Anti-bacteriophage escherichia coli based on laboratory adaptive evolution and anti-bacteriophage defense mechanism system

By knocking out the Escherichia coli phage receptor gene and integrating the defense genes of Bacillus cereus and Bacillus thuringiensis, an anti-phage defense system was constructed, which solved the problems of traditional response strategies such as long time consumption, high cost and poor effect, and achieved multi-antibody and broad-spectrum resistance to phages.

CN120665784APending Publication Date: 2025-09-19JIANGNAN UNIV
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202510597723.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-09
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

Traditional microbial anti-phage infection strategies are time-consuming, costly, and ineffective, and cannot fundamentally solve the problem of phage contamination.

Method used

By knocking out the Escherichia coli phage T1 and T7 receptor gene fhuA, and the phage vB_EcoM_P251 and vB_EcoM_P255 receptor gene ompA, and integrating the Bacillus cereus shedu gene and Bacillus thuringiensis septu gene into Escherichia coli, an anti-phage defense system was constructed to enhance Escherichia coli's resistance to phages.

Benefits of technology

It significantly enhances the resistance of Escherichia coli to bacteriophages, realizes the construction of multi-resistant and broad-spectrum chassis cells, and effectively resists the infection of multiple bacteriophages.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120665784A_ABST
    Figure CN120665784A_ABST
Patent Text Reader

Abstract

The invention discloses an anti-bacteriophage escherichia coli chassis cell based on combination of bacteriophage adaptive evolution and a bacterial anti-bacteriophage defense system. Receptor genes of bacteriophages are excavated through co-evolution of bacteriophages T1, T4, T7, vBEcoMP251 and vBEcoMP255 and escherichia coli strains, the resistance of escherichia coli to the bacteriophages is enhanced by knocking out screened bacteriophage receptors on the genome level, and meanwhile, defense systems shedu and septu with the ability to resist the bacteriophages are obtained through screening. The resistance of escherichia coli to the bacteriophage is further enhanced by integrating the gene to the ylbe and yeeP gene loci, construction of multi-resistant broad-spectrum chassis cells of the bacteriophage is completed, and certain application prospects are achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to a phage-resistant Escherichia coli chassis cell based on the combination of phage adaptive evolution and bacterial anti-phage defense system, belonging to the technical field of microorganisms. Background Art

[0002] The fermentation industry is an integral part of the industrialization of biotechnology. For example, the common industrial microorganism Escherichia coli has been widely used across various sectors of the biotechnology industry. The annual output value of biomanufacturing using E. coli as a base cell exceeds 100 billion yuan. However, during the production process, there is the risk of infection by bacteriophages. Bacteriophages are viruses that infect microorganisms such as bacteria, fungi, actinomycetes, and spirochetes. They share common viral characteristics: small size, ability to pass through filters, non-cellular organisms, lacking their own metabolic enzyme systems, and unable to grow and reproduce independently. They can only replicate within living host cells, utilizing host-synthesized substances. Furthermore, bacteriophages exhibit host specificity. Bacteriophages typically consist of a protein coat and nucleic acid. Under a microscope, bacteriophages have three basic morphologies: tadpole-shaped, microspherical, and filamentous. The tailed phage is the most common known type, consisting of an icosahedral head that encapsulates genetic material and a tail that assists in movement and invasion of host cells. The genetic material protected by the phage head is mainly divided into four types, namely dsDNA, ssDNA, dsRNA, and ssRNA. Many phages, such as T4, protect their genomes from bacterial restriction modification (RM) and CRISPR-Cas system nucleases by covalently modifying their genomes.

[0003] When microorganisms are infected with bacteriophages, measures such as formaldehyde fumigation, pipeline sterilization, and strain rotation are typically used to ensure continuous production. However, these traditional strategies present several challenges, including being time-consuming, demanding, costly, and ineffective. These strategies cannot fundamentally address the problem of phage contamination, necessitating a more effective and sustainable approach to combating it. This includes developing new anti-phage tools and technologies, establishing stricter production practices and regulatory standards, and strengthening basic research on microbial viruses to explore new prevention and control strategies. Therefore, the goal is to breed highly resistant and broadly phage-resistant Escherichia coli chassis cells. Summary of the Invention

[0004] In response to the above-mentioned deficiencies in the prior art, the present invention provides a phage-resistant Escherichia coli chassis cell based on the combination of phage adaptive evolution and bacterial anti-phage defense system, aiming to solve the traditional microbial anti-phage infection response strategy, which is time-consuming, strict, costly, and ineffective, and cannot fundamentally solve the technical problem of phage contamination.

[0005] The first technical solution provided by the present invention is a genetically engineered bacterium, which uses Escherichia coli as a starting strain, knocks out the phage T1 and T7 receptor genes fhuA and the phage vB_EcoM_P251 and vB_EcoM_P255 receptor genes ompA of the starting strain, and integrates and expresses the shedu gene from Bacillus cereus strain B4264 and the septu gene from Bacillus thuringiensis HD12 in the starting strain.

[0006] In an embodiment of the present invention, the nucleotide sequences of the fhuA gene, ompA gene, shedu gene, and septu gene are shown in SEQ ID NOs. 1 to 4, respectively.

[0007] In an embodiment of the present invention, the shedu gene and the septu gene are respectively driven to express by constitutive promoters.

[0008] In an embodiment of the present invention, the shedu gene and the septu gene are expressed by promoter j23101 and promoter j23105, respectively.

[0009] In an embodiment of the present invention, the integration sites of the shedu gene and the septu gene are ylbE and yeeP.

