Escherichia coli for fermentation production of riboflavin anti-phage

By knocking out the phage receptor gene and integrating the defense system gene in Escherichia coli strains, a multi-resistant, broad-spectrum anti-phage Escherichia coli was constructed. This solved the problems of stability and yield of microbial infection by phages, achieved the ability to efficiently resist multiple phages, and improved the stability of fermentation production and riboflavin yield.

CN121271902APending Publication Date: 2026-01-06JIANGNAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511672177.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-14
Publication Date
2026-01-06

AI Technical Summary

Technical Problem

Existing technologies are time-consuming, costly, and ineffective in dealing with phage infection, and cannot effectively solve the problem of phage contamination. There is a need to develop highly resistant, broad-spectrum anti-phage E. coli chassis cells.

Method used

By knocking out the phage receptor genes ompA and fhuA in Escherichia coli strains, integrating the shedu gene from Bacillus cereus and the septu gene from Bacillus thuringiensis, and expressing the KELM and Gabija genes, a multi-antibody broad-spectrum anti-phage defense system was constructed to enhance the resistance of Escherichia coli to phages.

Benefits of technology

It achieves highly efficient resistance to multiple bacteriophages, enhances the anti-phage ability of Escherichia coli, and ensures the stability and yield of the fermentation production process. The riboflavin yield can reach 1 g/L in shake flasks and 10.17 g/L in 5L fermenters.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121271902A_ABST
    Figure CN121271902A_ABST
Patent Text Reader

Abstract

The invention discloses Escherichia coli for fermentation production of riboflavin anti-bacteriophage, and belongs to the technical field of microorganisms. Receptor genes of bacteriophages are excavated through co-evolution of bacteriophages T1, T7, vBEcoMP251 and vBEcoMP255 and escherichia coli strains, the resistance of escherichia coli to the bacteriophages is enhanced by knocking out screened bacteriophage receptors on the genome level, and meanwhile, defense systems Gabija and KELM with the ability of resisting bacteriophages JNUWH1 and JNUWD and defense systems Shedu and Septu with the ability of resisting bacteriophages T4 are obtained through screening. Gene is integrated to a genome to strengthen the resistance of escherichia coli to bacteriophage, construction of the anti-bacteriophage chassis cell is completed, meanwhile, genes lacI, pfkA, edd and eda are knocked out, the anti-bacteriophage escherichia coli chassis cell for fermentation production of riboflavin is obtained, and a certain application prospect is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention discloses a strain of Escherichia coli that produces riboflavin-resistant phages through fermentation, belonging to the field of microbial technology. Background Technology

[0002] Fermentation is an indispensable part of the industrialization of biotechnology. Common industrial microorganisms such as *Escherichia coli* are used in this process. (Escherichia coli) For example, it has been widely applied in many fields of the biotechnology industry. The annual output value of biomanufacturing using E. coli as chassis cells exceeds hundreds of billions of yuan. However, after microorganisms are infected by bacteriophages, measures such as formaldehyde fumigation, pipeline sterilization, and strain rotation are usually used to ensure the continuity of production. However, traditional strategies have some problems, such as being time-consuming, having strict requirements, being costly, and having poor effects. These strategies cannot fundamentally solve the problem of bacteriophage contamination, so the fermentation industry needs to adopt more effective and sustainable methods to deal with bacteriophage contamination. This includes developing new anti-phage tools and technologies, establishing stricter production specifications and regulatory standards, and strengthening basic research on microbial viruses to explore new prevention and control strategies. Therefore, it is necessary to select highly resistant and broad-spectrum anti-phage E. coli chassis cells. Bacteriophages are viruses that can infect microorganisms such as bacteria, fungi, actinomycetes, and spirochetes. They have the characteristics of general viruses: small size, able to pass through filters, are non-cellular organisms, do not have their own metabolic enzyme system, cannot grow and reproduce independently, and can only replicate in living host cells and use the host's synthesized substances. In addition, bacteriophages exhibit host specificity. Bacteriophages typically consist of a protein coat and nucleic acid. Under a microscope, bacteriophages exhibit three basic morphologies: tadpole-shaped, microsphere-shaped, and filamentous. Tailed bacteriophages are the most common known type, consisting of an icosahedral head enclosing genetic material and a tail that assists in movement and infection of host cells. The genetic material protected by the bacteriophage head is primarily of four types: dsDNA, ssDNA, dsRNA, and ssRNA. Many bacteriophages, such as T4, protect their genome from bacterial restriction modifications (RM) and CRISPR-Cas nucleases by covalently modifying it. Bacteria and archaea are frequently attacked by viruses (bacteriophages), thus forming a variety of complex active defense lines collectively known as the prokaryotic "defense system." Summary of the Invention

[0003] To address the aforementioned technical problems, this invention utilizes laboratory adaptive evolution and an anti-phage defense mechanism system to construct anti-phage Escherichia coli chassis cells. By co-evolving phages and E. coli strains to mine phage receptor genes, the resistance of E. coli to phages is further enhanced at the genomic level. Simultaneously, a defense system with phage resistance capabilities is screened to further strengthen the resistance of E. coli to phages, thus completing the construction of chassis cells with broad-spectrum multi-anti-phage antibodies.

[0004] This invention provides a method for knocking out the receptor gene of bacteriophages, further enhancing the resistance of *E. coli* to bacteriophages at the genomic level. Using *E. coli* MG1655(DE3) as the starting strain, the receptor gene of bacteriophages vB_EcoM_P251 and vB_EcoM_P255 was knocked out for selection. ompA Receptor genes of bacteriophage T1 and T7 fhuA This invention provides a gene *Shedu* from *Bacillus cereus* strain B4264, a gene *Gabija* from *Bacillus cereus* strain VD045, and a gene *Septu* obtained from *Bacillus thuringiensis* HD12. These two defense systems were constructed as pET28a-Shedu, pET28a-Gabija, and pcycDuet-Septu, respectively. The resistance of these defense mechanisms to bacteriophages was verified by calculating the EOP. This invention also provides a system for constructing phage-resistant *Escherichia coli* chassis cells based on laboratory adaptive evolution and anti-phage defense mechanisms. The starting strain is MG1655(DE3) with the phage receptor gene knocked out, combined with a suitable constitutive promoter to integrate the genes *Shedu*, *Septu*, a KEL mutant (KELM), and *Gabija*. Finally, the resistance to bacteriophages vB_EcoM_P251, vB_EcoM_P255, T1, T7, T4, JNUWH1, and JNUWD was verified, and a multi-antibody broad-spectrum anti-phage chassis cell was constructed.

[0005] This invention constructs an antiphage-based E. coli chassis cell for riboflavin fermentation. The starting strain is the aforementioned antiphage, with the gene knocked out. lacI, pfkA , edd and eda Weakening competitive pathways enhances PPP riboflavin production. Finally, riboflavin production in shake-flask under phage contamination verifies the phage-resistant advantage, and riboflavin production in a 5L fermenter verifies the fermentation potential of chassis cells.

[0006] This invention provides a KELM mutant, the amino acid sequence of which is shown in SEQ ID NO.2.

[0007] This invention provides the application of Gabija and / or the above-mentioned KELM mutant in improving the ability of Escherichia coli to resist bacteriophages, wherein the nucleotide sequence of Gabija is shown in SEQ ID NO.1; Preferably, the bacteriophage includes T1 bacteriophage, T7 bacteriophage, JNUWH1 bacteriophage, and JNUWD bacteriophage; Preferably, the Escherichia coli includes Escherichia coli MG1655(DE3) and Escherichia coli BL21.

[0008] The present invention provides a recombinant Escherichia coli resistant to bacteriophages, wherein the recombinant Escherichia coli expresses the above-mentioned KELM mutant and / or the nucleotide sequence as shown in SEQ ID NO.1, Gabija; preferably, the Escherichia coli includes Escherichia coli MG1655(DE3) and Escherichia coli BL21.

