Application of circadian rhythm of CD47 protein on ctEVs as target spot in preparation of antitumor drugs

Abstract

The invention discloses an application of CD47 on ctEVs as a therapeutic target of a time therapy in preparation of antitumor drugs, discovers that the expression of CD47 protein on ctEVs shows significant circadian rhythm, and verifies that the therapeutic effect of a CD47 antibody can be significantly enhanced by adjusting the administration time according to the circadian rhythm. The discovery not only provides a new target for time therapy, but also is hopeful to improve the clinical complete remission rate of the existing CD47 antibody treatment through accurate time window selection.

Description

Technical Field

[0001] The present invention relates to an application of a circadian rhythm of CD47 protein on ctEVs as a target in the preparation of an anti-tumor drug. Background Art

[0002] CD47 is a well-recognized innate immune checkpoint protein. Overexpressed on cancer cells, CD47 binds to signal regulatory protein α (SIRPα) on macrophages, triggering a "don't eat me" signal, preventing tumor cells from being detected by the immune system and allowing them to evade phagocytosis. Based on this mechanism, inhibitors targeting the CD47-SIRPα axis have become a global research and development hotspot, with several novel anti-CD47 antibodies currently in preclinical and clinical development. Among them, letaplimab, a traditional humanized anti-CD47 monoclonal antibody, has initiated a Phase I clinical trial. Lemzoparlimab, another anti-CD47 antibody developed using human natural phage screening technology, is currently in a Phase II trial for patients with newly diagnosed high-risk myelodysplastic syndromes. Preliminary clinical data suggest that these antibody therapies demonstrate promising therapeutic potential: in 45 patients with newly diagnosed high-risk myelodysplastic syndromes treated with letaplimab combined with azacitidine, a complete remission rate of 31.1% was achieved. However, current efficacy remains to be improved, suggesting the need for further treatment optimization. Summary of the Invention

[0003] The main purpose of the present invention is to provide an application of CD47 on ctEVs as a chronotherapy target in the preparation of anti-tumor drugs.

[0004] Another object of the present invention is to provide a sustained-release anti-tumor drug, wherein the sustained-release time of the sustained-release anti-tumor drug is customized according to the characteristics of the CD47 secretion time on ctEVs.

[0005] Furthermore, the secretion time of CD47 on ctEVs is characterized by more secretion at night and less secretion during the day.

[0006] Another object of the present invention is to provide an application of the CD47 gene or protein on ctEVs in screening anti-tumor drugs for prevention and / or treatment.

[0007] Furthermore, the prevention and / or treatment is chronotherapy prevention or treatment.

[0008] Chronotherapy optimizes the timing of drug administration by matching biological rhythms, and has demonstrated significant advantages in chimeric antigen receptor (CAR) T cell therapy and immune checkpoint blockade therapy (PD-L1 antibodies). Studies have shown that the migration ability of dendritic cells and the number and phenotype of tumor-infiltrating leukocytes fluctuate during the day and night, and targeting this can significantly enhance the efficacy of immunotherapy. However, existing studies have not yet involved CD47 targeted therapy. In addition, existing chronotherapy mostly relies on the rhythmic characteristics of the immune system, but ignores the dynamic changes of tumor-secreted factors (such as ctEVs). The present invention innovatively discovered that the expression of CD47 protein on ctEVs exhibits significant circadian rhythmicity, and confirmed that adjusting the administration time according to this rhythm can significantly enhance the therapeutic effect of CD47 antibodies. This discovery not only provides a new target for chronotherapy, but also has the potential to improve the clinical complete remission rate of existing CD47 antibody treatments through precise time window selection. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] The present invention will be further described below with reference to the accompanying drawings and examples.

[0010] Figure 1 Schematic diagram of CD47 antibody day and night treatment.

[0011] Figure 2 (A) Volcano plot showing proteins with significant changes between ctEVs secreted at night and those produced during the day. (B) Gene ontology (GO) biological process enrichment analysis of proteins detected in ctEVs secreted at night, with pathways promoting tumor progression highlighted in red.