[0010] In an embodiment of the present invention, the starting strain is Escherichia coli MG1655 (DE3).

[0011] The second technical solution provided by the present invention is a method for improving the anti-phage ability of Escherichia coli, wherein the method is to knock out the phage T1 and T7 receptor genes fhuA and the phage vB_EcoM_P251 and vB_EcoM_P255 receptor genes ompA of Escherichia coli, and integrate the shedu gene from Bacillus cereus strain B4264 and the septu gene from Bacillus thuringiensis HD12 into the Escherichia coli.

[0012] In an embodiment of the present invention, the nucleotide sequences of the fhuA gene, ompA gene, shedu gene, and septu gene are shown in SEQ ID NOs. 1 to 4, respectively.

[0013] In an embodiment of the present invention, the shedu gene and the septu gene are respectively driven to express by constitutive promoters.

[0014] In an embodiment of the present invention, the shedu gene and the septu gene are expressed by promoter j23101 and promoter j23105, respectively.

[0015] In an embodiment of the present invention, the integration sites of the shedu gene and the septu gene are ylbE and yeeP.

[0016] In an embodiment of the present invention, the Escherichia coli is Escherichia coli MG1655 (DE3).

[0017] The third technical solution provided by the present invention is the use of the genetically engineered bacteria described in the first technical solution or the method described in the second technical solution in resisting bacteriophages.

[0018] Beneficial effects

[0019] The present invention is based on laboratory adaptive evolution and anti-phage defense mechanism system anti-phage Escherichia coli chassis cells, in the co-evolution of phage and Escherichia coli strains, the receptor gene of phage is excavated, the resistance of Escherichia coli to phage is further strengthened at the genome level, and the defense system with the ability to resist phage is screened at the same time, the resistance of Escherichia coli to phage is further strengthened, and the chassis cell construction with a wide spectrum of phage resistance is completed. Specifically, the receptor gene of phage is excavated by phage T1, T4, T7, vB_EcoM_P251, vB_EcoM_P255 and Escherichia coli strains co-evolution, the resistance of Escherichia coli to phage is strengthened at the genome level by knocking out the phage receptor screened out, and the defense system shedu and septu with the ability to resist phage is screened at the same time, and the resistance of Escherichia coli to phage is further strengthened by integrating genes into ylbe and yeeP gene sites, and the chassis cell construction with a wide spectrum of phage resistance is completed. It has certain application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 These are the phage resistance verification results of Example 1 of the present invention; A is Kp251, B is Kp251-pET28a-ompA (WT), C is KT1-pET28a-fhuA (WT), and D is KT1.

[0021] Figure 2 These are the results of phage resistance verification of the gene knockout strains in Example 2 of the present invention; A is MG1655 (DE3), and B is MG1655 (DE3) ΔfhuA ΔompA.

[0022] Figure 3 This is the result of verification of the resistance to bacteriophage T4 of Example 3 of the present invention; A is pET28a-shedu+pACYCDuet-septu, B is pACYCDuet-septu, and C is pET28a-shedu.

[0023] Figure 4This is the result of verification of the resistance to bacteriophage T4 of Example 4 of the present invention; A is pET28a-j23101shedu, B is pET28a-j23105shedu, C is pET28a-j23114shedu, D is pACYCDuet-j23101septu, E is pACYCDuet-j23105septu, and F is pACYCDuet-j23114septu.

[0024] Figure 5 This is the verification result of the phagocytic resistance of the anti-phage Escherichia coli chassis cells in Example 6 of the present invention. DETAILED DESCRIPTION

[0025] Staphylococcus aureus, Bacillus subtilis, Salmonella enterica subsp. enterica, Bacillus licheniformis, and Blastobotrys adeninivorans involved in the following examples were deposited in the laboratory.

[0026] The T1, T7, T4 phages and λ phages involved in the following examples were purchased from China Center for Type Culture Collection (CCTCC).

[0027] The remaining phages were preserved in the laboratory.

[0028] Test method:

[0029] (1) EOP assay: The ratio of the number of plaques formed by the same concentration and volume of phage in the control group and the experimental group (used to measure the phage resistance).

[0030] (2) Resistance determination: Pick a single colony of the engineered bacteria that has been successfully introduced with the plasmid and culture it in LB liquid medium (containing kan and chl) at 37°C and 180 r·min-1 on a shaker until the logarithmic phase (OD600 = 0.6). Mix 5 mL of semi-solid culture medium, an appropriate amount of the above-mentioned recombinant bacterial solution, IPTG and antibiotics evenly and pour it onto the lower solid agar plate (containing the corresponding antibiotics) and culture it at room temperature for 1 to 2 hours. Take the phage stored in the laboratory out of the refrigerator and store it on ice. After the double-layer agar plate culture is completed, add 1 μL of different phages (appropriate concentration) to the upper plate, invert the plate and culture it in a 25°C incubator overnight. Identify the phage receptor by observing the presence or absence of phage plaques, and measure the resistance to phage by calculating the EOP of the defense system.

[0031] (3) Gene editing technology: Resistance to phages is achieved by utilizing gene knockout receptors and integrated defense mechanisms. The plasmid cpf1 containing Cas12 is introduced into Escherichia coli MG1655 (de3) by chemical transformation, and a targeting plasmid pcrEG containing the knockout gene is constructed. The homologous arm (homologous 500Bp) is obtained by fusion PCR, and the targeting plasmid and homologous arm are introduced together into Escherichia coli MG1655 (de3) containing the plasmid cpf1 by electroporation. The gene knockout and integration are verified by colony PCR.

[0032] The raw materials used in the embodiment are:

[0033] (1) LB liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L.