[0009] This invention provides a recombinant Escherichia coli resistant to bacteriophages, wherein the recombinant Escherichia coli is a genome-knockout strain... fhuA Gene, ompA The gene, along with the shedu gene from Bacillus cereus, the septu gene from Bacillus thuringiensis, the aforementioned KELM mutant, and the Gabija gene shown in SEQ ID NO.1, are integrated into the genome. The shedu, septu, and Gabija genes are overexpressed using promoter J23100 (ttgacggctagctcagtcctaggtacagtgctagc), and the KELM mutant is overexpressed using promoter J23119 (ttgacagctagctcagtcctaggtataatactagt).

[0010] Preferably, the fhuA The gene's Gene ID is 944856. ompA The gene's Gene ID is 945571, the NCBI number of the shedu gene is 954837 to 957049 in CP001176.1, and the NCBI number of the septu gene is 2993073 to 2996156 in CP089521.1. Preferably, the Shedu gene is integrated at the ylbE site on the E. coli genome. yghx The site integrates the septu gene, located on the E. coli genome. glmS The site integrates the Gabija gene, located on the E. coli genome. ybcv The site integrates the KELM mutant; Preferably, the Gene ID of the ylbE site is 4056025. yghx The gene ID of the locus is 2847694. glmS The gene ID of the locus is 948241. ybcv Gene ID of the locus: 945178; Preferably, the bacteriophage includes T1 bacteriophage, T7 bacteriophage, JNUWH1 bacteriophage, and JNUWD bacteriophage; Preferably, the Escherichia coli includes Escherichia coli MG1655(DE3).

[0011] The present invention also provides a genetically engineered bacterium capable of producing high levels of riboflavin resistant to bacteriophages. The *Escherichia coli* is based on the aforementioned recombinant *Escherichia coli* resistant to bacteriophage infection as the chassis cell, with the lacI gene, pfkA gene, and edd-eda gene knocked out from its genome. Preferably, the lacI gene has a Gene ID of 945007, the pfkA gene has a Gene ID of 948412, and the edd-eda gene sequence is from position 1031585 to 1034719 of Sequence ID: AP027457.1.

[0012] The present invention also provides a method for improving the ability of *E. coli* to resist bacteriophages, the method comprising modifying *E. coli* by at least one of the following: (1) overexpressing the above-mentioned KELM mutant; (2) overexpressing the Gabija gene with the nucleotide sequence shown in SEQ ID NO. 1. Preferably, the modification further comprises: knocking out the gene on the genome. fhuA Gene, ompA The gene integrates the shedu gene from Bacillus cereus and the septu gene from Bacillus thuringiensis into the genome; preferably, the... fhuA The gene's Gene ID is 944856. ompA The gene's Gene ID is 945571, the NCBI number of the shedu gene is 954837 to 957049 in CP001176.1, and the NCBI number of the septu gene is 2993073 to 2996156 in CP089521.1. Preferably, the Shedu gene is integrated at the ylbE site on the E. coli genome. yghx The site integrates the septu gene, located on the E. coli genome. glmS The site integrates the Gabija gene, located on the E. coli genome. ybcv The site integrates the KELM mutant; Preferably, the Gene ID of the ylbE site is 4056025. yghx The gene ID of the locus is 2847694. glmS The gene ID of the locus is 948241. ybcv Gene ID of the locus: 945178; Preferably, the bacteriophage includes T1 bacteriophage, T7 bacteriophage, JNUWH1 bacteriophage, and JNUWD bacteriophage; Preferably, the Escherichia coli includes Escherichia coli MG1655(DE3).

[0013] The present invention also provides a method for preparing riboflavin, wherein the method comprises: fermenting the above-mentioned genetically engineered bacteria to obtain riboflavin; inoculating the strain into a culture medium and culturing it at 36-37 °C and 200-220 rpm for 10-12 hours to obtain a primary seed culture; inoculating the prepared primary seed culture into the culture medium at an inoculation rate of 12-15% by volume and culturing it at 36-37 °C and 200-220 rpm for 10-12 hours to obtain a secondary seed culture; transferring the prepared secondary seed inoculum into a fermentation culture medium and fermenting it at 37-38 °C, maintaining the pH at 7.0, keeping the dissolved oxygen level at 30%, and fermenting for at least 30 hours.

[0014] The present invention also provides the application of the above-mentioned recombinant Escherichia coli as chassis cells in the preparation of fermentation products.

[0015] Beneficial effects (1) By overexpressing Gabija and KELM, Escherichia coli can effectively resist the infection of bacteriophages T1, T7, JNUWH1 and JNUWD.

[0016] (2) The strain MG1655(DE3) constructed in this patent ΔfhuAΔompA -ylbE-J23100 shedu / yghX-J23100Septu / glmS - J23100Gabija / ybcv-J23119KELM can achieve highly efficient resistance to bacteriophages P251, P255, JNUWH1, JNUWD, T1, T4, and T7.

[0017] (3) This invention provides a recombinant strain (MG1655(DE3)) that is resistant to bacteriophages and produces high levels of riboflavin. Δ lacIΔfhuAΔompA - ylbE -J23100shedu / yghX -J23100Septu / glmS- J23100Gabija Δ pfkA Δ edd Δ Even when faced with multiple phage infections, riboflavin production can reach 1 g / L at the shake flask level and 10.17 g / L at the 5L fermenter level. Attached Figure Description

[0018] Figure 1 Plaque resistance verification experiment, where the left image shows MG1655(DE3); the right image shows MG1655(DE3). ΔfhuAΔ ompA .

[0019] Figure 2 : Resistance to bacteriophage T4; where A represents the effect of BL21 / pET28a-shedu+pACYCDuet-septu strain, B represents the effect of BL21 / pACYCDuet-septu, and C represents the effect of BL21 / pET28a-shedu.

[0020] Figure 3 Phage resistance of BL21 / pET28a-Gabija strain.

[0021] Figure 4 Phage resistance of BL21 / pET28a-KELM strain.

[0022] Figure 5 Screening for mutants.

[0023] Figure 6 Experiments on resistance of KELShedu, KELM, and Gabija to bacteriophages JNUWH1 and JNUWD.

[0024] Figure 7 MG1655(DE3) ΔfhuAΔompA -ylbE-J23100 shedu / yghX-J23100Septu / glmS Phage resistance of strain J23100Gabija / ybcv-J23119KELM; among which, A:MG1655(DE3) ΔfhuAΔompA - ylbE -J23100shedu / yghX -J23100Septu / glmS - J23100Gabija; B: MG1655(DE3).

[0025] Figure 8 The recombinant strain's resistance to bacteriophages and its production of riboflavin. Detailed Implementation

[0026] The present invention will be further described below with reference to specific embodiments, so that those skilled in the art can better understand and implement the present invention, but the embodiments are not intended to limit the present invention.

[0027] The fhuA, ompA, shedu, and septu genes involved in the following examples are described in the patent application text with publication number CN 120665784 A. The T1, T7, and T4 phages involved in the following examples were purchased from the China Center for Type Culture Collection (CCTCC). The vB_EcoM_P251 and vB_EcoM_P255 phages are disclosed in the paper "Isolation and Identification of Foodborne Pathogenic Escherichia coli O157:H7 and O55:H7 Specific Phages".

[0028] The JNUWH1 and JNUWD bacteriophages are disclosed in the paper "Genomic and biological insights of bacteria JNUWH1 and JNUWD in the arms race against bacterial resistance".

