA mRNA or protein expression in cells or tissues, comprising contacting the cells or tissues with an effective amount of the aforementioned RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof, and / or the aforementioned pharmaceutical composition.

[0334] Cells suitable for treatment using the methods of the present application can be any cell expressing an LPA gene, for example, liver cells, brain cells, gallbladder cells, heart cells, or kidney cells, but are preferably liver cells. Cells suitable for use in the methods of the present application can be mammalian cells, and when contacted with cells expressing an LPA gene, the RNA inhibitor inhibits the expression of the LPA gene (e.g., human, primate, non-primate, or rat LPA gene) by at least about 50%, as determined, for example, by PCR or branched DNA (bDNA)-based methods, or by protein-based methods such as immunofluorescence analysis, Western blotting, or flow cytometry.

[0335] In some embodiments, the tissue is liver tissue.

[0336] In some embodiments, the cells and tissues are ex vivo.

[0337] In some embodiments, the cells and tissues are in a subject.

[0338] As used herein, the term "inhibit" is used interchangeably with "reduce," "reduced," "silenced," "down-regulated," "suppressed," and other similar terms, and encompasses any level of inhibition. LPA gene expression can be assessed based on the level or change in level of any variable associated with LPA gene expression, for example, LPA mRNA levels. This level can be analyzed in a single cell or in a population of cells (including, for example, a sample derived from a subject). The control level can be any type of control level used in the art, for example, a baseline level before administration or a level measured from a similar subject, cell, or sample that has not been treated or that has been treated with a control (e.g., a buffer-only control or a no-active-agent control).

[0339] Inhibition of LPA gene expression can be manifested by a decrease in the amount of mRNA expressed by a first cell or cell population (such cells may, for example, be present in a sample derived from a subject) in which the LPA gene is transcribed and has been treated (e.g., by contacting one or more cells with an RNA inhibitor of the present invention, or by administering an RNA inhibitor of the present invention to a subject in which such cells are present) such that LPA gene expression is inhibited, compared to a second cell or cell population that is substantially identical to the first cell or cell population but has not been treated in this manner (control cells that have not been treated with an RNA inhibitor or with an RNA inhibitor targeting the gene of interest).

[0340] In a preferred embodiment, the assay is performed by using appropriate concentrations of siRNA in cell lines that highly express LPA, and the mRNA levels in the treated cells are expressed as a percentage of the mRNA levels in non-treated control cells.

[0341] In other embodiments, inhibition of LPA gene expression can be assessed by a decrease in a parameter functionally associated with LPA gene expression, such as, for example, LP(a) levels in the blood or serum of a subject. LPA gene inhibition can be measured in any cell expressing LPA (either endogenous or exogenous from an expression construct) and by any assay known in the art.

[0342] Inhibition of LPA expression can be manifested by a decrease in the level of LP(a) expressed by a cell or cell population or a sample from a subject (eg, protein levels in a blood sample from a subject).

[0343] Control cells, cell populations, or subject samples that can be used to evaluate LPA gene inhibition include cells, cell populations, or subject samples that have not been contacted with the RNA inhibitors of the present application. For example, control cells, cell populations, or subject samples can be derived from a single subject (e.g., a human or animal subject) or an appropriately matched population control prior to treatment with the RNA inhibitor.

[0344] The level of LPA mRNA expressed by a cell or cell population can be measured using any method known in the art for evaluating mRNA expression. For example, qRT-PCR can be used to evaluate a decrease in gene expression. A decrease in protein production can be evaluated by any method known in the art, such as ELISA. In some embodiments, a liver biopsy sample is used as the tissue material for monitoring a decrease in LPA gene expression. In other embodiments, a blood sample is used as the subject sample for monitoring a decrease in LP(a) expression.

[0345] On the other hand, the present application provides the use of the aforementioned RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition in the preparation of a medicament for preventing and / or treating a disease or condition or reducing the risk of a disease or condition.

[0346] In some embodiments, the diseases or conditions described herein include diseases or conditions associated with the LPA gene, such as cardiovascular disease.

[0347] In some embodiments, the disease or condition described herein is selected from the group consisting of: hyperLP(a)emia, hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease, aortic valve stenosis, vascular disease, myocardial infarction, angina pectoris, kidney disease, renal failure, obesity, glucose intolerance, type 2 diabetes (non-insulin-dependent diabetes mellitus), and metabolic syndrome.

[0348] On the other hand, the present application provides a method for preventing and / or treating a disease or condition, comprising administering to a subject in need thereof an effective amount of the aforementioned RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof, and / or the aforementioned pharmaceutical composition.

[0349] The in vivo methods of the present application may include administering to a subject a pharmaceutical composition comprising an RNA inhibitor, wherein the RNA inhibitor comprises a nucleotide sequence complementary to at least a portion of LPA mRNA of a mammal to which the RNA inhibitor is administered. The pharmaceutical compositions of the present invention may be administered by any means known in the art, including but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In some embodiments, the pharmaceutical composition is administered by intravenous infusion or injection. In some embodiments, the pharmaceutical composition is administered by subcutaneous injection. In some embodiments, the composition is administered by intramuscular injection.

[0350] The RNA inhibitors provided herein can also be administered as "free RNA inhibitors." Free RNA inhibitors are administered in the absence of a pharmaceutical composition. Naked RNA inhibitors can be in a suitable buffer. The buffer can contain acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer is phosphate-buffered saline (PBS). The pH and osmotic pressure of the buffer containing the RNA inhibitor can be adjusted so that it is suitable for administration to a subject.

[0351] Alternatively, the RNA inhibitors provided herein can be administered as a pharmaceutical composition, such as a liposomal formulation.

[0352] The pharmaceutical compositions provided herein can be administered at a dosage sufficient to inhibit LPA gene expression. Typically, a suitable dosage of the RNA inhibitors described herein is in the range of about 0.001 to about 200.0 mg per kilogram of subject body weight per day, typically in the range of about 1 to 50 mg per kilogram of subject body weight per day. Typically, a suitable dosage of the RNA inhibitors described herein is in the range of about 0.1 mg / kg to about 5.0 mg / kg, for example, in the range of about 0.3 mg / kg to about 3.0 mg / kg.

[0353] In one embodiment, the method comprises administering a pharmaceutical composition of the present invention to reduce target LPA gene expression, such as for about 1, 2, 3, 4, 5, 6, 1-6, 1-3, or 3-6 months per dose. In some embodiments, the pharmaceutical composition is administered once every 3-6 months.

[0354] In some embodiments, after the initial treatment regimen, the treatment is administered less frequently. A repeated dosage regimen may include administering a therapeutic amount of the RNA inhibitor regularly, such as once a month to once a year. In some embodiments, the RNA inhibitor is administered about once a month to about once every three months, or about once every three months to about once every six months.

[0355] After the initial treatment, the RNA inhibitor can be administered less frequently for treatment. The duration of treatment can be determined based on the severity of the disease.