[0034] (2) LB solid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 15 g / L.

[0035] (3) LB semisolid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 5 g / L.

[0036] Example 1 Screening of potential phage receptor genes based on adaptive evolution

[0037] The specific steps are as follows:

[0038] (1) Pick a loop of Escherichia coli BL21 colony that has been activated multiple times in LB solid medium and inoculate it into 10 mL of LB liquid medium and culture it until the logarithmic phase (OD 600 =0.6), 100 μL of phage [T1, T7, vB_EcoM_P251, vB_EcoM_P255] lysate was added respectively, mixed evenly, and incubated at 37°C, 180 r·min -1 Incubate overnight on a shaker. Take the bacterial solution and streak it, pick a single colony, and repeat the above steps 6 times. After multiple transfers, culture and select a single colony.

[0039] (2) The Escherichia coli strains KT1, KT7, Kp251, and Kp255 that were resistant to phages through adaptive evolution were screened and cultured in LB liquid culture medium. The conical flasks were placed in a shaker at 37°C and 200 r·min-1 for 8 to 10 hours. 2 to 4 mL of bacterial solution was aspirated with a pipette at room temperature. The centrifuge speed was set to 8000 r·min-1 and the centrifugation time was 5 minutes. After centrifugation, the precipitate was collected and the supernatant was removed. Then, the resistant bacterial genome was extracted according to the instructions of the bacterial genome extraction kit of Nanjing Novozymes Co., Ltd.

[0040] (3) The extracted E. coli genome was sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for whole genome resequencing to determine the gene fragment of the mutation site.

[0041] (4) The genome resequencing results are shown in Table 1.

[0042] Table 1 Genome resequencing results

[0043]

[0044]

[0045] The above-mentioned gene mutations of fhuA, fhuB and sslE appeared in KT1 and KT7 mutation-resistant Escherichia coli strains, while the gene mutations of ompA and waaG appeared in Kp251 and Kp255 mutation-resistant Escherichia coli strains.

[0046] (5) The above gene was constructed into pET-28a plasmid, and the BL21 genome was used as a template to design the following primers:

[0047] 28a-fhuA-F:GGTGGACAGCAAATGGGTCGCGGATCCATGGCGCGTTCCAAAACTGC

[0048] 28a-fhuA-R:AGTGCGGCCGCAAGCTTTTAGAAACGGAAGGTTGCGGTTG

[0049] 28a-fhuB-F:

[0050] AGCAAATGGGTCGCGGATCCGTGAGTAAACGAATTGCGCTTTTCCC

[0051] 28a-fhuB-R:TCGAGTGCGGCCGCAAGCTTTTAACGGCTCTGCTTTCTCAACAAAT

[0052] 28-ompA-F:ATGGGTCGCGGATCCATGAAAGTTAAAGTACTGTCCCTCCT

[0053] 28a-ompA-R:CGGCCGCAAGCTTTTAGAACTGGTAAACCAGACCCAG

[0054] 28a-sslE-F:TGGACAGCAAATGGGTCGCGGATCCTTACTCGGCAGACA

[0055] 28a-sslE-R:GAGTGCGGCCGCAAGCTTATGAATAAGAAATTTAAATATAAG

[0056] 28a-waaG-F:AGCAAATGGGTCGCGGATCCTCAACCATCTAAA

[0057] 28a-waaG-R:TCGAGTGCGGCCGCAAGCTTATGATCGTGGCGTTTTGTTTATAT

[0058] Perform PCR amplification, the steps are shown in Table 2.

[0059] Table 2 PCR amplification steps

[0060] condition time 95℃ pre-denaturation 5-10 minutes 95℃ pre-denaturation 30s Annealing at 58°C 30s 72℃ extension 2min cycle ×30 Final extension at 72°C 5-10 minutes Keep warm at 4°C

[0061] The original gene was constructed into a plasmid using the homologous recombination method. The reaction system is shown in Table 3.

[0062] Table 3 Homologous recombination reaction system (20 μL)

[0063] reactants volume Homologous recombination enzyme 10 μL Vector fragment 0.02×number of vector fragment base pairs / vector fragment concentration (μL) gene fragments 0.04×number of gene fragment base pairs / gene fragment concentration (μL) <![CDATA[ddH2O]]> Make up to 20 μL

[0064] The reaction system was reacted at 50° C. for 15 to 60 minutes to obtain recombinant plasmids pET28a-fhuA, pET28a-ompA, pET28a-sslE, and pET28a-waaG.

[0065] (6) Preparation of competent cells for E. coli transformation and introduction of recombinant plasmids by chemical competent transformation

[0066] Preparation of chemically competent E. coli:

[0067] First, isolate and streak frozen E. coli BL21 and incubate in a 37°C incubator for 8–10 hours until a single colony forms. Then, inoculate the single colony into 10 mL of liquid LB medium and incubate overnight at 37°C with a shaker at 200 rpm.

[0068] Next, transfer the cultured LB medium to 50 mL of liquid LB medium and continue to culture in a 37°C shaker. In a sterile operating table, aspirate about 1 mL of bacterial solution and use a UV spectrophotometer to detect the wavelength. When OD 600 When the value is about 0.6-0.8, place the cultured LB medium on ice for 30 minutes.

[0069] Finally, according to the instructions of Dalian Bao Company's competent state preparation kit, the operation was carried out in a sterile clean bench, and the prepared E. coli competent state was stored at -80℃ for use.