[0012] Figure 3 (A) Schematic diagram of ctEV-CLOCK-mediated capture and anti-CD47 antibody detection. (B) Box plot showing the fluorescence intensity of CD47+ ctEVs in plasma samples from BL / 6-B16F10 mice under a L:D ratio of 12:12 (n = 10 per group).

[0013] Figure 4 (A) Tumor growth curves of BL / 6-B16F10 mice treated with aCD47 during the day (ZT1), aCD47 at night (ZT13), and corresponding control groups (n=5 per group) and representative (B) H&E, TUNEL, and (C) CD8+ and Ki67 immunofluorescence images of tumor tissues. (D) Tumor growth curves of C57-Bmal1 mice treated with CD47 antibody during the day (ZT1), CD47 antibody at night (ZT13), and corresponding control groups (n=5 per group). - / - -Tumor growth curves of B16F10 mice. DETAILED DESCRIPTION

[0014] Example 1

[0015] 1. Exploring the circadian rhythm of ctEVs in tumor-bearing mice

[0016] 1) ctEVs-CLOCK analysis of newly generated ctEVs in plasma

[0017] Sample preparation: 15 μL of mouse plasma was incubated with a DBCO-BiPar-biotin probe (2 μM, 1 μL) in 20 μL of binding buffer (containing 0.5% BSA) at 37°C for 1 hour with rotation. SSB (1 μL) was then added and incubated at 37°C for 1 hour with rotation. This step enabled biotin labeling of nascent ctEVs in plasma using a specific click strategy.

[0018] The probe is named BiPar, and its sequence is: TGGGGGATGTGGAGGGGGGTATGGGTGGGATT

[0019] TTTTCACTACAGAGGTTGCGTCTGTCCCACGT TGTCATGGGGGGTTGGCCTG

[0020] The 5' end is modified with DBCO (dibenzocyclooctyne), and the 3' end is modified with Biotin. BiPar is the heterologous bivalent aptamer described in the present invention. The two segments are connected in series, and each segment recognizes a different site on EpCAM.

[0021] Chip capture and detection: After blocking the chip with 50 μL of 20% exosome-depleted FBS (fetal bovine serum) at room temperature for 1 hour, the prepared sample was pumped into a SA (streptavidin)-modified microfluidic chip at a flow rate of 1.25 mL / h and incubated at room temperature for 1 hour. This step captured biotinylated nascent ctEVs. After washing with PBS, CD63 antibody (25 μg / mL, 20 μL) and β-galactosidase-conjugated secondary antibody (1:20 dilution, 20 μL) were pumped into the chip sequentially at a flow rate of 1.25 mL / h. The incubation time for both primary and secondary antibodies was 1 hour. After each incubation, the chip was washed with PBS. Finally, FDG solution (100 μM fluorescein di-β-D-galactoside, DMSO, 20 μL) was passed through the chip and reacted in the dark for 30 minutes at room temperature. Fluorescence microscopy was used to acquire chip images, and the concentration of target extracellular vesicles in the sample was analyzed based on the fluorescence signal. ImageJ software was used to calculate the fluorescence intensity.

[0022] For the detection of nascent CD47+ctEVs, anti-CD47 (25 μg / mL, 20 μL) was used as the primary antibody.

[0023] 2) Enrichment of newly generated ctEVs in plasma

[0024] Take 1mL of plasma and incubate with 100nM DBCO-BiPar-biotin in 1.33mL binding buffer containing 0.5% BSA at 37°C for 1 hour. After incubation, add SSB (67μL) to the reaction system and incubate at 37°C for 1 hour. Then add 35μL of streptavidin magnetic beads (SA beads) and incubate at 37°C for 1 hour. Centrifuge at 3000rpm for 3min and collect the precipitate, which is the SA beads enriched for newly formed ctEVs. Then use DNase I (20U / mL, 50μL) and incubate with the precipitate obtained in the previous step at 37°C for 30min to degrade the aptamer and secrete newly formed ctEVs. Centrifuge at 3000rpm for 3min, collect the supernatant, and obtain newly formed ctEVs in plasma.