[0356] In other embodiments, a single dose of the pharmaceutical composition can be long-acting, such that the dosage is administered at intervals of no more than 1, 2, 3, or 4 months. In some embodiments of the present application, a single dose of the pharmaceutical composition described herein is administered approximately once a month. In other embodiments of the present application, a single dose of the pharmaceutical composition described herein is administered quarterly (i.e., approximately every 3 months). In other embodiments of the present application, a single dose of the pharmaceutical composition described herein is administered 2 times per year (i.e., approximately once every 6 months).

[0357] It will be understood by those skilled in the art that several factors may affect the dosage and administration time required to effectively treat a subject, including but not limited to: mutations present in the subject, previous treatments, the subject's general health or age, and other diseases present. In addition, prevention and / or treatment of a subject may include a single treatment or a series of treatments as needed.

[0358] In some embodiments, the method further comprises determining the level of LP(a) in a sample from the subject.

[0359] For example, the method further comprises determining the level of LP(a) in a blood sample, a serum sample, or a urine sample from the subject.

[0360] In some embodiments, the method further comprises administering to the subject an additional therapeutic agent for treating hyperLP(a)emia, hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease, and aortic stenosis.

[0361] For example, the additional therapeutic agent can be selected from: statins, such as atorvastatin, rosuvastatin, etc.; cholesterol absorption inhibitors such as ezetimibe; PCSK9 inhibitors; ANGPTL3 inhibitors; APOC3 inhibitors and AGT inhibitors.

[0362] In another aspect, the present application provides a cell comprising the aforementioned RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof.

[0363] On the other hand, the present application provides a drug kit comprising the aforementioned RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.

[0364] Without intending to be bound by any theory, the following examples are merely intended to illustrate the RNA inhibitors, preparation methods, and uses provided by the present application, and are not intended to limit the scope of the present invention.

[0365] Example

[0366] illustrate:

[0367] The Chinese name of DMSO is dimethyl sulfoxide;

[0368] The Chinese name of DMF is N,N-dimethylformamide;

[0369] The Chinese name of HOBt is 1-hydroxybenzotriazole;

[0370] The Chinese name of HBTU is O-benzotriazole-tetramethyluronium hexafluorophosphate;

[0371] The Chinese name of DIPEA (DIEA) is N,N-diisopropylethylamine;

[0372] The Chinese name of DCM is dichloromethane;

[0373] The Chinese name of DMAP is 4-dimethylaminopyridine;

[0374] The Chinese name of DMT-CL is 4,4'-dimethoxytriphenylmethane;

[0375] The Chinese name for MEOH is methanol;

[0376] The Chinese name of TBTU is O-benzotriazole-N,N,N',N'-tetramethyluronium tetrafluoroborate;

[0377] The name of the solid phase carrier is macroporous aminomethyl resin (Resin).

[0378] Example 1 Synthesis of RNA Inhibitors

[0379] The sense and antisense strands of the uncoupled carrier structure are synthesized using a standard solid-phase phosphoramidite method using a multi-channel solid-phase synthesizer, and then the sense strands are complementary annealed with the corresponding antisense strands to prepare the corresponding RNA inhibitors.

[0380] The basic steps of the solid phase phosphoramidite method include:

[0381] 1) Deprotection: removing the hydroxyl protecting group (DMTr) of the starting monomer Solid Support;

[0382] 2) Coupling: Add the first phosphoramidite monomer and the coupling reaction occurs in the 3' to 5' direction;

[0383] 3) Oxidation: oxidizing the resulting nucleoside phosphite to a more stable nucleoside phosphate (i.e., oxidation of trivalent phosphorus to pentavalent phosphorus);

[0384] 4) Blocking: Block the 5'-OH group of the nucleotide sequence that failed in the previous step to prevent it from further participating in the reaction; repeat the above steps until the last phosphoramidite monomer is added; then use methylamine aqueous solution and ammonia water to cleave the ester bond between the Solid Support and the starting monomer, and remove the protecting groups on each base and phosphate on the resulting nucleotide sequence; after HPLC separation and purification, filter sterilization, and lyophilize to obtain the corresponding sense chain or antisense chain.

[0385] Description of the synthesis process of RNA inhibitors:

[0386] Reconstitute the sense and antisense strand lyophilized powders separately and mix them in equal moles. Add an appropriate amount of water for injection and an appropriate amount of TRIS buffer. Gently shake the solution for approximately 1–2 minutes to mix thoroughly. Heat a water bath to 92–95°C. Heat the reaction mixture in a water bath for 3–5 minutes, gently shaking to ensure even heating. Allow to cool naturally to room temperature. A colorless or slightly yellowish transparent liquid is obtained. Sample the solution for analysis and concentration determination.

[0387] Example 2 In vitro inhibition of LPA gene expression by RNA inhibitors 1

[0388] The RNA inhibitors of this example are selected from Table 3 and prepared by the method described in Example 1. Plasmid DNA (LPA_PSICHECK(TM)-2 plasmid) was transfected into Huh7 cells using Fugene HD. Transfected cells were seeded into 96-well plates at a density of 10,000 cells per well, with 100 μL of culture medium per well. The cells were cultured overnight in a 5% CO2, 37°C incubator. The RNA inhibitors were then prepared using PBS to prepare nanolipid-encapsulated RNA inhibitor sample solutions of the corresponding concentrations. RNAiMAX / Opti-MEM was added to each well, and the diluted RNA inhibitor sample solutions of the corresponding concentrations were added to the wells, mixed, and incubated. The incubated mixture was then mixed with DMEM containing 10% FBS. The culture medium in each well was aspirated, and fresh culture medium containing the sample was added. After addition, the plates were incubated in a 5% CO2, 37°C incubator. The final concentrations tested were 5 nM, 0.5 nM, and 0.05 nM.

[0389] Remove the cells from the incubator, discard the supernatant, add fresh culture medium and detection reagent, shake in the dark, and after the cells are fully lysed, transfer the sample to an opaque white plate to detect the luminescent signal of fireflies; add Add the assay reagent, shake in the dark, and measure the Renilla luciferase signal. Calculate the ratio of the primary reporter gene to the internal reference reporter gene signal in each well. The test results are shown in Table 20 and Figure 1.

[0390] Table 20 Inhibitory effect of RNA inhibitors on LPA mRNA in Huh7 cells

[0391] The experimental results showed that the RNA inhibitors in Table 3 exhibited varying degrees of inhibitory effects on LPA mRNA levels in Huh7 cells at different concentrations, and were significantly dose-dependent. At a low concentration of 0.05 nM, except for Kylo-11-DS-03, Kylo-11-DS-17, Kylo-11-DS-20, Kylo-11-DS-24, and Kylo-11-DS-27, whose inhibition rates were less than 40%, the remaining inhibitors all had inhibition rates greater than 40%.

[0392] Example 3 Synthesis of carrier structure

[0393] When the 3' end of the sense or antisense strand of the RNA inhibitor of the present invention is coupled with the support structure 3'MVIP, the solid support of 3'MVIP serves as the starting monomer for solid-phase synthesis. When the 5' end of the sense or antisense strand of the RNA inhibitor of the present invention is coupled with the support structure 5'MVIP, the 5'MVIP phosphoramidite monomer serves as the last monomer for solid-phase synthesis.

[0394] The solid spport formula of 3'MVIP is as follows:

[0395] When m is 1-4, the linker B in the general formula is branched 1 to 4 times to obtain the corresponding Solid Support of 3'MVIP.