[0070] To introduce the recombinant plasmid using the chemical competent transformation method: First, remove the competent cells stored on ice from the refrigerator and use the prepared competent cells. Next, add approximately 2–10 μL of the recombinant plasmid to the EP tube containing the competent cells and gently pipette the mixture. Immediately place the EP tube on ice for 0.5 hours. Next, heat the EP tube in a 42°C water bath for 90 seconds, remove it, and cool it on ice for 2 minutes. Finally, add 800 μL of liquid LB medium and incubate it at 37°C and 180 rpm for 1–2 hours to ensure that the competent cells can recover and express the exogenous gene.

[0071] (7) Verification of positive transformants

[0072] Centrifuge the reconstituted bacteria prepared above after resuscitation and place on a clean bench. Gently mix the bacterial slurry with a small amount of liquid at the bottom of the EP tube using a pipette and spread the mixture onto a resistance plate. Incubate the plate upside down at 37°C in a 37°C incubator overnight. Select a single colony from the resistance plate and verify it is a positive transformant using a PCR instrument using the appropriate primers.

[0073] Validation of pET-28a plasmid primers:

[0074] T7:TAATACGACTCACTATAGGG;

[0075] T7-TERM: GCTAGTTATTGCTCAGCGG.

[0076] (8) Phage resistance verification and phage preparation

[0077] Resistance verification: Pick a single colony of the engineered bacteria that has been successfully introduced with the recombinant plasmid and culture it in LB liquid medium (containing kan) at 37°C and 180 r·min-1 on a shaking table until the logarithmic phase (OD 600 =0.6). Evenly mix 5 mL of semi-solid culture medium, an appropriate amount of the recombinant bacterial suspension, IPTG, and Kan, and pour onto the lower solid agar plate (containing Kan). Incubate at room temperature for 1-2 hours. Remove laboratory-stored bacteriophages T1, T7, vB_EcoM_P251, and vB_EcoM_P255 from the refrigerator and store on ice. After the double-layer agar plate incubation is complete, add 1 μL of each phage (at the appropriate concentration) dropwise to the upper plate. Incubate the plates in an inverted position overnight at 25°C. Verify the resistance of the recombinant bacteria by observing the appearance of plaques.

[0078] Phage preparation: Pipette 100 μL of phage stock solutions T1, T7, vB_EcoM_P251, and vB_EcoM_P255 stored at 4°C and mix evenly with 10 mL of logarithmically growing Escherichia coli BL21 culture. Incubate overnight at 37°C at 200 rpm. Collect the clarified culture solution and centrifuge at 5000 rpm for 15 minutes to remove phage-adsorbed cells. Sterilize the supernatant by filtering through a 0.22 μm sterile microporous filter. This filtrate is the phage lysate.

[0079] The results are as follows Figure 1 As shown above, the resistant strain expressing the original genes ompC and fhuA lost its resistance to phage infection, confirming that the genes ompA and fhuA are receptors for phages vB_EcoM_P251, vB_EcoM_P255, T1, and T7. However, overexpression of the genes waaG and sslE had no effect on phage infection.

[0080] Example 2: Obtaining resistant strains by knocking out phage receptor genes

[0081] 1. Design sgRNA: Find the targeting sequence and construct the pGRB plasmid. The steps are as follows:

[0082] (1) Search for the targeting sequence of genes ompA and fhuA according to the website:

[0083] ompA targeting sequence 1:AGCCTGACCTTCCGGTTTCA;

[0084] ompA targeting sequence 2: CTCGTCTGGGTGGCATGGTA;

[0085] fhuA targeting sequence 1: CATTCATGGTGCTGTTGTGG;

[0086] fhuA targeting sequence 2: TGATGCCGGACGCGACTCTA.

[0087] (2) Design primers:

[0088] Pgrb1-fhuA-F:CATTCATGGTGCTGTTTGTGGgttttagagctagaaatagc;

[0089] Pgrb1-fhuA-R: actagtattatacctaggact CCACAACAGCACCATGAATG;

[0090] Pgrb2-fhuA-F:TGATGCCGGACGCGACTCTAgttttagagctagaaatagc;

[0091] Pgrb2-fhuA-R:TAGAGTCCGCGTCCGGCATCAactagtattatacctaggact;

[0092] Pgrb1-ompA-F:AGCCTGACCTTCCGGTTTCAgttttagagctagaaatagcaagtta;

[0093] Pgrb1-ompA-R:gacagctagctcagtcctaggtataatactagtAGCCTGACCTTCCGGTTTTCA;

[0094] Pgrb2-ompA-F:CTCGTCTGGGTGGCATGGTAgttttagagctagaaatagcaagtt;

[0095] Pgrb2-ompA-R:gacagctagctcagtcctaggtataatactagtCTCGTCTGGGTGGCATGGTA;

[0096] Second, fusion PCR amplified 500bp upstream and downstream fragments and connected them to form homology arms:

[0097] (1) The Escherichia coli MG1655 (DE3) genome was used as a template;

[0098] Primers: fhuA-LH-F:GTTTCACTGAAACGTGTTCATAGACTCCT

[0099] fhuA-LH-R:TGAAGTCATAATCATTTCAGTAGAAAAACC

[0100] fhuA-RH-F:CTGAAATGATTATGACTTCAGCATAAAGTCAAAAGCCTCCGA

[0101] fhuA-RH-R:TTCTCCTCAGGAAAATCATAGTAGCAT

[0102] Amplify fhuA LH and fhuA RH.

[0103] (2) Same ompA-LH-F: TTCACCAGCGGCCCGACG

[0104] ompA-RH-F:TTCGATATCAATCGAGAGTTATTAACCCTCTGTTATATGCCTTTTATTTGC

[0105] ompA-RH-R:TTGTGAAATAGTTAACAAGCGTTATAGTTTTTCTGTGG

[0106] ompA-LH-R:TCTCGATTGATATCGAACAAAGGGC

[0107] Amplify ompA LH and ompA RH.