[0029] The EOP calculation method for the defense system involved in the following embodiments is as follows: 500 μL of recombinant bacterial culture encoding the defense system gene (OD600 0.4–0.6) was mixed with 5 mL of preheated (55°C) semi-solid covering agar (with 0.1 mM IPTG added to induce expression), and then immediately poured onto prepared LB agar plates. A 10-fold serial dilution of the phage stock solution was spotted at 1 μL onto the bacterial lawn, and the plates were incubated overnight at 25°C. Phage plaques were counted, and the EOP relative to the control was calculated. EOP calculation: Single colonies of Escherichia coli strain BL21 and BL21 (containing a defense system) were inoculated into 10 ml LB liquid medium and cultured at 37 °C and 180 rpm in a shaker until the logarithmic growth phase (OD50). 600=0.6). Mix 5 mL of semi-solid culture medium, an appropriate amount of the above recombinant bacterial suspension, IPTG, and Kan evenly, and pour onto the lower solid agar plate (containing Kan). Incubate at room temperature for 1–2 h. Remove the laboratory-preserved phage T4 from the refrigerator and store it on ice. After the double-layer agar plate culture is complete, add 1 μL of different phages (appropriate concentrations) to the upper plate, invert, and incubate overnight at 25 °C. Calculate the number of plaques per μL in the control and experimental groups. EOP = Number of plaques per μL in the control group / Number of plaques per μL in the experimental group. The higher the EOP, the stronger the resistance of the defense system to this phage.

[0030] The method for preparing Escherichia coli bacteriophage according to this invention is as follows: 100 μL of the phage stock solution stored at 4°C is mixed thoroughly with 10 mL of logarithmic-phase Escherichia coli BL21 bacterial suspension and incubated overnight at 37°C and 200 rpm. The clarified bacterial suspension sample is collected, centrifuged at 5000 rpm for 15 min to remove cells adsorbed by the phage, and the supernatant is filtered through a 0.22 μm sterile microporous membrane for sterilization. This filtrate is the phage lysis buffer.

[0031] The phage titer verification steps are as follows: Phages of a certain titer are added to the logarithmic growth phase (OD) culture medium of gene knockout *E. coli*. 600 In a solution of 0.6, after incubation at 37 ℃ and 80 rpm for 15 min on a shaker, the sample was collected and centrifuged at 5000 rpm for 15 min to remove cells adsorbed by the phage. The supernatant was filtered through a 0.22 μm sterile microporous membrane for sterilization. The titer of unadsorbed phage was determined by a bilayer plate titration method. The number of adsorbed phages was determined based on the ratio between the initial titer and the test titer. Data were obtained from three replicate experiments. (Titer = potency, phage potency (PFU / mL) = average number of plaques × dilution factor × 10).

[0032] The double-layer plate method of this invention involves serially diluting the filtered phage supernatant with sterile water at a ratio of 10:1. -1 Up to 10 -3 The phage was diluted using a gradient. Next, 100 μL of the diluted phage solution was added to 400 μL of logarithmic-phase *E. coli* BL21 suspension and mixed thoroughly. The mixture was then added to 5 mL of semi-solid LB medium incubated at 45°C, mixed again, and carefully poured onto solid LB plates, avoiding air bubbles. The plates were laid flat and allowed to solidify, then incubated overnight at 37°C. The growth of plaques was observed, with three replicates for each dilution. The number of plaques was counted, and the phage titer was calculated.

[0033] The culture media involved in the following examples are as follows: LBG medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, glucose 1 g / L.

[0034] MSY medium: (NH4)2SO4 1 g / L, MgSO4 0.2 g / L, Na2HPO4 3.8 g / L, KH2PO4 1.5 g / L, yeast extract 5 g / L, glucose 20 g / L.

[0035] LB liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L. LB solid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 15 g / L. LB semi-solid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 5 g / L.

[0036] 2-YT medium contains: 16 g / L peptone, 10 g / L yeast extract, and 5 g / L NaCl.

[0037] Example 1: Obtaining a resistant strain MG1655(DE3) by knocking out the phage receptor gene ΔfhuAΔompA E.Coli MG1655(DE3) ΔfhuAΔompA Construction and knockout of resistant strains E.Coli On the MG1655(DE3) genome (NCBI ID: NC_000913.3) fhuA (Gene ID: 944856) ompA (Gene ID:945571) gene.

[0038] The construction method is described in the patent application text with publication number CN 120665784 A; the specific steps are as follows: 1. Constructing pGRB plasmids for expressing sgRNA Searching for genes on the website ompA , fhuA The target sequence, ompA Target sequence 1: AGCCTGACCTTCCGGTTTCA; ompA Target sequence 2: CTCGTCTGGGTGGCATGGTA; fhuA Target sequence 1: CATTCATGGTGCTGTTGTGG; fhuA Target sequence 2: TGATGCCGGACGCGACTCTA.

[0039] The following primers were designed based on the cloning sites of the pGRB plasmid: Pgrb1- fhuA -F:CATTCATGGTGCTGTTTGTGGgttttagagctagaaatagc; fhuA Target sequence 1 primer: Pgrb1- fhuA -R: actagtattatacctaggact CCACAACAGCACCATGAATG; Pgrb2- fhuA -F: TGATGCCGGACGCGACTCTAgttttagagctagaaatagc; fhuA Target sequence 2 primer: Pgrb2- fhuA -R: TAGAGTCGCGTCCGGCATCAactagtattatacctaggact; ompA Target sequence 1 primer: Pgrb1- ompA -F: AGCCTGACCTTCCGGTTTCAgttttagagctagaaatagcaagtta;Pgrb1- ompA -R: gacagctagctcagtcctaggtataatactagtAGCCTGACCTTCCGGTTTTCA; ompA Target sequence 2 primer: Pgrb2- ​ -F: CTCGTCTGGGTGGCATGGTAgttttagagctagaaatagcaagtt; Pgrb2 ​ -R: gacagctagctcagtcctaggtataatactagtCTCGTCTGGGTGGCATGGTA; The primer pairs were annealed to form double-stranded DNA fragments using methods such as annealing extension or Gibson assembly, and then ligated into linearized pGRB plasmids to construct pGRB plasmids that can be used to express sgRNA.

[0040] 2. The upstream and downstream 500 bp fragments were amplified by fusion PCR and ligated to form homologous arms. (1) Obtaining the fhuA homologous arm fragment Primers were designed using the Escherichia coli MG1655(DE3) genome as a template: ​ -LH-F:GTTTCACTGAAACGTGTTCATAGACTCCT; ​ -LH-R:TGAAGTCATAATCATTTCAGTAGAAAAACC; ​-RH-F: CTGAAATGATTATGACTTCAGCATAAAGTCAAAAGCCTCCGA; ​ -RH-R: TTCTCCTCAGGAAAATCATAGTAGCAT; the left homologous arm (LH) was obtained by amplification. ​ LH and right homologous arm (RH) ​ RH; Will ​ LH and ​ RH fragment mixing, to ​ LH, ​ RH was used as the template, and primers were employed: ​ -LH-F:GTTTCACTGAAACGTGTTCATAGACTCCT; ​ -RH-R: TTCTCCTCAGGAAAATCATAGTAGCAT, using fusion PCR to connect LH and RH to amplify the complete fhuA homologous arm fragment.

[0041] (2) ​ Obtaining homologous arm fragments Primers were designed using the Escherichia coli MG1655(DE3) genome as a template: ​ -LH-F:TTCACCAGCGGCCCGACG; ​ -RH-F :TTCGATATCAATCGAGAGTTATTAACCCTCTGTTATATGCCTTTTATTTGC; ​ -RH-R:TTGTGAAATAGTTAACAAGCGTTATAGTTTTTCTGTGG; ​ -LH-R: TCTCGATTGATATCGAACAAAGGGC; the left homologous arm (LH) was obtained by amplification. ​ LH and right homologous arm (RH) ​ RH; will ​ LH and ​ RH fragment mixing, to ​ LH, ​ RH as template, primers: ​ -LH-F:TTCACCAGCGGCCCGACG; ​ -RH-R: TTTGTGAAATAGTTAACAAGCGTTATAGTTTTTCTGTGG, using fusion PCR to ligate LH and RH, amplifying the complete... ​ Homologous arm fragment.