[0396] The general formula of 5'MVIP phosphoramidite monomer is as follows:

[0397] When n is 1-4, the linker B in the general formula is branched 1 to 4 times to obtain the corresponding 5'MVIP phosphoramidite monomer.

[0398] The following are only illustrative examples of the chemical synthesis processes of several 3'MVIP Solid Support and 5'MVIP phosphoramidite monomers. By referring to the methods described in the examples, those skilled in the art can easily synthesize the remaining 3'MVIP Solid Support and 5'MVIP phosphoramidite monomers involved in the present invention. The synthetic process is described as follows:

[0399] 3.1 Synthesis of 3'MVIP Solid Support

[0400] 3.1.1 Synthesis of 3'MVIP09 Solid Support

[0401] 3'MVIP09's Solid Support

[0402] Description of the synthesis process:

[0403] 3.1.1.1 Synthesis of ERC-01-c1

[0404] Weigh 5.0 g of 2-amino-1,3-propanediol (54.9 mmol), add 50 mL of DMSO and 5 mL of sodium hydroxide solution (1 g / mL), cool to 0°C, and add tert-butyl acrylate (20 mL, 137.8 mol) dropwise over 2 hours. Let react at room temperature for 48 hours, then add petroleum ether (100 mL). Wash twice with saturated brine, and dry the organic layer. Pass the mixture through a chromatography column (eluent: ethyl acetate:petroleum ether = 25%-75%). Add 0.05% triethylamine to the column to obtain 6.2 g of a colorless oil.

[0405] 3.1.1.2 Synthesis of ERC-01-c2

[0406] Weigh ERC-01-c1 (6.2 g, 17.9 mmol), add 50 mL of dichloromethane and 23 mL of sodium carbonate solution (25%), and add benzyl chloroformate (8.2 mL, 57.4 mmol) dropwise at room temperature for 2 hours. React at room temperature overnight, wash three times with saturated brine, dry over anhydrous sodium sulfate, evaporate the solvent, and pass through a chromatography column (ethyl acetate: petroleum ether = 5%-30%) to obtain 4.0 g of an oil.

[0407] 3.1.1.3 Synthesis of ERC-01-c3

[0408] Take ERC-01-c2 (4.0 g, 8.3 mmol), add 12 mL of formic acid, react at room temperature overnight, and evaporate the solvent under reduced pressure to obtain 2.8 g of the product.

[0409] 3.1.1.4 Synthesis of ERCd-01-c1

[0410] Compounds ERC-01-c3 (1.11 g, 3.0 mmol) and dlSANC-c4 (3.6 g, 8.04 mmol) were added to DMF (60 mL), followed by HOBt (2.24 g) and HBTU (3.36 g), and then DIEA (4.16 mL) was slowly added. The reaction mixture was stirred at room temperature for 3 hours. Water was then added, and the aqueous layer was extracted with dichloromethane (2 x 10 mL). The organic layers were combined and washed sequentially with saturated sodium bicarbonate (80 mL), water (2 x 60 mL), and saturated brine (60 mL). The mixture was dried over anhydrous sodium sulfate, evaporated to dryness under reduced pressure, and purified by silica gel column chromatography (eluent: 3-15% MeOH in DCM). 3.24 g of a pale yellow solid was obtained.

[0411] 3.1.1.5 Synthesis of ERCd-01-c2

[0412] ERCd-01-c1 (3.24 g, 2.6 mmol) was dissolved in methanol (60 mL), and 10% palladium on carbon (0.3 g) and acetic acid (2.0 mL) were added. Hydrogenation was then added under normal pressure, and the reaction was allowed to proceed overnight. The reaction solution was filtered through celite, and the filtrate was evaporated to dryness under reduced pressure to obtain 2.9 g of ERCd-01-c2 as an oil. Its high-resolution mass spectrum is shown in Figure 2.

[0413] 3.1.1.6 Synthesis of 3'MVIP09-c1

[0414] SANCd-01-c0 (0.824 g, 1.5 mmol) and ERCd-01-c2 (1.09 g, 1.0 mmol) were added to the reaction flask in sequence, and then 10 mL of DCM was added and stirred to dissolve. TBTU (0.963 g) and DIPEA (0.517 g) were added in sequence, and the reaction was allowed to proceed overnight. Water was added and the mixture was extracted with DCM. The organic phase was washed with saturated brine, dried, filtered, concentrated, and finally purified by silica gel column to obtain 1.3 g of the product.

[0415] 3.1.1.7 Synthesis of 3'MVIP09-c2

[0416] 3'MVIP09-c1 (1.62 g, 1 μmol) and 10 mL of DCM were added to the reaction flask in sequence, stirred at room temperature to dissolve, and then DMAP (0.366 g) and succinic anhydride (0.2 g, 3 μmol) were added in sequence. The reaction was stirred at room temperature and analyzed by TLC. If the reaction was qualified, DCM was concentrated and water was added. The mixture was extracted with DCM, and the organic phase was washed with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, concentrated, and finally purified by silica gel column to obtain 1.55 g of the product.

[0417] 3.1.1.8 Solid Support Synthesis of 3'MVIP09

[0418] 3'MVIP09-c2 (0.86 g, 0.5 μmol) and 10 mL of DMF were added to the reaction flask in sequence and dissolved. HBTU (0.19 g), DIPEA (0.194 g), and macroporous aminomethyl resin (2.0 g) were then added in sequence. The mixture was shaken for 24 h and filtered. The resin was washed with 10% methanol / DCM and capped with 25% acetic acid / pyridine. The degree of substitution was 150 μmol / g.

[0419] 3.1.2 Synthesis of the Solid Support of 3'MVIP17

[0420] 3'MVIP17 Solid Support

[0421] 3.1.2.1 Synthesis of SANC-01-c1

[0422] The synthesis steps refer to 3.1.1.1. Synthesis of ERC-01-c1.

[0423] 3.1.2.2 Synthesis of SANC-01-c2

[0424] The synthesis steps refer to 3.1.1.2. Synthesis of ERC-01-c2.

[0425] 3.1.2.3 Synthesis of SANC-01-c3

[0426] The synthesis steps refer to 3.1.1.3. Synthesis of ERC-01-c3.

[0427] 3.1.2.4 Synthesis of SANCd-01-c1

[0428] The synthesis steps refer to 3.1.1.4. Synthesis of ERCd-01-c1.

[0429] 3.1.2.5 Synthesis of SANCd-01-c2

[0430] The synthesis steps refer to 3.1.1.5. Synthesis of ERCd-01-c2.

[0431] 3.1.2.6 Synthesis of 3'MVIP17-c1

[0432] The synthesis steps were similar to those described in 3.1.1.6. for the synthesis of 3'MVIP09-c1. The high-resolution mass spectrum of the synthesized 3'MVIP17-c1 is shown in Figure 3 .

[0433] 3.1.2.7 Synthesis of 3'MVIP17-c2

[0434] The synthesis steps refer to 3.1.1.7 Synthesis of 3'MVIP09-c2.

[0435] 3.1.2.8 Solid Support Synthesis of 3'MVIP17

[0436] The synthesis steps refer to 3.1.1.8 Solid Support Synthesis of 3'MVIP09.