[0108] (3) Using fhuA LH and fhuA RH as templates, primers: fhuA-LH-F: GTTTCACTGAAACGTGTTCATAGACTCCT;

[0109] fhuA-RH-R: TTCTCCTCAGGAAAATCATAGTAGCAT was amplified and fused with RH and LH to construct the fhuA homology arm.

[0110] (4) Using ompA LH and ompA RH as templates, primers: ompA-LH-F: TTCACCAGCGGCCCGACG; ompA-RH-R: TTGTGAAATAGTTAACAAGCGTTATAGTTTTTCTGTGG were amplified and fused to RH and LH to construct the ompA homology arm.

[0111] 3. Preparation of Electrocompetent Cells (Escherichia coli MG1655 (DE3))

[0112] First, isolate and streak frozen E. coli MG1655 (DE3) and culture in a 37°C incubator for 8–10 hours until a single colony forms. Then, inoculate the single colony into 10 mL of liquid LB medium and incubate overnight at 37°C, 200 rpm.

[0113] Next, take out the cultured E. coli liquid, transfer it to 50mL of liquid LB medium, and continue to culture in a 37℃ shaker. Pipette about 1mL of the liquid in the clean bench and detect the wavelength with a UV spectrophotometer. When OD 600When the pH is around 0.6-0.8, place the LB medium containing E. coli on ice for 30 minutes. Add 1 mL of bacterial solution to a pre-chilled 1.5 mL EP tube. Set the speed of the refrigerated centrifuge to 6000 r / min-1 and the centrifugation time to 5 minutes. After low-temperature centrifugation, pour out the supernatant in the clean bench and retain the bacterial sludge. Add 1 mL of 10% glycerol solution (pre-chilled) to the 1.5 mL EP tube containing the bacterial sludge, gently mix thoroughly, and then refrigerate and centrifuge at 6000 r / min-1 for 5 minutes. Pour out the supernatant and repeat 2-3 times. Finally, add 800 μL of pre-chilled glycerol solution to the bacterial sludge, mix thoroughly, and store in a -80°C refrigerator.

[0114] 4. Construction of MG1655(DE3)(pCas9) strain

[0115] Thawed electrocompetent MG1655 (DE3) cells and 200 ng of pCas9 plasmid were electroporated into the host bacteria. Add 1 ml of LB medium and incubate at 30°C, 200 rpm for 1.5 hours. Centrifuge the culture medium, spread it on a SPE-resistant plate, and incubate overnight at 30°C in a constant-temperature incubator. Perform colony PCR on individual colonies to select the correct positive transformants.

[0116] 5. Construction of gene knockout strains

[0117] First, a frozen, stored E. coli MG1655(DE3)(pCas9) strain was isolated and streaked, then cultured overnight in a 30°C incubator until a single colony was observed. Then, a single colony was inoculated into 10 mL of liquid LB medium and cultured overnight at 30°C, 200 rpm.

[0118] Next, take out the cultured E. coli liquid, transfer it to 50mL of liquid LB medium, and continue to culture in a 30℃ shaker. In the clean bench, take about 1mL of the liquid and detect the wavelength with a UV spectrophotometer. When OD 600When the p-value is around 0.6-0.8, IPTG is added to the LB medium culture of E. coli for induction for 1.5 hours. The bacterial suspension is collected in a 50 mL EP tube. A refrigerated centrifuge is set to 6000 rpm for 5 minutes. The bacterial suspension is resuspended in pre-chilled 10% glycerol and centrifuged at 6000 rpm for 5 minutes, repeated twice. 800 μL of pre-chilled glycerol solution is then added to the bacterial slurry, mixed thoroughly, and 200 ng of the homology arms and 100 ng of the pGRB plasmid are added. The mixture is then transformed into the host bacteria by electroporation. 1 mL of LB medium is added and incubated at 30°C at 200 rpm for 1.5 hours. The bacterial suspension is then centrifuged and plated on a dual-antibody plate containing spe and amp antibodies and incubated overnight at 30°C. Single colonies are analyzed for colony PCR using primers fhuA-LH-F / RH-R and ompA-LH-F / RH-R to select the correct positive transformants.

[0119] Plasmid removal: E. coli positive transformants containing the pGRB and pCas9 plasmids were inoculated into LB medium supplemented with L-arabinose and spe, incubated for 14-16 hours, and then streaked. Single colonies were selected and streaked onto amp plates and then spe plates. Strains that grew only on spe-resistant plates indicated successful pGRB plasmid removal. Single colonies that successfully lost the pGRB plasmid were inoculated into LB liquid medium and incubated overnight at 42°C. Strains were then divided and streaked using the same method. Isolated colonies were then plated onto spe-resistant and non-resistant LB plates, indicating successful pCas9 plasmid removal, indicating successful pTarget and pCas9 elimination. Through these steps, we obtained E. coli MG1655(DE3)ΔfhuAΔompA, which is a knockout strain of the fhuA and ompA genes.