[0042] 3. Construction of knockout strains (1) First, after streaking the frozen Escherichia coli MG1655(DE3), it was incubated in a 37 ℃ incubator for 8-10 hours until single colonies were observed. Then, the single colonies were inoculated into 10 mL of liquid LB medium and incubated overnight at 37 ℃ and 200 rpm. Next, the cultured E. coli solution was taken out and transferred to 50 mL of liquid LB medium and incubated in a shaker at 37 ℃. About 1 mL of the bacterial solution was taken in a clean bench and the wavelength was detected using a UV spectrophotometer. When the OD 600 When the bacterial culture medium for *E. coli* shows a pH of approximately 0.6–0.8, place it on ice for 30 minutes. Add 1 mL of bacterial culture to a pre-chilled 1.5 mL EP tube. Set the centrifuge speed to 6000 rpm and the centrifugation time to 5 min. After low-temperature centrifugation, pour off the supernatant in a clean bench, retaining the bacterial sludge. Add 1 mL of 10% glycerol solution (pre-chilled) to the 1.5 mL EP tube containing the bacterial sludge, gently mix well, and centrifuge at 6000 rpm for 5 min. Pour off the supernatant, repeating 2–3 times. Finally, add 800 μL of pre-chilled glycerol solution to the bacterial sludge, mix well, and store at -80 °C.

[0043] (2) 200 ng pCas9 plasmid was introduced into the thawed electrocompetent cells MG1655(DE3) obtained in step (1), 1 ml LB medium was added, and the cells were incubated at 30 ℃ and 200 rpm for 1.5 h. After centrifugation, the bacterial culture was spread onto SPE resistant plates and incubated overnight at 30 ℃. Single colonies were subjected to colony PCR, and the correct positive transformants were selected to obtain MG1655(DE3)(pCas9).

[0044] (3) First, after streaking the *E. coli* MG1655(DE3) (pCas9) strain obtained in step (2), incubate it overnight in a 30°C incubator until single colonies are observed. Then, inoculate the single colony into 10 mL of liquid LB medium and incubate overnight at 30°C and 200 rpm. Next, take out the cultured *E. coli* solution, transfer it to 50 mL of liquid LB medium, and continue incubation in a shaker at 30°C. Take about 1 mL of the bacterial solution in a clean bench and detect the wavelength using a UV spectrophotometer. When OD... 600When the bacterial growth rate was around 0.6-0.8, IPTG was added to the LB medium containing *E. coli* for induction for 1.5 h. The bacterial culture was collected in 50 mL EP tubes. The centrifuge was set to 6000 rpm for 5 minutes. The bacterial culture was resuspended in pre-chilled 10% glycerol and centrifuged at 6000 rpm for 5 minutes, repeated twice. Finally, 800 μL of pre-chilled glycerol solution was added to the bacterial sludge and mixed well. 200 ng of the homologous arm obtained in step 2 and 100 ng of the pGRB plasmid obtained in step 1 were added, and the mixture was electroporated into the host bacterium MG1655(DE3) / (pCas9). 1 mL of LB medium was added and the mixture was incubated at 30 °C and 200 rpm for 1.5 h. After centrifugation, the bacterial culture was spread onto SPE and AMP plates and incubated overnight at 30 °C.

[0045] Single colony using primers ​ - LH-F / RH-R and ​ Colony PCR was performed using LH-F / RH-R, and the correct positive transformants were selected.

[0046] 4. Plasmid removal: The *E. coli* positive transformants containing pGRB and pCas9 plasmids obtained in step 3 were inoculated into LB medium with L-arabinose and SPE added. After culturing for 14-16 hours, streaking was performed. Single colonies were selected and streaked onto AMP and SPE plates. Only strains growing on SPE-resistant plates showed successful pGRB plasmid loss. Single colonies with successful pGRB plasmid loss were inoculated into LB liquid medium and incubated overnight at 42°C. Using the same method, the isolated single colonies were streaked onto SPE-resistant and non-resistant LB plates. Only strains growing on non-resistant plates showed successful pCas9 plasmid loss, indicating recombinant strains that eliminated both pGRB and pCas9.

[0047] Through the above steps, we obtained the knockout gene. ​ Genes and ​ Escherichia coli MG1655(DE3) ​ ​ .

[0048] 5. Verification of phage resistance in gene knockout strains The engineered Escherichia coli MG1655(DE3) strain with its gene plasmid successfully knocked out was then used. ​ , ​ Single colonies of MG1655(DE3) were picked and cultured in LB liquid medium at 37 °C and 180 rpm on a shaker until the logarithmic growth phase (OD2). 600=0.6). Mix 5 mL of LB semi-solid medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 5 g / L agar) with 0.5 mL of the above recombinant bacterial solution and pour it onto the lower solid agar plate. Incubate at room temperature for 1.5 h.

[0049] The T1, T7, vB_EcoM_P251, vB_EcoM_P255, T4, JNUWH1, and JNUWD phages stored in the laboratory were removed from the refrigerator and stored on ice. After double-layer agar plate culture was completed, 1 μL of each phage (appropriate concentration 10) was added to each plate. -4 ~10 -8 The sample was dropped onto the upper plate and incubated upside down at 37°C overnight. Resistance was verified by observing the appearance of plaques. Results are as follows... ​ As shown.

[0050] The results showed that the gene knockout strain MG1655(DE3) was effective. ​ It successfully resisted bacteriophages T1, T7, vB_EcoM_P251, and vB_EcoM_P255. However, it was not resistant to T4 bacteriophage, JNUWH1 bacteriophage, and JNUWD bacteriophage.

[0051] because ​ and ​ The genes are phage receptor genes. By knocking out these two receptor genes, resistance to adsorption of T1, T7, vB_EcoM_P251, and vB_EcoM_P255 phages was achieved.

[0052] Example 2: Construction and assembly of antiphage plasmids for the defense system I. Gene selection: Bacteriophage T4 resistance employs a defense mechanism against bacteriophages: ​ and ​ Target gene acquisition: The shedu gene was obtained from Bacillus cereus strain B4264, and the septu gene was obtained from Bacillus thuringiensis HD12. These two defense systems were then constructed as pET28a-shedu and pacycDuet-septu, respectively.

[0053] Shedu sequences (NCBI serial numbers: CP001176.1, sequences 954837 to 957049): Septu sequences (NCBI ID: CP089521.1, sequences 2993073 to 2996156): The resistance to bacteriophages JNUWH1 and JNUWD employs defense mechanisms against these phages: Gabija and KEL. Target gene acquisition: The Gabija gene was obtained from Bacillus cereus strain VD045, and KELShedu was obtained from Escherichia coli and directionally evolved into the KELM mutant. This defense system was then used to construct pET28a-Gabija and primers were designed.

[0054] Gabija gene (SEQ ID NO.1) II. Obtaining the KELM mutant (1) Identifying mutation sites - phage stress completes directed evolution This experiment employed a random mutagenesis method, using the Controlled Error-prone PCR Kit (BINGENE) to induce low-level mutations (1-2 bases / 1000bp) in the KELShedu gene. Error-prone PCR was performed on the target gene to amplify it (controlling the generation of 1-3 mutant bases). Single colonies were selected after transformation and cultured in 96-well plates for 4 h. 200 μL of LB broth (0.1 mM IPTG) was added at a 0.5% inoculum, and the culture was maintained at 25°C until OD595 reached 0.2. Phages JNUWD and JNUWH1 (MOI=10) were then introduced, and growth was observed after 4 h. OD595 was measured, indicating that the KEL defense system had entered the abortion infection stage, and growth had ceased. OD595 under infection with phages JNUWD (MOI=10) and JNUWH1 (MOI=10) was measured, and the mutant strains with the best growth advantage were selected for sequencing; the mutation site P91Q was identified.

[0055] (2) Compared to KELShedu, one mutant strain maintained an OD595 value above 0.8 under infection by bacteriophages JNUWH1 and JNUWD with an MOI of 10, demonstrating a significant growth advantage. In contrast, the OD595 values ​​of the remaining 199 mutant strains were all below 0.7 when exposed to JNUWH1 and JNUWD. ​ Sequencing revealed that the screened KELM mutant was obtained by mutating the 91st amino acid of KELShedu (wild type) from proline to glutamine.

[0056] The results showed that the mutation site was P91Q; the mutated sequence was named KELM (SEQ ID NO.2).