[0437] 3.1.3 Synthesis of 3'MVIP01 Solid Support:

[0438] 3'MVIP01 Solid Support

[0439] Description of the synthesis process:

[0440] 3.1.3.1 Synthesis of 3'MVIP01-c1

[0441] The synthesis steps refer to 3.1.1.6.3'MVIP09-c1 synthesis.

[0442] 3.1.3.2 Synthesis of 3'MVIP01-c2

[0443] The synthesis steps refer to 3.1.1.7.3'MVIP09-c2 synthesis.

[0444] 3.1.3.3 Solid Support Synthesis of 3'MVIP01

[0445] The synthesis steps refer to 3.1.1.8.3'Solid Support Synthesis of MVIP09.

[0446] 3.2 Synthesis of 5'MVIP phosphoramidite monomer

[0447] 3.2.1 Synthesis of 5'MVIP09 phosphoramidite monomer:

[0448] 5'MVIP09 phosphoramidite monomer

[0449] 3.2.1.1 Synthesis of 5'MVIP09-ERCd-PFP-c1

[0450] ERCd-01-c2 (2.18 g, 2.0 mmol) was weighed and dissolved in DMF (50 mL). Benzyl glutarate (0.53 g, 2.4 mmol), DIPEA (0.78 g) and TBTU (0.84 g) were added and stirred at room temperature overnight. The mixture was quenched with water (50 mL) and extracted with DCM (30 mL*3). The mixture was washed with 10% citric acid (50 mL*3), saturated sodium bicarbonate (50 mL) and pyridine (100 mL). The mixture was dried over anhydrous sodium sulfate, filtered, rotary evaporated, and purified by column chromatography to obtain the product 5'MVIP09-ERCd-PFP-c1 (2.15 g).

[0451] 3.2.1.2 Synthesis of 5'MVIP09-ERCd-PFP-c2

[0452] 5'MVIP09-ERCd-PFP-c1 (2.15 g, 1.66 mmol) and 10% palladium on carbon (0.21 g) were weighed, methanol (50 mL) was added, and hydrogenation was carried out at room temperature with stirring overnight. After the reaction, the palladium on carbon was filtered through celite and rotary evaporation was performed to obtain a crude product of 5'MVIP09-ERCd-PFP-c2 (1.9 g). Its high-resolution mass spectrum is shown in Figure 4.

[0453] 3.2.1.3 Synthesis of 5'MVIP09-ERCd-PFP

[0454] The crude product of 5'MVIP09-ERCd-PFP-c2 (1.9 g, 1.58 mmol) was weighed and dissolved in DCM (60 mL). DIPEA (1.33 g) was added and cooled. Pentafluorophenol trifluoroacetate (2.21 g, 7.9 mmol) was added and stirred at room temperature for 2 h. The product was then rotary evaporated and dissolved in DCM (60 mL). The product was washed with saturated sodium bicarbonate (30 mL*3), 10% citric acid (30 mL*1), and saturated brine (50 mL*1). The product was dried over anhydrous sodium sulfate, filtered, and rotary evaporated to obtain the crude product of 5'MVIP09-ERCd-PFP (2.35 g). The product was dried and used directly in the next reaction without purification.

[0455] 3.2.1.4 Synthesis of 5'MVIP09 Phosphoramidite Monomer-c1

[0456] The crude 5'MVIP09-ERCd-PFP product (2.35 g, 1.58 mmol) was dissolved in DCM (60 mL) and DIPEA (0.82 g, 6.32 mmol) and 6-amino-1-hexanol (0.37 g, 3.16 mmol) were added. The mixture was stirred at room temperature overnight. 10% citric acid (30 mL) was added and the mixture was extracted with DCM (30 mL x 3). The product was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, rotary evaporated, and purified by column chromatography to obtain 5'MVIP09 monomer-c1 (1.73 g).

[0457] 3.2.1.5 5'MVIP09 phosphoramidite monomer

[0458] 5'MVIP09 phosphoramidite monomer-c1 (1.3 g, 1.0 mmol) was weighed and dissolved in acetonitrile (30 mL). Diisopropylamine triazole (0.22 g) was added, and bis-(diisopropylamino)(2-cyanoethoxy)phosphine (0.36 g, 1.2 mmol) was added dropwise under ice bath. The reaction was carried out at room temperature for 4 h. The reaction was controlled by HPLC. After the reaction was qualified, the product 5'MVIP09 monomer (1.2 g) was concentrated and purified by column.

[0459] 3.2.2 Synthesis of 5'MVIP01 phosphoramidite monomer:

[0460] 5'MVIP01 phosphoramidite monomer

[0461] 5'MVIP01 phosphoramidite monomer YICd-01-c2 (1.12 g, 2.0 mmol) was weighed, and the remaining operations were carried out according to 3.2.1.1. to 3.2.1.5.

[0462] Example 4 Synthesis of carrier-coupled RNA inhibitors

[0463] Synthesis description of the antisense strand of the coupled carrier (3'MVIP 09 coupling): Purge the reagent bottle with argon for at least 2 minutes. Add the phosphoramidite monomer or acetonitrile to the reagent bottle in sequence, tighten the bottle cap, and shake until the solid is completely dissolved by visual inspection. Then add 3A molecular sieves and let it stand for at least 8 hours before use. Purge the reagent bottle with argon for at least 2 minutes. Add hydrogenated xanthan gum and dry pyridine to the reagent bottle in sequence, tighten the bottle cap, and shake until the solid is completely dissolved by visual inspection. Store it for use. Confirm that the following operations are performed at room temperature of 20-30℃: Weigh the 3'MVIP Solid Support and add it to the reagent bottle. Then add acetonitrile, shake to mix thoroughly, transfer it to the synthesis column, and use acetonitrile to elute the remaining part of the reagent bottle and transfer it to the synthesis column. After elution, fill the synthesis column with acetonitrile and record the amount of acetonitrile used. Install and fix the synthesis column according to the instrument instructions.

[0464] Connect the prepared monomer solution, CAP A, CAP B, oxidant, thiolation reagent, activator, decapping agent and acetonitrile to the corresponding tubing of AKTA PILOT100, ensuring that the tubing is inserted into the bottom of the reagent bottle.

[0465] Once the synthesis method is set up and the instrument is ready, click Run to begin the synthesis. Observe and record the area of ​​each detritylation peak online. During the synthesis, add additional deprotection reagent based on the actual amount used.

[0466] After the synthesis is completed, argon is purged into the synthesis column for ≥2h, and the synthesis column is unloaded according to the operating procedures. The solid phase carrier in the synthesis column is transferred to the reaction bottle, methylamine aqueous solution and ammonia water are added, and the reaction bottle is placed in a shaker at 35°C for 2-3 hours. The solution is filtered into a round-bottom flask, and the residual solid phase is washed with 50% ethanol aqueous solution, filtered again and combined with the previous filtrate, the round-bottom flask is connected to a rotary evaporator, the water temperature is set to 50°C and evaporated until no distillate is produced, ethanol is added to the round-bottom flask, mixed, and evaporated again until no distillate is produced. Repeat the operation until white powder appears at the bottom of the bottle. The obtained white powder is prepared into a solution, purified using a reverse chromatography column, and samples are taken to detect OD260 and purity. The purified antisense chain solution is divided into vials and freeze-dried for use, and the product is sealed and stored in a -20°C refrigerator.