[0120] VI. Verification of phage resistance of gene knockout strains

[0121] The engineered bacteria Escherichia coli MG1655 (DE3) with the gene plasmid successfully knocked out ΔompAΔfhuA were picked and cultured in LB liquid medium at 37°C and 180 r·min-1 shaking until the logarithmic phase (OD 600 =0.6). Evenly mix 5 mL of semi-solid culture medium with an appropriate amount of the recombinant bacterial solution and pour onto the lower solid agar plate. Incubate at room temperature for 1-2 hours. Remove laboratory-stored bacteriophages T1, T7, vB_EcoM_P251, and vB_EcoM_P255 from the refrigerator and store on ice. After the double-layer agar plate is incubated, add 1 μL of each phage (at the appropriate concentration) dropwise to the upper plate. Incubate the plate in an inverted position at 37°C overnight. Verify resistance by observing the appearance of plaques.

[0122] The results are as follows Figure 2As shown, the gene knockout strain MG1655 (DE3) ΔfhuA ΔompA was successfully resistant to bacteriophages T1, T7, vB_EcoM_P251, and vB_EcoM_P255.

[0123] Example 3: Construction and combination of two defense systems combined with anti-phage plasmids

[0124] The specific steps are as follows:

[0125] (1) Resistance to bacteriophage T4 utilizes the phage-resistant defense mechanisms shedu and septu. Target genes were obtained by obtaining the shedu gene from Bacillus cereus strain B4264 and the septu gene from Bacillus thuringiensis HD12. These two defense systems were constructed into pET28a-shedu and pacycDuet-septu, respectively.

[0126] Design primers

[0127] pET28a-shedu-F:AGCAAATGGGTCGCGGATCCATGTATATGACC

[0128] pET28a-shedu-R:TTAAAATTATTTAAAAGCTTGCGGCCGCACTCGAGC

[0129] pACYCDuet-septu-F:ACTTTAAGAAGGAGATATACCATGGGCAGCAGCCATCA

[0130] pACYCDuet-septu-R:CACGCCCCAGCATTAATTTAAAAGCTTGCG

[0131] (2) Construction of plasmid

[0132] Preparation of chemically competent E. coli:

[0133] First, isolate and streak frozen E. coli BL21 and incubate in a 37°C incubator for 8–10 hours until a single colony forms. Then, inoculate the single colony into 10 mL of liquid LB medium and incubate overnight at 37°C with a shaker at 200 rpm.

[0134] Next, transfer the cultured LB medium to 50 mL of liquid LB medium and continue to culture in a 37°C shaker. In a sterile operating table, aspirate about 1 mL of bacterial solution and use a UV spectrophotometer to detect the wavelength. When OD 600 When the value is about 0.6-0.8, place the cultured LB medium on ice for 30 minutes.

[0135] Finally, according to the instructions of Dalian Bao Company's competent state preparation kit, the operation was carried out in a sterile clean bench, and the prepared E. coli competent state was stored at -80℃ for use.

[0136] To introduce the recombinant plasmid using the chemical competent transformation method: First, remove the competent cells stored on ice from the refrigerator and use the prepared competent cells. Next, add approximately 2–10 μL of the recombinant plasmid to the EP tube containing the competent cells and gently pipette the mixture. Immediately place the EP tube on ice for 0.5 hours. Next, heat the EP tube in a 42°C water bath for 90 seconds, remove it, and cool it on ice for 2 minutes. Finally, add 800 μL of liquid LB medium and incubate it at 37°C and 180 rpm for 1–2 hours to ensure that the competent cells can recover and express the exogenous gene.

[0137] (3) Verification of positive transformants

[0138] Centrifuge the reconstituted bacteria prepared above after resuscitation and place on a clean bench. Gently mix the bacterial slurry with a small amount of liquid at the bottom of the EP tube using a pipette and spread the mixture onto a resistance plate. Incubate the plate upside down at 37°C in a 37°C incubator overnight. Select a single colony from the resistance plate and verify it is a positive transformant using a PCR instrument using the appropriate primers.

[0139] Validation of pET28a-shedu and pACYCDuet-septu primers:

[0140] T7:TAATACGACTCACTATAGGG;

[0141] T7-TERM: GCTAGTTATTGCTCAGCGG.

[0142] (4) Plasmid extraction

[0143] Inoculate 10 mL of liquid LB medium with E. coli BL21-pET28a-shedu and BL21-pacycDuet-septu and culture overnight at 37°C with a shaker at 200 rpm. Extract 2 mL of the culture medium using the TRAN Plasmid Extraction Kit to extract the plasmids pET28a-shedu and pACYCDuet-septu.

[0144] (5) Construction of a dual-defense system-resistant Escherichia coli strain by transfection

[0145] First, isolate and streak frozen E. coli MG1655 (DE3) and culture in a 37°C incubator for 8–10 hours until a single colony forms. Then, inoculate the single colony into 10 mL of liquid LB medium and culture overnight at 37°C with a shaker at 200 rpm.

[0146] Next, transfer the cultured LB medium to 50 mL of liquid LB medium and continue to culture in a 37°C shaker. In a sterile operating table, aspirate about 1 mL of bacterial solution and use a UV spectrophotometer to detect the wavelength. When OD 600 When the value is about 0.6-0.8, place the cultured LB medium on ice for 30 minutes.

[0147] Finally, according to the instructions of Dalian Bao Company's competent state preparation kit, the operation was carried out in a sterile clean bench, and the prepared E. coli competent state was stored at -80℃ for use.

[0148] To introduce the recombinant plasmid using the chemical competent transformation method: First, remove the competent cells stored on ice from the refrigerator and use the prepared competent cells. Next, add 2-10 μL of the recombinant plasmid to each of the EP tubes containing the competent cells, gently pipetting the tubes, and immediately place the EP tubes on ice for 0.5 hours. Subsequently, heat the EP tubes in a 42°C water bath for 90 seconds, remove them, and cool them on ice for 2 minutes. Finally, add 800 μL of liquid LB medium and incubate them at 37°C and 180 rpm for 1-2 hours to ensure that the competent cells can recover and express the exogenous gene.