[0057] The amino acid sequence of KELM (SEQ ID NO.2): mslqllresvqrrkpisfqynkpgkvagerignvhaifimrrksdgvettklhivqtagvtdtapnfpefrtfdievisnvvilenepdfqidekykpesdfyqnviakvmslshshligsdgvndlmlnisglntqekniedisacffahcsntgaprftcklsiqslqllhkylssysvisddssastgrfvevkdnhneiisilehadnnslvmalqhlvsnkltnndintilgrkeslseyehmlehpenhtepdwqrffernewifgyglkykflkilqreahisktdlnggndviadflmsdsrftkivelktpttklftkrqgrsdtwflsseitdavsqilaqkanweiesqtrnytaegnliheetfdaeciliigslssiegsdkeklikrktlelyrrnlknidilfydellersryivrsaeiiedklasslnlp The primers involved are as follows: pET28a-shedu-F: agcaaatgggtcgcggatccatgtatatgacc, pET28a-shedu-R: ttaaaattatttaaaagcttgcggccgcactcgagc; pACYCDuet-septu-F: actttaagaaggagatataccatgggcagcagccatca, pACYCDuet-septu-R: cacgccccagcattaatttaaaagcttgcg;pET28a-Gabija-F: atgaatattctgatagataaagtacgtatatctggg,pET28a-Gabija-R: agcaaaaatcccgatttgtcagtgaaatagaataa; pET28a-KELM-F: agcaaatgggtcgcggatccatgagtctacaattattgagggaatcagtacaacg; pET28a-KELM-R: tcgagtgcggccgcaagcttttatggcagattcaaagagctcgcc.

[0058] III. Phage Resistance Test 1. Construction of recombinant strains (1) Construction of recombinant plasmids The shedu gene, Gabija gene, KELShedu, and KELM were respectively ligated to the BamHI and HindIII restriction sites of the pET28a gene; pET28a-shedu, pET28a-Gabija, pET28a-KELShedu, and pET28a-KELM were prepared respectively. The septu gene was ligated to the NdeI and KpnI restriction sites of the pACYCDuet gene to prepare pACYCDuet-septu; Construction of plasmids encoding the defense system: AZENTA (Suzhou, China) synthesized the genes encoding the defense system and ligated the DNA products into the pET-28a plasmid digested with BamHI and HindIII (pACYCDuet plasmid digested with NdeI and KpnI). The defense system genes include: Shedu (positions 954837 to 957049 of CP001176.1), Septu (positions 2993073 to 2996156 of CP089521.1), Gabija (positions 3383223 to 3386956 of CP000800.1), KELShedu, and KELM.

[0059] Recombinant plasmids were prepared as follows: pET28a-shedu, pET28a-Gabija, pACYCDuet-septu, pET28a-KELShedu, and pET28a-KELM.

[0060] (2) Preparation of chemically competent Escherichia coli: First, streaked the cryopreserved *E. coli* BL21 and incubate at 37 °C for 8–10 hours until single colonies are observed. Then, inoculate each single colony into 10 mL of liquid LB medium and incubate overnight at 37 °C with a shaker at 200 rpm. Next, transfer the incubated LB medium to 50 mL of liquid LB medium and continue incubation at 37 °C with a shaker. In a sterile environment, aspirate approximately 1 mL of the bacterial culture and measure the wavelength using a UV spectrophotometer. When the OD... 600 When the pH value is approximately 0.6–0.8, place the cultured LB medium on ice for 30 minutes. Finally, following the instructions of the Dalian Bao Company's competent cell preparation kit, perform the procedure in a sterile laminar flow hood, and store the prepared E. coli competent cells at -80 °C for use.

[0061] Recombinant plasmids (pET28a-shedu, pET28a-Gabija, pACYCDuet-septu, pET28a-KELShedu, pET28a-KELM) were introduced using a chemicompetent cell transformation method: First, competent cells stored on ice were removed from the freezer and the prepared competent cells were used. Next, approximately 2–10 μL of the recombinant plasmid was added to an EP tube containing competent cells, gently pipetted, and then the EP tube was immediately placed on ice for 0.5 hours. Subsequently, the EP tube was heated in a 42°C water bath for 90 seconds, removed, and cooled on ice for 2 minutes. Finally, 800 μL of liquid LB medium was added, and the cells were cultured at 37°C and 180 rpm for 1–2 hours to ensure that the competent cells could recover and express the exogenous gene.

[0062] (3) Verification of positive transformants After centrifugation, the recombinant bacteria prepared above and revived were placed in a clean bench. The bacterial slurry was gently mixed with a small amount of liquid at the bottom of an EP tube using a pipette, and then spread onto antibiotic-resistant plates. The plates were incubated overnight at 37°C. Single colonies were picked from the antibiotic-resistant plates and verified as positive transformants using PCR with the corresponding primers. The primers for verifying pET28a-shedu and pACYCDuet-septu were: T7: TAATACGACTCACTATAGGGT7-TERM: GCTAGTATTGCTCAGCGG; (4) Plasmid extraction The *E. coli* culture obtained in step (3) was inoculated into 10 mL of liquid LB medium and cultured overnight at 37 °C and 200 rpm on a shaker. 2 mL of the culture was used to extract plasmids pET28a-shedu, pET28a-Gabija, pET28a-KELShedu, pET28a-KELM, and pACYCDuet-septu using a TRAN plasmid extraction kit.

[0063] Meanwhile, recombinant strains were prepared: BL21 / pET28a-shedu, BL21 / pET28a-Gabija, BL21 / pET28a-KELShedu, BL21 / pET28a-KELM and BL21 / pACYCDuet-septu.

[0064] (5) Transforming competent Escherichia coli strains into dual-defense system resistant strains Using the chemical competent cell transformation method, recombinant plasmids (pET28a-shedu and pACYCDuet-septu were introduced into Escherichia coli BL21 to prepare BL21 / pET28a-shedu+pACYCDuet-septu; 2. Phage resistance test (1) Single colonies of the prepared engineered bacteria BL21 / pET28a-shedu, BL21 / pACYCDuet-septu, and BL21 / pET28a-shedu+pACYCDuet-septu were picked and cultured in LB liquid medium (containing antibiotics) at 37 ℃ and 180 rpm in a shaker until the logarithmic growth phase (OD200). 600 =0.6). Inoculate 0.5 mL of the recombinant bacterial culture into 5 mL of LB semi-solid medium, add 5 μL of 0.1 M IPTG and mix well. Pour the mixture onto the lower solid agar plate and incubate at room temperature for 1–2 h.

[0065] Following the phage resistance verification method for gene knockout strains in Example 1, laboratory-preserved phage T4 was removed from the refrigerator and stored on ice. After double-layer agar plate culture was completed, 1 μL of different phages was added to the upper plate, and the plates were incubated upside down at 25 °C overnight. The strength of resistance to phage T4 was measured by calculating the EOP of the defense system.

[0066] The results are as follows ​ As shown, the EOP of the defense system was calculated separately; the results showed: EOP(BL21 / pET28a-shedu): 2; EOP(BL21 / pACYCDuet-septu): 1.7; EOP(BL21 / pET28a-shedu+ pACYCDuet-septu): 1000; therefore, the combined dual defense system can effectively resist the infection of bacteriophage T4.

[0067] It can be seen that through overexpression ​ and ​ This gene can enable E. coli to effectively resist infection by bacteriophage T4, and experimental verification has shown that overexpression of this gene... ​ and ​ Genes can enable E. coli to effectively resist infection by bacteriophages vB_EcoM_P251 and vB_EcoM_P255.

[0068] (2) Following the method in step 5 of Example 1, the phage resistance of BL21 / pET28a-Gabija and BL21 / pET28a-KELM strains was tested, and the strength of resistance to phages was measured by the EOP of the defense system. The results show that ( ​ ): 1) Effect of BL21 / pET28a- Gabija: EOP(T1) is 10 3 EOP(T7) is 10 2 EOP(JNUIWH1) is 10 3 EOP(JNUWD) is 10 3 It is evident that Gabija can effectively resist infection by bacteriophages JNUWH1 and JNUWD.