[0467] The synthesis of the sense strand (5'MVIP09-coupled) is similar to the antisense strand, except that the Solid Support used for the column is the Universal support. Add DIPEA to the resulting intermediate to create a solution. Add the 5'MVIP phosphoramidite monomer and mix thoroughly. Place the reaction flask in a shaker at 35°C for 2-3 hours.

[0468] Description of the synthetic annealing process of RNA inhibitors:

[0469] Take the obtained positive and antisense chains, mix them in a reaction bottle in a 1:1 equimolar ratio, and after 5 minutes in a water bath at 95°C, turn off the power of the water bath and let it cool naturally to below 40°C. Add 3M sodium acetate aqueous solution to the double-stranded solution, mix evenly, then add an appropriate volume of anhydrous ethanol, mix evenly, and place the reaction solution in a -20°C refrigerator for 45 minutes. Set the refrigerated high-speed centrifuge to 4°C for pre-cooling. After the temperature is reached, add the double-stranded solution and start the centrifuge. Take out the double-stranded solution after centrifugation, remove the supernatant, add ultrapure water to completely dissolve the solid, take samples to test OD260 and purity, and obtain the RNA inhibitors in Table 14. The purified finished solution is divided into syringe bottles and freeze-dried for use, and the product is sealed and stored in a -20°C refrigerator.

[0470] The above examples illustrate only the synthesis of RNA inhibitors with 5'MVIP09 / 3'MVIP09 couplings. All RNA inhibitors described herein but not listed here are subject to this same principle: when the 3' end of the sense or antisense strand of an RNA inhibitor is coupled to the support structure 3'MVIP, the 3'MVIP solid support serves as the starting monomer for solid-phase synthesis; when the 5' end of the sense or antisense strand of an RNA inhibitor is coupled to the support structure 5'MVIP, the 5'MVIP phosphoramidite monomer serves as the final monomer for solid-phase synthesis. By referring to the methods described in this example, those skilled in the art can readily synthesize the remaining RNA inhibitors of the present invention.

[0471] Example 5 In vitro inhibition of LPA gene expression by RNA inhibitors 2

[0472] The RNA inhibitors of this embodiment are selected from Table 4, and the 2' position of the sugar groups of different nucleotides in the sense chain and the antisense chain has a methoxy or fluorine modification.

[0473] RNA inhibitors were prepared using the method described in Example 4. The inhibitory effects of the RNA inhibitors on LPA mRNA in Huh7 cells at concentrations of 5 nM and 0.5 nM were investigated using the same assay as in Example 2. The results are shown in Table 21 and Figure 5.

[0474] Table 21 Inhibitory effect of RNA inhibitors on LPA mRNA in Huh7 cells

[0475] The experimental results showed that the RNA inhibitor Kylo-11-DS53 had a significant inhibitory effect on the LPA mRNA level in Huh7 cells at different concentrations. Its characteristics are that the 2' position of the sugar group of the 5th, 7th, 8th and 9th nucleotides starting from the 5' end of the sense chain are all fluorine, and the rest are methoxy, and the phosphate ester bonds between the three consecutive nucleotides at the 5' and 3' ends are thio. The 2' position of the sugar group of the 2nd, 4th, 8th, 14th and 16th nucleotides starting from the 5' end of the antisense chain are all fluorine, and the rest are methoxy, and the phosphate ester bonds between the three consecutive nucleotides at the 5' and 3' ends are thio.

[0476] Example 6 In vitro inhibition of LPA gene expression by RNA inhibitors 3

[0477] The RNA inhibitors of this embodiment are selected from Table 5, and the 2' position of the sugar groups of different nucleotides in the sense chain and the antisense chain has a methoxy or fluorine modification.

[0478] RNA inhibitors were prepared using the method described in Example 4. The inhibitory effects of the RNA inhibitors on LPAmRNA expression in Huh7 cells at concentrations of 5 nM and 0.5 nM were investigated using the same assay as in Example 2. The results are shown in Table 22 and Figure 6.

[0479] Table 22 Inhibitory effect of RNA inhibitors on LPA mRNA in Huh7 cells

[0480] The experimental results showed that the RNA inhibitors Kylo-11-DS65, Kylo-11-DS71, Kylo-11-DS72, and Kylo-11-DS74 significantly inhibited LPA mRNA levels in Huh7 cells at different concentrations. Kylo-11-DS65 is characterized by fluorine at the 2' position of the sugar groups at positions 5, 7, 8, and 9, starting from the 5' end of the sense strand, and methoxy at the remaining positions. The phosphate bonds between the three consecutive nucleotides at the 5' and 3' ends are thiolated. The antisense strand is characterized by fluorine at the 2' position of the sugar groups at positions 2, 4, 8, 14, and 16, starting from the 5' end, and methoxy at the remaining positions. The phosphate bonds between the three consecutive nucleotides at the 5' and 3' ends are thiolated.

[0481] Kylo-11-DS71 and Kylo-11-DS72 are characterized by fluorine at the 2' position of the sugar group of the 3rd, 5th, 7th, 8th, 9th, 10th, 11th, 13th, and 15th nucleotides starting from the 5' end of the sense chain, and methoxy at the rest, and thio at the phosphate ester bonds between the three consecutive nucleotides at the 5' and 3' ends; and fluorine at the 2' position of the sugar group of the 2nd, 4th, 6th, 8th, 14th, and 16th nucleotides starting from the 5' end of the antisense chain, and methoxy at the rest, and thio at the phosphate ester bonds between the three consecutive nucleotides at the 5' and 3' ends. The characteristics of Kylo-11-DS74 are that the 2' positions of the sugar groups of the 9th, 10th, and 11th nucleotides starting from the 5' end of the sense chain are all fluorine, and the rest are methoxy groups, and the phosphate bonds between the three consecutive nucleotides at the 5' and 3' ends are thio groups. The 2' positions of the sugar groups of the 2nd, 4th, 6th, 8th, 14th, 16th, 18th, and 20th nucleotides starting from the 5' end of the antisense chain are all fluorine, and the rest are methoxy groups, and the phosphate bonds between the three consecutive nucleotides at the 5' and 3' ends are thio groups.

[0482] Example 7 In vitro inhibition of LPA gene expression by RNA inhibitors 4

[0483] The RNA inhibitors of this example are selected from the RNA inhibitors in Table 6. The 2' position of the sugar groups of different nucleotides in the sense and antisense strands of the candidate RNA inhibitors Kylo-11-DS81 to Kylo-11-DS105 are modified with methoxy or fluorine.

[0484] RNA inhibitors were prepared using the method described in Example 4. The inhibitory effects of the RNA inhibitors on LPAmRNA expression in Huh7 cells at concentrations of 5 nM and 0.5 nM were investigated using the same experimental method as in Example 2. The experimental results are shown in Table 23 and Figure 7.