[0149] After the resuscitation culture, the recombinant bacteria prepared above were centrifuged and placed on a clean bench. Using a pipette, the bacterial slurry was gently mixed with a small amount of liquid at the bottom of the EP tube. The mixture was spread onto kan and chl plates and inverted in a 37°C incubator for overnight incubation. A single colony was picked from the resistance plate and verified as a positive transformant using a PCR instrument using the appropriate primers.

[0150] (6) Pick a single colony of the engineered bacteria that has successfully introduced the recombinant plasmid and culture it in LB liquid medium (containing kan and chl) at 37°C and 180 r·min-1 on a shaking table until the logarithmic phase (OD 600 =0.6). Evenly mix 5 mL of semi-solid culture medium, an appropriate amount of the recombinant bacterial suspension, IPTG, and Kan, and pour onto the lower solid agar plate (containing Kan). Incubate at room temperature for 1-2 hours. Remove the laboratory-stored bacteriophage T4 from the refrigerator and store on ice. After the double-layer agar plate incubation is complete, add 1 μL of each phage (at an appropriate concentration) to the upper plate. Incubate the plates in an inverted position overnight at 25°C. Calculate the end-of-life performance (EOP) of the defense system to measure resistance to bacteriophage T4.

[0151] The experimental results are as follows Figure 3 As shown, EOP (pET28a-shedu) is 2; EOP (pACYCDuet-septu) is 1.7; EOP (pET28a-shedu+pACYCDuet-septu) is 10, which further indicates that the dual defense system can effectively resist the infection of bacteriophage T4.

[0152] Example 4: Constitutive promoter screening and constitutive plasmid construction

[0153] The specific steps are as follows;

[0154] The following three constitutive promoters, j23101, j23105 and j23114, were selected, and their nucleotide sequences are shown in Table 4.

[0155] Table 4 Promoter sequences

[0156] J23101 tttacagctagctcagtcctaggtattatgctagc J23105 tttacggctagctcagtcctaggtactatgctagc J23114 tttatggctagctcagtcctaggtacaatgctagc

[0157] Plasmids pET28a-j23101shedu, pET28a-j23105shedu, pET28a-j23114shedu and plasmids pACYCDuet-j23101septu, pACYCDuet-j23105septu, pACYCDuet-j23114septu were constructed by homologous recombination.

[0158] The appropriate constitutive promoter was selected by measuring the EOP size of different plasmids for phage T4. The results are shown in Table 5.

[0159] Table 5 Constitutive promoter EOP results

[0160] constitutive plasmid EOP pET28a-j23101shedu 10 pET28a-j23105shedu 2 pET28a-j23114shedu 2 pACYCDuet-j23101septu 1 pACYCDuet-j23105septu 1.7 pACYCDuet-j23114septu 1

[0161] according to Figure 4 As shown in Table 5, pET28a-j23101shedu and pacycDuet-j23105septu had strong resistance to bacteriophage T4.

[0162] Example 5: Construction of phage-resistant Escherichia coli chassis cells based on laboratory adaptive evolution and anti-phage defense mechanism system

[0163] The specific steps are as follows:

[0164] (1) Designing sgRNA: Finding the targeting sequence to construct the PCREG plasmid

[0165] Select pseudogene sites as integration sites for resistance genes, select genes ylbE and yeeP

[0166] ylbE targeting sequence:ACCGGCTTCTCGCAGGAGCAGGC

[0167] Yeep targeting sequence: ACACGGCGGAGAGCGTCTGTATT

[0168] ylbE-LH-F:aactgaggagtgcaacgatgcc

[0169] ylbE-RH-R:cgtgaattaacgtctgcaaacacaaccc

[0170] yeeP-LH-F:atagcaatgttgctggttttgatggcc

[0171] yeeP RH-R:gatgcgccatttaccacacatttattatggt

[0172] Construct plasmids pcrEG-ylbE and pcrEG-yeeP.

[0173] (2) PCR amplified 500 bp upstream and downstream fragments and connected them to the gene to form homology arms

[0174] Design primers such as gene knockout and amplification fragments j23101shedu, j23105 septu.

[0175] Use fusion PCR to connect the upstream and downstream fragments of the gene and the gene fragment to be integrated to form homology arms

[0176] (3) Preparation of electroporated competent cells (Escherichia coli MG1655 (DE3) ΔfhuA ΔompA): as in Example 1 above: (9)

[0177] (4) Construction of Escherichia coli MG1655(DE3)ΔfhuAΔompA(Cpf1) strain:

[0178] Thawed electroporation competent MG1655 (DE3) ΔfhuAΔompA and 200ng Cpf1 plasmid were electroporated into the host bacteria. 1ml LB culture medium was added and incubated at 37℃ and 200r / min. -1 After 1.5 hours of incubation, the bacterial solution was centrifuged and spread on a Kan plate, which was then incubated overnight in a 37°C constant temperature incubator. Single colonies were subjected to colony PCR to select the correct positive transformants.

[0179] (5) Gene integration step

[0180] Preparation of competent cells for electroporation:

[0181] First, the frozen Escherichia coli MG1655 (DE3) ΔfhuA ΔompA (Cpf1) strain was isolated and streaked, and then cultured in a 37°C constant temperature incubator overnight until a single colony was observed. Then, the single colony was inoculated into 10 mL of liquid LB medium and incubated at 37°C, 200 r·min -1 Incubate overnight.