[0069] 2) Effect of BL21 / pET28a-KELM: EOP(T1) is 10 2 EOP(T7) is 10 3 EOP(JNUIWH1) is 10 4 EOP(JNUWD) is 10 3It is evident that KELM can effectively resist infection by bacteriophages JNUWH1 and JNUWD.

[0070] It is evident that overexpression of Gabija and KELM can enable Escherichia coli to effectively resist infection by bacteriophages T1, T7, JNUWH1, and JNUWD.

[0071] (3) Detect according to step 5 of Example 1. ​ BL21(DE3), BL21 / pET28a- Gabija (can be named: ​ BL21(DE3)-Gabija), BL21 / pET28a-KELM (can be named: ​ BL21(DE3)-KELM), BL21 / pET28a-KELShedu (can be named: ​ BL21(DE3)-KEL strain phage resistance to JNUWH1 and JNUWD.

[0072] The results show: The EOP results from KELShedu, KELM, and Gabija for phages JNUWH1 and JNUWD indicate that KELM and Gabija can provide 10 for both phages JNUWH1 and JNUWD. 3 The above EOPs all have significantly better resistance than KELShedu. ​ ).

[0073] In summary, KELM and Gabija provide sufficient resistance against infection by bacteriophages JNUWH1 and JNUWD.

[0074] Example 3: Construction of antiphage E. coli chassis cells based on antiphage defense mechanism system MG1655(DE3) ​ -ylbE-J23100 ​ / yghX-J23100Septu ​ Build of -J23100Gabija / ybcv-J23119KELM: exist ​ MG1655(DE3) ​ The ylbE site on the genome (Gene ID: 4056025) integrates a gene overexpressed via promoter J23100. ​ On the genome ​ The site (Gene ID: 2847694) integrates Septu overexpressed via promoter J23100, on the genome. ​The site (Gene ID: 948241) integrates Gabija overexpressed via promoter J23100; on the genome ​ The specific steps for integrating KELM overexpressed with promoter J23119 at the site (Gene ID: 945178) are as follows: 1. Designing sgrna: Finding target sequences and constructing pcrEG plasmids Select genes ​ ,Gene ​ and genes ​ and ​ Integration site; ​ Target sequence: ACCGGCTTCTCGCAGGAGCAGGC; ​ Target sequence: ACACGGCGGAGAGCGTCTGTATT; ​ Target sequence: GCCAGACTGTGACAAGGTGATCA; ​ Target sequence: TCTTGATTTCAACCTATCATAGG; Primers were designed using the Escherichia coli MG1655(DE3) genome as a template: ​ -LH-F:aactgaggagtgcaacgatgcc; ​ -RH-R: cgtgaattaacgtctgcaaacacaaccc; ​ -LH-F:atagcaatgttgctggttttgatggcc; ​ -RH-R: gatgcgccatttaccacacatttattatggt; ​ -LH-F: ATGAAAAAAGCGCGTCTGGGTAAAG; ​ -RH-R:GGTTTCTTTCTGGTAAGTGTCAGCC; ​ -LH-F: CTGGGTTTCTGTTTTAACAACATTTTCTGCG; ​ --RH-R:TATGGTGATCAGTCAACCACCAGGGAATAATC; Constructing plasmid pcrEG- ​ pcrEG- ​ pcrEG- ​ and pcrEG- ​ .

[0075] 2. PCR amplifies upstream and downstream 500bp fragments and ligates them to the gene to form homologous arms; PCR is used to fuse the upstream and downstream gene fragments with the integrated gene fragment to form homologous arms; promoter sequence: Starter J23100: TT ​ CTAGCTCAGTCCTAGGTA ​ Starter J23119: TT ​ CTAGCTCAGTCCTAGGTA ​

[0076] 3. Escherichia coli MG1655(DE3) ​ Construction of / Cpf1 Competent cells were prepared according to the method in Example 1: Escherichia coli MG1655(DE3). ​ ; 200 ng of Cpf1 plasmid was electroporated and introduced into competent MG1655(DE3) cells. ​ Add 1 ml of LB medium and incubate at 37 °C and 200 r / min for 1.5 h. Centrifuge the bacterial culture, spread it onto a Kans plate, and incubate overnight at 37 °C. Perform colony PCR on single colonies and select the correct positive transformants.

[0077] 4. Gene integration steps First, the frozen E. coli MG1655(DE3) was... ​ After streaking the / Cpf1 strain, it was incubated overnight at 37 °C until single colonies were observed. Then, single colonies were inoculated into 10 mL of liquid LB medium and incubated at 37 °C and 200 r·min. -1 Incubate overnight. Next, transfer the cultured *E. coli* culture to 50 mL of liquid LB medium and continue incubation in a shaker at 37°C. In a clean bench, take approximately 1 mL of the culture and measure the wavelength using a UV spectrophotometer. When the OD... 600When the bacterial growth rate was around 0.6-0.8, L-arabinose was added to the LB medium used to culture *E. coli* for 1.5 h to induce growth. The bacterial culture was collected in 50 mL EP tubes. A refrigerated centrifuge was set to 6000 rpm for 5 minutes. The bacterial culture was resuspended in pre-chilled 10% glycerol and centrifuged at 6000 rpm for 5 minutes, repeated twice. Then, 800 μL of pre-chilled glycerol solution was added to the bacterial slurry and mixed well. 2000 ng of homologous arm and 500 ng of pcrEG plasmid were added, and the culture was transformed into host bacteria via electroporation. 1 mL of LB medium was added, and the culture was incubated at 30 °C and 200 rpm for 1.5 h. The culture was then centrifuged, and the bacterial culture was plated on KAN and SPE plates with double antibiotics and incubated overnight at 37 °C. Single colonies were analyzed using primers. ​ -LH-F / RH-R、 ​ -LH-F / RH-R、 ​ -LH-F / RH-R and ​ Colony PCR was performed using -LH-F / RH-R, and the correct positive transformants were selected.

[0078] Plasmid removal: E. coli positive transformants containing pcrEG and Cpf1 plasmids were inoculated into LB medium supplemented with rhamnose and KAN and cultured for 14-16 hours. Single colonies were then streaked onto SPE and KAN plates. Only strains growing on SPE-resistant plates showed successful pcrEG plasmid loss. Single colonies with successful pcrEG plasmid loss were inoculated into LB liquid medium supplemented with sucrose and glucose and cultured overnight at 37°C. Using the same method, the isolated single colonies were streaked onto KAN-resistant and non-resistant LB plates. Only strains growing on the non-resistant plates showed successful cpf1 plasmid loss, indicating recombinant strains that eliminated both pcrEG and Cpf1 plasmids. A dual-defense system against phage-resistant E. coli was constructed: MG1655(DE3). ​ -ylbE-J23100 ​ / yghX-J23100Septu ​ - J23100Gabija / ybcv-J23119KELM.

[0079] 5. Phage resistance verification Following the method in step 5 of Example 1, MG1655(DE3) and MG1655(DE3) were detected. ​ -ylbE-J23100 ​ / yghX-J23100Septu ​ - Phage resistance of strain J23100Gabija / ybcv-J23119KELM; because ​ and ​ The genes are phage receptor genes. Knocking out these two receptor genes achieved resistance to adsorption by T1, T7, vB_EcoM_P251, and vB_EcoM_P255 phages. Furthermore, experimental verification confirmed that the resulting recombinant strain MG1655(DE3) ​ -ylbE-J23100 ​ / yghX-J23100Septu ​ -J23100Gabija / ybcv-J23119KELM is effectively resistant to infection by T1, T7, vB_EcoM_P251, and vB_EcoM_P255 bacteriophages. Therefore, ​ The figure only shows the effect of resisting infection by bacteriophages T4, JNUWH1, and JNUWD.