[0485] Table 23 Inhibitory effect of RNA inhibitors on LPA mRNA in Huh7 cells

[0486] The experimental results showed that the RNA inhibitors Kylo-11-DS87, Kylo-11-DS88, Kylo-11-DS91, Kylo-11-DS92, Kylo-11-DS97, Kylo-11-DS98, Kylo-11-DS101, Kylo-11-DS102 and Kylo-11-DS104 had significant inhibitory effects on the LPA mRNA level of Huh7 cells at different concentrations. Kylo-11-DS87 is characterized in that the 2' positions of the sugar groups at positions 7, 8, 9, and 10 of the sense chain starting from the 5' end are all fluorine, and the 2' positions of the sugar groups at positions 2, 4, 6, 8, and 14 of the antisense chain starting from the 5' end are all fluorine; Kylo-11-DS88 is characterized in that the 2' positions of the sugar groups at positions 5, 8, 9, and 10 of the sense chain starting from the 5' end are all fluorine, and the 2' positions of the sugar groups at positions 2, 15, and 17 of the antisense chain starting from the 5' end are all fluorine; Kylo-11-DS91 is characterized in that the 2' positions of the sugar groups at positions 5, 8, 9, and 10 of the sense chain starting from the 5' end are all fluorine, and the 2' positions of the sugar groups at positions 2, 15, and 17 of the antisense chain starting from the 5' end are all fluorine. The 2' positions of the sugar groups at positions 8, 9, and 10 of the sense chain starting from the 5' end are all fluorine, and the 2' positions of the sugar groups at positions 2, 4, 12, and 14 of the antisense chain starting from the 5' end are all fluorine; Kylo-11-DS92 is characterized in that the 2' positions of the sugar groups at positions 7, 8, 9, and 10 of the sense chain starting from the 5' end are all fluorine, and the 2' positions of the sugar groups at positions 2, 5, 14, and 16 of the antisense chain starting from the 5' end are all fluorine; Kylo-11-DS97 is characterized in that the 2' positions of the sugar groups at positions 5, 7, 8, and 9 of the sense chain starting from the 5' end are all fluorine. The 2' position of the sugar group of the acid is fluorine, and the 2' position of the sugar group of the 7th, 12th, and 14th nucleotides starting from the 5' end of the antisense chain is fluorine; Kylo-11-DS98 is characterized in that the 2' position of the sugar group of the 7th, 9th, 10th, and 11th nucleotides starting from the 5' end of the sense chain is fluorine, and the 2' position of the sugar group of the 2nd and 14th nucleotides starting from the 5' end of the antisense chain is fluorine; Kylo-11-DS101 is characterized in that the 2' position of the sugar group of the 7th, 9th, 10th, and 11th nucleotides starting from the 5' end of the sense chain is fluorine, and the 2' position of the sugar group of the 2nd and 14th nucleotides starting from the 5' end of the antisense chain is fluorine. The 2'-positions of the nucleotide sugars at positions 5, 7, 8, and 9 are all fluorine; Kylo-11-DS102 is characterized by fluorine at the 2'-positions of the nucleotide sugars at positions 5, 7, 8, and 9 starting from the 5'-end of the sense strand, and fluorine at the 2'-positions of the nucleotide sugars at positions 2, 6, 8, 10, 14, and 16 starting from the 5'-end of the antisense strand; Kylo-11-DS104 is characterized by fluorine at the 2'-positions of the nucleotide sugars at positions 9, 10, and 11 starting from the 5'-end of the sense strand, and fluorine at the 2'-positions of the nucleotide sugars at positions 14 and 16 starting from the 5'-end of the antisense strand. These RNA inhibitors share the following characteristics: except for the fluorine at the 2'-positions of the nucleotide sugars at the aforementioned positions, the 2'-positions of the remaining nucleotide sugars are methoxy, and the phosphate bonds between the three consecutive nucleotides at the 5' and 3' ends are thiolated. Among them, Kylo-11-DS102 had the best inhibitory effect on the LPA mRNA level in Huh7 cells, with an inhibition rate of 72.99% at a concentration of 0.5 nM.

[0487] Example 8 In vitro inhibition of LPA gene expression by RNA inhibitors 5

[0488] The RNA inhibitors of this embodiment are selected from Table 7, and the 2' position of the sugar groups of different nucleotides in the sense chain and the antisense chain has a methoxy or fluorine modification.

[0489] RNA inhibitors were prepared using the method described in Example 4. The inhibitory effects of the RNA inhibitors on LPA mRNA expression in Huh7 cells at concentrations of 5 nM and 0.5 nM were investigated using the same assay as in Example 2. The results are shown in Table 24 and Figure 8.

[0490] Table 24 Inhibitory effect of RNA inhibitors on LPA mRNA in Huh7 cells

[0491] The experimental results showed that the RNA inhibitors Kylo-11-DS106~Kylo-11-DS110, Kylo-11-DS112~Kylo-11-DS117 and Kylo-11-DS119 had significant inhibitory effects on LPA mRNA in Huh7 cells at different concentrations. Among them, Kylo-11-DS106~Kylo-11-DS110, Kylo-11-DS112~Kylo-11-DS114 and Kylo-11-DS116 have at least 15 consecutive nucleotides in common with each other, and the 2' position of the sugar group of the 3rd, 5th, 7th, 8th, 9th, 10th, 11th, 13th and 15th nucleotides starting from the 5' end of the sense chain are all fluorine, and the remaining 2' positions are methoxy, the phosphate ester bonds between the three consecutive nucleotides at the 5' and 3' ends have thio groups, and the 2' positions of the 2nd, 4th, 6th, 8th and 9th nucleotides starting from the 5' end of the antisense chain are all methoxy groups. The 2' position of the sugar group of the nucleotides at positions 14 and 16 is fluorine, and the rest are methoxy groups. The phosphate bonds between the three consecutive nucleotides at the 5' and 3' ends are thio groups. Both the sense and antisense strands contain 21 nucleotides (except Kylo-11-DS109), and there are two nucleotide overhangs at the 3' end of each sense and antisense strand. Kylo-11-DS106 and Kylo-11-DS115 differ by only one nucleotide: the sixth nucleotide from the 5' end of the antisense strand is fU in the former and dT in the latter. The two have similar activities and both have high inhibitory activity. The unmodified sequences of the sense and antisense strands of Kylo-11-DS116 and Kylo-11-DS117 are identical, SEQ ID NO. 8 and SEQ ID NO. 21, respectively. However, their modification features differ: the 5th, 7th, 8th, and 9th nucleotide sugars of the sense strand, starting from the 5' end, are all fluorine-containing, while the 2nd, 6th, 8th, 10th, 14th, and 16th nucleotides of the antisense strand, starting from the 5' end, are all fluorine-containing. The unmodified sequences of the sense and antisense strands of the RNA inhibitor Kylo-11-DS119 are SEQ ID NO. 11 and SEQ ID NO. 25, respectively. Their modification features are: the 9th, 10th, and 11th nucleotide sugars of the sense strand, starting from the 5' end, are all fluorine-containing, while the 2nd, 4th, 6th, 12th, 14th, 16th, 18th, and 20th nucleotides of the antisense strand, starting from the 5' end, are all fluorine-containing. Both the sense and antisense strands contain 21 nucleotides and are blunt-ended.