[0182] Next, take out the cultured E. coli liquid, transfer it to 50mL of liquid LB medium, and continue to culture in a 37℃ shaker. Pipette about 1mL of the liquid in the clean bench and detect the wavelength with a UV spectrophotometer. When OD 600 When the pH value is around 0.6-0.8, add L-arabinose to the LB medium containing E. coli and induce for 1.5 hours. Collect the bacterial suspension in a 50 mL EP tube. Set the speed of the refrigerated centrifuge to 6000 rpm. -1 , set the centrifugation time to 5 minutes. Resuspend the bacterial solution with pre-cooled 10% glycerol and centrifuge at 6000r·min -1 , 5 minutes, repeat twice. Then add 800μL of pre-cooled glycerol solution to the bacterial slurry and mix well. Add 2000ng of homology arm and 500ng of pcrEG plasmid and transform into host bacteria by electroporation. Add 1ml of LB culture medium and incubate at 30℃, 200r·min -1 After 1.5 hours of incubation, the bacterial suspension was centrifuged and plated with kan and spe dual-antibody plates and incubated overnight at 37°C in a constant temperature incubator. Single colonies were subjected to colony PCR using primers ylbE-LH-F / RH-R and yeeP-LH-F / RH-R to select correct positive transformants.

[0183] Plasmid removal: E. coli positive transformants containing the pcrEG and Cpf1 plasmids were inoculated into LB medium supplemented with rhamnose and kan and incubated for 14-16 hours before streaking. Single colonies were selected and streaked onto SPE and then Kan plates. Strains that grew only on SPE-resistant plates indicated successful pcrEG plasmid removal. Single colonies that successfully lost the pcrEG plasmid were inoculated into LB liquid medium supplemented with sucrose and glucose and incubated overnight at 37°C. Strains were then streaked using the same method and isolated onto kan-resistant and non-resistant LB plates. Strains that grew only on the non-resistant plates indicated successful cpf1 plasmid removal, indicating successful pcrEG and Cpf1 elimination. This construct constructed a phage-resistant E. coli MG1655(DE3)ΔfhuAΔompA-ylbE-23101shedu / yghX-j23105septu strain with a combined dual defense system.

[0184] Example 6: Verification of phage resistance of phage-resistant Escherichia coli chassis cells

[0185] The successfully integrated engineered bacteria were picked up and single colonies were cultured in LB liquid medium at 37°C and 180 r·min. -1 Culture on a shaker until the logarithmic phase (OD 600 =0.6). Evenly mix 5 mL of semi-solid culture medium and an appropriate amount of the recombinant bacterial solution described above, pour the mixture onto the lower solid agar plate, and incubate at room temperature for 1-2 hours. Remove the laboratory-stored bacteriophage T4 from the refrigerator and store on ice. After the double-layer agar plate incubation is complete, add 1 μL of each phage (at the appropriate concentration) dropwise to the upper plate. Incubate the plate in an inverted position at 37°C overnight. Calculate the EOP.

[0186] The results are as follows Figure 5 As shown, the full titer of resistance was achieved against phages T1, T7, vB_EcoM_P251, and vB_EcoM_P255, indicating that the E. coli chassis cell MG1655 (DE3) ΔfhuAΔompA-ylbE-23101shedu / yghX-j23105septu achieved multi-antibody broad-spectrum anti-phage targets.

[0187] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria uses Escherichia coli as a starting strain, knocks out the phage T1 and T7 receptor genes fhuA and the phage vB_EcoM_P251 and vB_EcoM_P255 receptor genes ompA of the starting strain, and integrates and expresses the shedu gene from Bacillus cereus strain B4264 and the septu gene from Bacillus thuringiensis HD12 in the starting strain. The nucleotide sequences of the fhuA gene, ompA gene, shedu gene, and septu gene are shown in SEQ ID NOs. 1 to 4, respectively.

2. The genetically engineered bacterium according to claim 1, characterized in that The shedu gene and septu gene are respectively driven to express by constitutive promoters.

3. The genetically engineered bacterium according to claim 2, characterized in that The shedu gene and the septu gene are driven to express by promoter j23101 and promoter j23105 respectively.

4. The genetically engineered bacterium according to claim 1, characterized in that The integration sites of the shedu gene and the septu gene are ylbE and yeeP.

5. The genetically engineered bacterium according to claim 1, characterized in that The starting strain is Escherichia coli MG1655 (DE3).

6. A method for improving the anti-phage ability of Escherichia coli, characterized in that: The method comprises knocking out the bacteriophage T1 and T7 receptor genes fhuA and the bacteriophage vB_EcoM_P251 and vB_EcoM_P255 receptor genes ompA of Escherichia coli, and integrating the shedu gene from Bacillus cereus strain B4264 and the septu gene from Bacillus thuringiensis HD12 into the Escherichia coli, wherein the nucleotide sequences of the fhuA gene, ompA gene, shedu gene and septu gene are shown in SEQ ID NOs. 1 to 4, respectively.

7. The method according to claim 6, characterized in that The shedu gene and the septu gene are driven to express by constitutive promoters respectively; alternatively, the shedu gene and the septu gene are driven to express by promoter j23101 and promoter j23105 respectively.

8. The method according to claim 6, characterized in that The integration sites of the shedu gene and the septu gene are ylbE and yeeP.

9. The method according to claim 6, characterized in that The Escherichia coli is Escherichia coli MG1655 (DE3).

10. Use of the genetically engineered bacteria according to any one of claims 1 to 5 or the method according to any one of claims 6 to 9 in resisting bacteriophages.

Citation Information

Cited By

  • Escherichia coli for fermentation production of riboflavin anti-phage

    CN121271902A