[0080] The results showed that E. coli basal disc cells MG1655(DE3) ​ - ​ -J23100shedu / ​ -J23100Septu / ​ - J23100Gabija effectively resists infection by phages T1, T7, vB_EcoM_P251, vB_EcoM_P255, JNUWH1, and JNUWD, achieving the goal of broad-spectrum antiphage protection.

[0081] Example 4: Construction of Riboflavin-resistant Escherichia coli Chassis Cells for Fermentation Production Knock out genes lacI (Gene ID: 945007), pfkA (Gene ID: 948412), and edd-eda. The edd-eda sequence is as follows: ​ Targeting primers: F:cttaatgggcccgctaacagcgcgatttgctggtgacccaatgcgaccagat; R:cttaatgggcccgctaacagcgcgatttgctggtgacccaatgcgaccagat; lacI-LH-F:gagcgagtaaca acccgtcgg;lacI-LH-R:cttaatgggcccgctaacagcgcgatttgctggtgacccaatgcgaccagat;lacI-RH-F:attcaccaccctgaattgactctcttcc;lacI-RH-R:cgggcgacgtttgccg; 1. The primer sequences involved are as follows: pfkA targeting sequence: TTCACTGCGCTGAGCACCGTTGT; ​ Target sequence: TCATCGATCATCTTACCGATCGG; ​ Target sequence: AGCGCCAGGTAGTCACGGTAGTT; Construct plasmid pcrEG- ​ pcrEG- ​ .

[0082] 2. PCR amplifies upstream and downstream 500bp fragments and ligates them to the gene to form homologous arms. The primer sequences involved are as follows: ​ -LH-F:gcgcgttacgcatggga; ​ -RH-R:caggtaaacaagcgacgtcggtaa; ​ and ​ -LH-F: catttctgtgcaccagtaggtcatc; ​ and ​ -RH-R: tctgaatagctcagatccagcttggt.

[0083] Fusion PCR is used to connect upstream and downstream gene fragments and the gene fragment to be integrated to form homologous arms.

[0084] 3. Escherichia coli MG1655(DE3) ​ - ​ -J23100shedu / ​ -J23100Septu / ​ - J23100Gabija / Cpf1 build Competent cells were prepared according to the method in Example 1: Escherichia coli MG1655(DE3). ​ - ​ -J23100shedu / ​ -J23100Septu / ​ - J23100Gabija / ybcv-J23119KELM; 200 ng of Cpf1 plasmid was electroporated and introduced into competent cells. 1 ml of LB medium was added, and the cells were incubated at 37 °C and 200 rpm for 1.5 h. The bacterial culture was then centrifuged, spread onto a Kans plate, and incubated overnight at 37 °C. Single colonies were subjected to colony PCR, and correctly identified positive transformants were selected.

[0085] 4. Gene knockout steps First, the cryopreserved *E. coli* / Cpf1 strain prepared in step 3 was isolated and streaked, then incubated overnight at 37 °C until single colonies were observed. Next, the single colonies were inoculated into 10 mL of liquid LB medium and incubated overnight at 37 °C and 200 rpm. Then, the cultured *E. coli* solution was transferred to 50 mL of liquid LB medium and incubated further in a shaker at 37 °C. Approximately 1 mL of the culture was aspirated in a clean bench and the wavelength was measured using a UV spectrophotometer. When the OD... 600 When the pH value was around 0.6-0.8, L-arabinose was added to the LB medium used to culture *E. coli* for 1.5 h to induce incubation. The bacterial culture was collected in 50 mL EP tubes. A refrigerated centrifuge was set to 6000 rpm for 5 minutes. The bacterial culture was resuspended in pre-chilled 10% glycerol and centrifuged at 6000 rpm for 5 minutes, repeated twice. Then, 800 μL of pre-chilled glycerol solution was added to the bacterial slurry and mixed well. 2000 ng of homologous arm and 500 ng of pcrEG plasmid were added, and the culture was transformed into host bacteria via electroporation. 1 mL of LB medium was added, and the culture was incubated at 30 °C and 200 rpm for 1.5 h. The culture was then centrifuged, and the bacterial culture was plated on KAN and SPE plates with double antibiotics and incubated overnight at 37 °C. Single colonies were analyzed using primers. ​ -LH-F / RH-R、 edd and eda Colony PCR was performed using -LH-F / RH-R, and the correct positive transformants were selected.

[0086] Plasmid removal: E. coli positive transformants containing pcrEG and Cpf1 plasmids were inoculated into LB medium supplemented with rhamnose and KAN and cultured for 14-16 hours. Single colonies were then streaked onto SPE and KAN plates. Only strains growing on SPE-resistant plates showed successful pcrEG plasmid loss. Single colonies with successful pcrEG plasmid loss were inoculated into LB liquid medium supplemented with sucrose and glucose and cultured overnight at 37°C. Using the same method, the isolated single colonies were streaked onto KAN-resistant and non-resistant LB plates. Only strains growing on the non-resistant plates showed successful cpf1 plasmid loss, indicating recombinant strains that eliminated both pcrEG and Cpf1 plasmids.

[0087] MG1655(DE3) was prepared. ΔlacIΔfhuAΔompA - ylbE -J23100shedu / yghX -J23100Septu / glmS - J23100Gabija Δ pfkA Δ edd Δ EDA (named EF-7-PRE) Similarly, the gene knockout strain was constructed using the experimental method: MG1655(DE3). ΔlacIΔ pfkA Δ edd Δ EDA (named EF-7) Example 5: Fermentation Production of Riboflavin Antiphage Escherichia coli Chassis Cells and its Application 1. Shake-flask fermentation culture: The strain was inoculated from an agar plate into a 250 mL culture flask containing 30 mL of LBG medium and cultured at 37 ℃ and 220 rpm for 12 hours to obtain a seed culture. The seed culture was then inoculated at a rate of 15% (v / v) into a 250 mL shake flask containing 50 mL of MSY medium. Fermentation was carried out at 37℃ and 200 rpm for 48 hours. During this period, cocktail phage MIX1 (a mixture of T1, T7, JNUWH1 and JNUWD, with MOI controlled at 0.05) and MIX2 (a mixture of P251, P255 and T4, with MOI controlled at 0.05) were added at 0 h and 12 h of fermentation to simulate phage contamination. There were four experimental groups in total: Group 1: Cocktail phage MIX1 was added at 0 h of fermentation; Group 2: Cocktail phage MIX1 was added at 12 h of fermentation; Group 3: Cocktail phage MIX2 was added at 0 h of fermentation; Group 4: Cocktail phage MIX2 was added at 12 h of fermentation.

[0088] The results show: (1) First, patch analysis was performed on strains EF-7 and EF-7-PRE, and it was found that EF-7 remained highly sensitive to phages T1, T7, P251, P255, JNYWH1, JNUWD and T4. Figure 8 As mentioned in section A), the fermentation process was severely affected by phage contamination, which prevented the fermentation from continuing. However, strain EF-7-PRE resisted the high-titer phage infection.

[0089] (2) Since strain EF-7 could not survive after the addition of bacteriophage, in subsequent experiments, strain EF-7 was fermented without the addition of bacteriophage as a control. At the same time, in order to test the resistance of strain EF-7-PRE to bacteriophage, the fermentation experiment of EF-7-PRE without the addition of bacteriophage was used as a blank control. The specific results are as follows: 1) Growth status ( Figure 8 (B in the text) a. The growth of EF-7-PRE in the absence of phage contamination was not significantly different from that of EF-7 (without phage contamination); b. Adding cocktail phages MIX1 (a mixture of T1, T7, JNUWH1, and JNUWD, with MOI controlled at 0.05) and MIX2 (a mixture of P251, P255, and T4, with MOI controlled at 0.05) to EF-7-PRE at 0 h and 12 h of fermentation, respectively, to simulate phage contamination during fermentation, the results showed that: In the early stage of fermentation (0h when phage was added), EF-7-PRE showed a decline in growth rate when infected by cocktail phages MIX1 and MIX2, but no cell lysis occurred. In the middle stage of fermentation (12h when phage was added), EF-7-PRE also showed a certain degree of decline in growth rate when infected by cocktail phages MIX1 and MIX2, especially when infected by cocktail phage MIX2, but it maintained normal growth without cell lysis.