[0492] Example 9 In vitro inhibition of LPA gene expression by RNA inhibitors 6

[0493] The RNA inhibitors of this example were selected from Table 8. The 2'-position of the sugar groups of different nucleotides in the sense and antisense strands were modified with a methoxy or fluorine group. The RNA inhibitors were prepared using the method described in Example 4. Using the same experimental method as in Example 2, the inhibitors were tested for their inhibitory effects on LPA mRNA in Huh7 cells at concentrations of 5 nM and 0.5 nM. The results are shown in Table 25 and Figure 9.

[0494] Table 25 Inhibitory effect of RNA inhibitors on LPA mRNA in Huh7 cells

[0495] Experimental results showed that the RNA inhibitors Kylo-11-DS-124, Kylo-11-DS-126, Kylo-11-DS-130, and Kylo-11-DS-131 significantly inhibited LPA mRNA expression in Huh7 cells at various concentrations. These RNA inhibitors share a common characteristic: the 2'-position of the sugar groups at positions 9, 10, and 11, starting from the 5' end of the sense strand, are all fluorine-containing, with the remaining methoxy groups. The phosphate bonds between three consecutive nucleotides at the 5' and 3' ends contain thio groups. Furthermore, the 2'-position of the sugar groups at positions 2, 4, 6, 12, 14, 16, 18, and 20, starting from the 5' end of the antisense strand, are all fluorine-containing. Kylo-11-DS-126 and Kylo-11-DS-131 both have 21 nucleotides in their sense and antisense strands, with two nucleotide overhangs at their 3' ends. The difference is that the sixth nucleotide from the 5' end of the antisense strand of the former is fA, while the sixth nucleotide from the 5' end of the antisense strand of the latter is dT. Both exhibit similar activity. Kylo-11-DS-124 and Kylo-11-DS-130 have 19 nucleotides in their sense strands and 21 nucleotides in their antisense strands. The antisense strands have two nucleotide overhangs at their 3' ends, and both are blunt-ended. Both exhibit similar activity.

[0496] Example 10 Evaluation of the in vivo activity of RNA inhibitors using cynomolgus monkeys

[0497] The RNA inhibitors Kylo-11-DS148, Kylo-11-DS146, and Kylo-11-DS163 were evaluated in age-appropriate cynomolgus monkeys. Each was administered via subcutaneous injection at 6 mg / kg on Day 0. Blood samples were collected weekly after dosing to measure LDL-c and Lp(a) levels. Results of LDL-c and Lp(a) levels following RNA inhibitor treatment are shown in Tables 26-27 and Figures 10-11.

[0498] Table 26 Effects of RNA inhibitors on lowering LDL-c levels in cynomolgus monkey plasma

[0499] Table 27 Effects of RNA inhibitors on reducing Lp(a) levels in cynomolgus monkey plasma

[0500] The experimental results showed that the RNA inhibitors Kylo-11-DS146, Kylo-11-DS 148 and Kylo-11-DS163 can reduce the LDL-c level in the plasma of crab-eating macaques and can significantly and continuously reduce the Lp(a) level in the plasma. After the intervention of Kylo-11-DS146, the individual plasma Lp(a) level can be reduced by up to 95.25% compared with before administration. By day 77, the average reduction rate can still be maintained at 89.98%.

[0501] Example 11 Comparison of in vitro inhibitory effects of different duplexes

[0502] CN202210241706.1 (hereinafter referred to as D1) is a Chinese invention patent application filed by the applicant, Xiamen Ganbaoli Biopharmaceutical Co., Ltd., on March 11, 2022. Its invention is entitled LPA inhibitors and their uses, and its publication number is CN114703184A. The applicant conducted the following experimental operations on different duplexes:

[0503] Huh7 cells were washed with PBS, digested with 0.05% trypsin, and gently pipetted in DMEM supplemented with 10% FBS until single cells were counted. Plasmid DNA was then transfected into Huh7 cells using Fugene HD. Transfected cells were seeded at a density of 10,000 cells per well in a 96-well plate with 100 μL of culture medium per well. Cells were cultured overnight in a 5% CO2, 37°C incubator.

[0504] Prepare RNAiMAX transfection reagent by dispensing the appropriate volume in a 15mL centrifuge tube at a ratio of 1.5:48.5 RNAiMAX:Opti-MEM. Vortex for 15 seconds to mix thoroughly, and incubate at room temperature for 15 minutes. Add 60μL of RNAiMAX / Opti-MEM to each well of the corresponding position, and add 60μL of the diluted compound of the corresponding concentration to the well, mix thoroughly, and incubate for 15 minutes. Aspirate the medium from each well and add fresh medium containing the compound, so that each well now contains 120μL of medium. Incubate in a 5% CO2, 37°C incubator. Final test compound concentrations are 5nM, 0.5nM, and 0.05nM.

[0505] Experimental steps reference The instructions for the dual-luciferase assay system are as follows: remove the cells from the incubator, discard the supernatant, add 75 μL of fresh culture medium and 75 μL of detection reagent, shake in the dark for 10 minutes, and after the cells are fully lysed, transfer 100 μL of the sample to an opaque white plate to detect the luminescent signal of fireflies; add 50 μL of Detection reagent, shake in the dark for 10 minutes, and then detect the Renilla luciferase signal. Calculate the ratio of the main reporter gene to the internal reference reporter gene signal in each well, and calculate the inhibition rate (%) based on this ratio.

[0506] The test results are as follows:

[0507] As shown by the above test results, the two target sequences for the original sequences claimed in the present application, comprising a region of LPA mRNA NM_005577.4 (SEQ ID NO. 1), are different from those in D1 and are expanded by 2 positions forward or 1 position backward compared to the region in D1. In the present application, the inhibition rates of Kylo-11-DS13 and Kylo-11-DS11 at concentrations of 5 nM, 0.5 nM, and 0.05 nM, respectively, are higher than those of Ky-11-DS12 and Ky-11-DS08 in D1.

Claims

1. An RNA inhibitor for inhibiting LPA gene expression or a pharmaceutically acceptable salt thereof, wherein: The RNA inhibitor is formed by base pairing of a sense strand and an antisense strand with a chain length of 15-30, preferably 19-23, and at least 85% of the bases between the sense strand and the antisense strand are complementary; The -OH at the 2' position of some or all nucleotide sugar groups of the sense chain and / or antisense chain may be substituted, wherein the substituent group is fluorine or methoxy; Furthermore, the phosphate bonds between three adjacent nucleotides at at least one end of the sense strand and / or antisense strand may be thiolated.

2. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 1, wherein The antisense strand forms a complementary region with the target sequence, and the target sequence is a plurality of regions at different positions of LPA mRNA, wherein the plurality of regions have at least 15 identical consecutive nucleotides, and the target sequence is selected from any one of nucleotide regions between 312-332, 654-674, 996-1016, 1338-1358, 1680-1700, 2022-2042 and 2364-2384 in LPA mRNA (NM_005577.4).