[0025] 3) Mass spectrometry analysis of differentially expressed proteins in newly generated ctEVs during the day and night

[0026] Nascent ctEVs enriched with SA beads were incubated with freshly prepared lysis buffer (8 M urea in 100 mM Tris / HCl, pH 8, 150 μL) on ice for 20 minutes. Protein concentration in the lysate was then determined using the BCA assay. 100 μg of the resulting peptides were analyzed by nanoscale liquid chromatography coupled to tandem mass spectrometry (LC-MS / MS). Functional enrichment analysis was performed using the online tool DAVID. Protein differential volcano plots were generated using GraphPad Prism 8 software.

[0027] 2. Developing time-based therapies targeting the circadian rhythm of ctEVs

[0028] 2) Chronotherapy regimen of anti-CD47 antibody in B16F10 tumor-bearing mice.

[0029] Female C57BL / 6J mice aged 6–8 weeks were purchased from the Experimental Animal Center of Xiamen University. Female Bmal1 knockout C57BL / 6J mice (C57-Bmal1- / -) aged 6–8 weeks were purchased from the Shanghai Southern Model Organisms Center.

[0030] For the chronotherapy of C57-B16F10 and C57-Bmal1- / --B16F10 models, 2×10 6B16F10 cells were suspended in 100 μL of PBS and injected subcutaneously into mice. Anti-CD47 antibody treatment began on day 5 after tumor inoculation and was administered every three days at a dose of 2.5 mg / kg. A control group was injected with PBS. The light-treated group received treatment at ZT1, while the night-treated group received treatment at ZT13. The entire treatment cycle lasted 11 days, and plasma and tumor tissue were collected on day 20. All treatments were administered via intraperitoneal injection in a final volume of 100 μL.

[0031] 3) Tissue section staining

[0032] H&E staining: Paraffin sections of tumor tissue were incubated in hematoxylin for 5 minutes to stain cell nuclei. After dehydration with ethanol, sections were incubated in eosin for 5 minutes. Neutral gum was applied to the sections, coverslips were placed, and sections were observed under a microscope. Data were analyzed using SlideViewer software.

[0033] Immunofluorescence staining: Paraffin sections of tumor tissue were pre-activated with citrate buffer (pH 6.0). Primary antibodies were then added and incubated overnight at 4°C. After washing, fluorescently labeled secondary antibodies were added and incubated for 1 hour. Cell nuclei were then stained with DAPI. Sections were observed under a fluorescence microscope. Data were analyzed using SlideViewer software.

[0034] Result analysis:

[0035] Figure 2-4 The results showed that in the C57BL / 6-B16F10 mouse model, developing time therapy targeting the circadian rhythm of CD47+ctEVs had significant therapeutic effects, and antibody treatment during the peak of CD47+ctEVs secretion had better therapeutic effects.

[0036] In summary, the present invention discovered significant diurnal differences in CD47 protein expression on ctEVs (higher expression at night), and used this as a target for the development of chronotherapy. This finding demonstrated that nighttime CD47 antibody treatment significantly improved the therapeutic efficacy in B16F10 tumor-bearing mice. This discovery not only provides a new target for chronotherapy but also holds promise for improving the complete remission rate of existing CD47 antibody treatments by precisely selecting the right time window.

[0037] The above description is merely a preferred embodiment of the present invention and therefore cannot be used to limit the scope of the present invention. In other words, equivalent changes and modifications made according to the scope of the present invention and the contents of the specification should still fall within the scope of the present invention.

Claims

1. Application of CD47 on ctEVs as a chronotherapy target in the preparation of anti-tumor drugs.

2. A sustained-release anti-tumor drug, characterized in that: The sustained-release time of the sustained-release anti-tumor drug is customized according to the characteristics of CD47 secretion time on ctEVs.

3. A sustained-release anti-tumor drug according to claim 2, characterized in that: The secretion time of CD47 on ctEVs is characterized by more secretion at night and less secretion during the day.

4. Application of the CD47 gene or protein on ctEVs in screening anti-tumor drugs for prevention and / or treatment.

5. The use according to claim 4, characterized in that The prevention and / or treatment is chronotherapeutic prevention or treatment.

Images