[0090] 2) Strain OD 600 and riboflavin production ( Figure 8 (C in the middle) a. After 48 hours of shake-flask fermentation, the OD of the strain... 600 Compared with riboflavin production, EF-7-PRE, after 48 hours of shake-flask fermentation without phage contamination, ultimately showed a higher OD. 600 The riboflavin production was not significantly different from that of EF-7 (which was not contaminated with bacteriophages), with both production levels remaining above 1030 mg / L. b. EF-7-PRE's OD rate at 48 hours in response to infection by cocktail phages MIX1 and MIX2. 600Compared to EF-7-PRE without phage infection, there was a slight decrease, but the final riboflavin production was minimally affected, remaining at 1020 mg / L or above. 2. To further evaluate potential industrial applications, riboflavin was produced by fed-batch fermentation of EF-7-PRE strain in a 5 L bioreactor.

[0091] The strain was inoculated from an agar plate into a 250 mL culture flask containing 30 mL of LBG medium and cultured at 37 °C and 220 rpm for 12 hours to obtain a primary seed culture. This primary seed culture was then inoculated at a rate of 15% (v / v) into a 500 mL shake flask containing 150 mL of MSY (10 g / L glucose) and fermented at 37 °C and 200 rpm for 12 hours. 300 mL of the secondary seed inoculum was transferred to a 5 L bioreactor containing 1.7 L of MSY medium (20 g / L glucose). Fermentation was carried out at 37 °C, with the pH maintained at 7 using 50% NH3·H2O (v / v). The stirring speed and aeration rate were adjusted during fermentation to maintain a dissolved oxygen level of approximately 30%. After the initial glucose was depleted, the residual glucose concentration was maintained at approximately 2 g / L. Analytical methods: Cell density and riboflavin titer were determined by measuring absorbance at 600 nm and 444 nm using a UV spectrophotometer. Residual sugars were detected using a biosensor analyzer (SBA-40E, Shandong, China). Results showed: Fermentation curves of EF-7-PRE showed that as fermentation progressed, the cell biomass of strain EF-7-PRE increased dramatically, reaching 34.4 OD600 at 24 h, before entering a stationary growth phase. Riboflavin production increased rapidly between 11 and 37 h, reaching a maximum titer of 10.17 g / L at 51 h. Figure 8 (D in the middle).

[0092] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A KELM mutant, characterized in that, The amino acid sequence of the KELM mutant is shown in SEQ ID NO.

2.

2. The application of the Gabija gene and / or the KELM mutant of claim 1 in enhancing the phage resistance of Escherichia coli, characterized in that, The nucleotide sequence of Gabija is shown in SEQ ID NO.1; Preferably, the bacteriophage includes T1 bacteriophage, T7 bacteriophage, JNUWH1 bacteriophage, and JNUWD bacteriophage; Preferably, the Escherichia coli includes Escherichia coli MG1655(DE3) and Escherichia coli BL21.

3. A recombinant Escherichia coli resistant to bacteriophages, characterized in that, The recombinant Escherichia coli expressed the KELM mutant of claim 1 and / or the Gabija gene with the nucleotide sequence shown in SEQ ID NO. 1; Preferably, the Escherichia coli includes Escherichia coli MG1655(DE3) and Escherichia coli BL21; Preferably, the bacteriophage includes T1 bacteriophage, T7 bacteriophage, JNUWH1 bacteriophage, and JNUWD bacteriophage.

4. A recombinant Escherichia coli resistant to bacteriophages, characterized in that, The recombinant E. coli is a strain with the genome knocked out. fhuA Gene, ompA The gene, along with the shedu gene from Bacillus cereus, the septu gene from Bacillus thuringiensis, the KELM mutant as described in claim 1, and the Gabija gene shown in SEQ ID NO. 1, are integrated into the genome.

5. The recombinant Escherichia coli according to claim 4, characterized in that, The fhuA The gene's Gene ID: 944856, described ompA The gene's Gene ID is 945571, the NCBI number of the shedu gene is 954837 to 957049 in CP001176.1, and the NCBI number of the septu gene is 2993073 to 2996156 in CP089521.

1. Preferably, the shedu gene is integrated at the ylbE site on the E. coli genome. yghx The site integrates the septu gene, located on the E. coli genome. glmS The site integrates the Gabija gene, located on the E. coli genome. ybcv The site integrates the KELM mutant; Preferably, the Gene ID of the ylbE site is 4056025. yghx The gene ID of the locus is 2847694. glmS The gene ID of the locus is 948241. ybcv Gene ID of the locus: 945178; Preferably, the bacteriophage includes T1 bacteriophage, T7 bacteriophage, T4 bacteriophage, JNUWH1 bacteriophage, JNUWD bacteriophage, vB_EcoM_P251 bacteriophage, and vB_EcoM_P255 bacteriophage; Preferably, the Escherichia coli includes Escherichia coli MG1655(DE3).

6. A genetically engineered bacterium capable of resisting high riboflavin production by bacteriophages, characterized in that, The *E. coli* is a recombinant *E. coli* as described in claim 4 or 5, with the lacI gene, pfkA gene, and edd-eda gene knocked out from its genome; Preferably, the lacI gene has a Gene ID of 945007, the pfkA gene has a Gene ID of 948412, and the edd-eda gene sequence is from position 1031585 to 1034719 of Sequence ID AP027457.

1.

7. A method for improving the ability of Escherichia coli to resist bacteriophages, characterized in that, The method involves modifying Escherichia coli in at least one of the following ways: (1) Overexpression of the KELM mutant as described in claim 1; (2) Overexpression of the Gabija gene with the nucleotide sequence shown in SEQ ID NO.

1.

8. The method according to claim 7, characterized in that, The modification also includes: knocking out genes fhuA Gene, ompA The gene integrates the shedu gene from Bacillus cereus and the septu gene from Bacillus thuringiensis into the genome; Preferably, the fhuA The gene's Gene ID is 944856. ompA The gene's Gene ID is 945571, the NCBI number of the shedu gene is 954837 to 957049 in CP001176.1, and the NCBI number of the septu gene is 2993073 to 2996156 in CP089521.

1. Preferably, the shedu gene is integrated at the ylbE site on the E. coli genome. yghx The site integrates the septu gene, located on the E. coli genome. glmS The site integrates the Gabija gene, located on the E. coli genome. ybcv The site integrates the KELM mutant; Preferably, the Gene ID of the ylbE site is 4056025. yghx The gene ID of the locus is 2847694. glmS The gene ID of the locus is 948241. ybcv Gene ID of the locus: 945178; Preferably, the bacteriophage includes T1 bacteriophage, T7 bacteriophage, T4 bacteriophage, JNUWH1 bacteriophage, JNUWD bacteriophage, vB_EcoM_P251 bacteriophage, and vB_EcoM_P255 bacteriophage; Preferably, the Escherichia coli includes Escherichia coli MG1655(DE3).

9. A method for preparing riboflavin, characterized in that, The method involves preparing riboflavin through fermentation using the genetically engineered bacteria described in claim 6. The strain was inoculated into the culture medium and cultured at 36-37 °C and 200-220 rpm for 10-12 hours to prepare a primary seed culture. The prepared primary seed culture was inoculated into the culture medium at an inoculation rate of 12-15% by volume and cultured at 36-37 °C and 200-220 rpm for 10-12 hours to prepare a secondary seed culture. The prepared secondary seed inoculum was transferred to a fermentation medium and fermented at 37-38°C, with the pH maintained at 7.0 and the dissolved oxygen level kept at 30% for at least 30 hours.

10. The use of the recombinant Escherichia coli as a chassis cell in the preparation of fermentation products according to claim 4 or 5.

Citation Information

Patent Citations

  • Anti-bacteriophage escherichia coli based on laboratory adaptive evolution and anti-bacteriophage defense mechanism system

    CN120665784A