3. The RNA inhibitor according to claim 1 or a pharmaceutically acceptable salt thereof, wherein: The antisense strand forms a complementary region with the target sequence, wherein the target sequence is a plurality of regions at different positions of LPA mRNA, wherein the plurality of regions have at least 15 identical consecutive nucleotides, and the target sequence is selected from any one of the nucleotide regions between 493-512, 1861-1880, and 2203-2222 in LPA mRNA (NM_005577.4).

4. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 3, wherein The antisense strand is selected from the following sequences: 5'ucguauaacaauaaggagcug 3' SEQ ID NO.25 5'auaacucuguccauuaccaug 3' SEQ ID NO.21 or a sequence having at least 15 consecutive nucleotides identical to the antisense strand, or a sequence differing from the antisense strand by one, two or three nucleotides, Wherein, g = guanylate, a = adenylate, u = uridylate, and c = cytidylate.

5. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 3, wherein The sense strand is selected from the following sequences: 5'cagcuccuuauuguuauacga 3' SEQ ID NO.11 5'ugguaauggacagaguuauca 3' SEQ ID NO.8 or a sequence having at least 15 consecutive nucleotides identical to the sense strand, or a sequence differing from the sense strand by one, two, or three nucleotides, Wherein, g = guanylate, a = adenylate, u = uridylate, and c = cytidylate.

6. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 5, wherein The sense strand is SEQ ID NO.11 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence that differs therefrom by one, two, or three nucleotides; and the antisense strand is SEQ ID NO.25 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence that differs therefrom by one, two, or three nucleotides: sense strand: 5'cagcuccuuauuguuauacga 3' SEQ ID NO.11 antisense strand: 5'ucguauaacaauaaggagcug 3' SEQ ID NO.25; Alternatively, the sense strand is SEQ ID NO. 8, or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two, or three nucleotides; and the antisense strand is SEQ ID NO. 21, or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing therefrom by one, two, or three nucleotides: Sense strand: 5'ugguaauggacagaguuauca 3' SEQ ID NO.8 Antisense strand: 5'auaacucuguccauuaccaug 3' SEQ ID NO.21; Wherein, g = guanylate, a = adenylate, u = uridylate, and c = cytidylate.

7. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 6, wherein The sense strand is SEQ ID NO. 270 or a sequence that differs therefrom by one, two or three nucleotides, and the antisense strand is SEQ ID NO. 278 or a sequence that differs therefrom by one, two or three nucleotides: Sense strand: 5'CsAsGCUCCUfUfAfUUGUUAUACsGsA 3' SEQ ID NO. 270 Antisense strand: 5'UsfCsGfUAfUAACAAfUAfAGfGAfGCsfUsG 3' SEQ ID NO. 278; Alternatively, the sense strand is SEQ ID NO. 239 or a sequence differing therefrom by one, two or three nucleotides, and the antisense strand is SEQ ID NO. 344 or a sequence differing therefrom by one, two or three nucleotides: Sense strand: 5'UsGsGUfAAfUfGfGACAGAGUUAUsCsA 3' SEQ ID NO.239 Antisense strand: 5'AsfUsAfACdTCfUGUCCAfUUfACCAsUsG 3' SEQ ID NO.344; Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenylate, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidine; fGs = 2'-fluoro-3'-thioguanylate, fAs = 2'-fluoro-3'-thioadenylate, fUs = 2'-fluoro-3'-thiouridylate, fCs = 2'-fluoro-3'-thiocytidine, dT = 2'-deoxythymidylate.

8. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 7, wherein The RNA inhibitor further comprises carrier structures 5'MVIP and 3'MVIP, and the structure of the RNA inhibitor is shown in Formula Ia, Ib or Ic: in, The 5'MVIP is composed of a transfer point R1, a connecting chain D, a linker B, a side chain L, and a liver-targeting specific ligand X. It is connected to the 5' end of the sense chain or the 5' end of the antisense chain through the transfer point R1. Its structure is shown in Formula I: (X-L) n -B-D-R1- I The 3'MVIP is composed of a transfer point R2, a connecting chain D, a linker B, a side chain L, and a liver-targeting specific ligand X. It is connected to the 3' end of the sense chain or the 3' end of the antisense chain through the transfer point R2. Its structure is shown in Formula II: (X-L) m -B-D-R2- II in, n and m are each independently any integer from 0 to 4, preferably an integer from 1 to 3, and n+m=an integer from 2 to 6, preferably n+m=2, 3 or 4, more preferably 4; The transition point R1 is a heterocyclic or carbocyclic structure containing N, S or O as shown below: Alternatively, the R1 is -NH(CH2) x CH2O-, wherein x is any integer from 3 to 12, preferably any integer from 4 to 6; The transition point R2 is a heterocyclic or carbocyclic structure containing N, S or O as shown below: Alternatively, the transition point R2 is -NH(CH2) x1 CH(OH)(CH2) x2 CH2O-, wherein x1 is any integer from 1 to 4, and x2 is any integer from 0 to 4; The liver-targeting specific ligand X is the same or different within each of 5'MVIP and 3'MVIP or between 5'MVIP and 3'MVIP, and is selected from monosaccharides and their derivatives, preferably N-acetylgalactosamine and its derivatives, and more preferably selected from the following structures: Wherein, W is selected from -OH, -NHCOOH and -NHCO(CH2) q One or two of CH3, wherein q is an integer from 0 to 4; The branched chain L is the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP, and is selected from one or more of the following structures: wherein r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, and Z is H, an alkyl group or an amide group, wherein the alkyl group is, for example, a C1-C5 alkyl group; The linker B is the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP, and is selected from the following structures: wherein A1 and A2 are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl or thiophosphoryl, and r is any integer from 0 to 4; The connecting chain D is the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP, and is selected from the following structures: wherein each p is independently any integer from 1 to 20; s is any integer from 2 to 13; and Z1 and Z2 are the same or different substituent groups.

9. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 8, wherein The 5'MVIP is 5'MVIP01 or 5'MVIP09 as shown below, and the 3'MVIP is 3'MVIP01, 3'MVIP09 or 3'MVIP17 as shown below:

10. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 9, wherein The combination of the sense strand 5'MVIP and the antisense strand 3'MVIP is 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17 or 5'MVIP09 / 3'MVIP09, or the combination of the sense strand 5'MVIP and the antisense strand 3'MVIP is 5'MVIP01 / 3'MVIP09 or 5'MVIP09 / 3'MVIP01.

11. The RNA inhibitor or a pharmaceutically acceptable salt thereof according to claim 10, wherein The RNA inhibitor is selected from Kylo-11-DS146, Kylo-11-DS148 and Kylo-11-DS163.

12. Use of the RNA inhibitor according to any one of claims 1 to 11 or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating and / or preventing a disease associated with elevated LP(a) levels, wherein: The diseases include but are not limited to inflammatory diseases, cardiovascular and cerebrovascular diseases and metabolic diseases, wherein the cardiovascular and cerebrovascular diseases include hyperlipidemia, hyperlipidemia, stroke, atherosclerosis, thrombosis, coronary heart disease and aortic valve stenosis.

13. A pharmaceutical composition comprising the RNA inhibitor according to any one of claims 1 to 11 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, wherein the composition is in the form of an oral agent, an intravenous injection, or a subcutaneous or intramuscular injection, preferably a subcutaneous injection.

Images