A non-invasive thyroid cancer detection kit and its application method
The nucleic acid aptamer TCA-1, screened using CELL-SELEX technology, is used for the diagnosis of thyroid cancer. This solves the problems of false negative risk and treatment resistance in existing technologies, achieving high specificity and high sensitivity in the detection of thyroid cancer, simplifying the operation and reducing costs.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-03
- Publication Date
- 2026-03-24
AI Technical Summary
Current technologies for thyroid cancer diagnosis have the risk of false negatives, targeted drugs are prone to drug resistance and significant side effects, and molecular markers lack specificity, making it impossible to accurately guide individualized treatment.
The CELL-SELEX technology was used to screen for the highly specific and high-affinity nucleic acid aptamer TCA-1, which is used for the identification of thyroid cancer cells. It has strong binding force and sensitive detection. The aptamer sequence is 5'-AATGACGGGAGGACCTGTTCGATGTCGTATAACTTTATAG-3', which can be radiolabeled, fluorescently labeled or biotinylated, to prepare a non-invasive diagnostic kit for thyroid cancer.
It achieves specific recognition of thyroid cancer cells, reduces the risk of false negatives, improves the accuracy and sensitivity of detection, simplifies the operation process, reduces synthesis costs, and is free from cytotoxicity and immunogenicity.
Smart Images

Figure CN120665876B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, and in particular relates to a non-invasive diagnostic kit for thyroid cancer and its application method. Background Technology
[0002] Thyroid cancer is the most common malignant tumor of the endocrine system worldwide, and its incidence has increased significantly in the past decade (an average annual increase of about 5%). Although the prognosis of early-stage differentiated thyroid cancer (such as papillary carcinoma) is relatively good, there are still no effective treatments for advanced, recurrent, and undifferentiated carcinomas. Current diagnostic and treatment technologies have the following limitations: Diagnosis: Ultrasound and fine-needle aspiration biopsy (FNA) have a false negative risk (about 10-15%) and cannot distinguish between benign and malignant follicular lesions; Treatment: Targeted drugs (such as sorafenib and lenvatinib) are prone to drug resistance and have significant side effects; Molecular markers: Traditional markers (such as Tg and TSH) lack specificity and cannot accurately guide individualized treatment.
[0003] Nucleic acid aptamers are a type of ligand system evolution technology that utilizes exponential enrichment in vitro.
[0004] The Evolution of Ligands by Exponential Enrichment (SELEX) refers to single-stranded DNA or RNA that binds highly specifically to target molecules, obtained through multiple rounds of screening from random single-stranded nucleic acid sequence libraries. Nucleic acid aptamers are relatively stable compared to protein antibodies, and their preparation process is relatively easy, with no batch-to-batch variability. When nucleic acid aptamers bind to their targets, they mainly rely on intermolecular forces such as hydrogen bonding, van der Waals forces, electrostatic interactions, and hydrophobic interactions to form stable secondary structures, such as hairpin, stem-loop, and G4 structures. The bases forming these structures are usually key sites affecting binding activity.
[0005] The method of screening nucleic acid aptamers by targeting cells is called CELL-SELEX. Its basic principle is to bind target cells to an in vitro synthetic oligonucleotide library, introduce normal cells to remove non-specifically binding oligonucleotides, and use PCR technology to expand the capacity of oligonucleotide molecules binding to target cells. After several or even a dozen rounds of repeated screening and enrichment processes, highly specific and high-affinity nucleic acid aptamers are obtained. Cell-SELEX technology typically utilizes the identification of subtle molecular differences on the cell membranes of positively selected cells (cancer cells) and negatively selected cells (normal cells) to obtain nucleic acid aptamers that can efficiently distinguish between cancer cells and normal cells. Further characterization of these nucleic acid aptamers and identification of target molecules helps in the discovery of new tumor biomarkers for tumor diagnosis and treatment. Throughout the CELL-SELEX process, all molecules expressed by the cells are in their natural folded state, reflecting a state closer to physiological conditions, thus enhancing the success rate of in vivo application of nucleic acid aptamers. Summary of the Invention
[0006] The first aspect of this invention is to provide a novel nucleic acid aptamer with high affinity and high specificity for thyroid cancer cells. This aptamer is simple to prepare, low in cost, exhibits good selectivity for thyroid cancer cells, strong binding affinity, high detection sensitivity, and a simple and accurate detection process.
[0007] A nucleic acid aptamer for detecting thyroid cancer, with the sequence 5'-AATGACGGGAGGACCTGTTCGATGTCGTATAACTTTATAG-3' (SEQ NO.1), or with primer sequences added to both ends of this sequence, preferably 5'-AGCAGCACAGAGGTCAGATG AATGACGGGAGGACCTGTTCGATGTCGTATAACTTTATAGCCTATGCGTGCTACCGTGAA-3' (SEQ NO.2), named TCA-1.
[0008] The nucleic acid aptamer TCA-1 used to detect thyroid cancer was tested at 25°C with 1.0 mM Na. + 0.5mM Mg 2+ Under certain conditions, it possesses a unique stem-ring structure, the structural formula of which is as follows:
[0009]
[0010] ΔG = -4.00 kcal / mol
[0011] The preferred thyroid cancer cells are one or more of TPC-1, BTH-231, TSHRO-4, TSHRO-1, TPO-5, and TPO-6.
[0012] It is worth mentioning that the secondary structure of this invention is only a predicted structure. The prediction results may vary slightly in different prediction software. Therefore, as long as the nucleic acid aptamer sequence is the same as that of this invention, regardless of the secondary structure, it should be considered to fall within the protection scope of this invention.
[0013] Similarly, any sequence that has a sequence similarity of more than 90% to the nucleic acid aptamer of the present invention and can have the same or very similar applications as the nucleic acid aptamer of the present invention, even if there may be modifications to individual bases, should also be considered to fall within the protection scope of the present invention.
[0014] Preferably, the nucleic acid library and primers used in the screening of the above-mentioned nucleic acid aptamers are designed as follows:
[0015] Random nucleic acid library (SEQ ID NO:3): 5'-FAM-AGCAGCACAGAGGTCAGATG-[N40]-CCTATGCGTGCTACCGTGAA-3'
[0016] Upstream primer (SEQ ID NO:4): 5'-fluorescein isothiocyanate-AGCAGCACAGAGGTCAGATG-3'
[0017] Downstream primer (SEQ ID NO:5): 5'-Biotin-CCTATGCGTGCTACCGTGAA-3'.
[0018] Where N represents any random base of A, T, C, or G.
[0019] Another aspect of the present invention provides a nucleic acid aptamer for detecting thyroid cancer, wherein the sequence is modified or altered at one or both ends, including by radiolabeling, linking to therapeutic drugs, fluorescent labeling or biotin labeling, to obtain a nucleic acid aptamer derivative having the same ability to bind to thyroid cancer cells as the nucleic acid aptamer.
[0020] Another aspect of the present invention is to provide a non-invasive diagnostic kit for thyroid cancer, the kit comprising the aforementioned aptamer and commonly used reagents for detection.
[0021] Another aspect of the present invention is to provide the application of the above-mentioned aptamer or kit, wherein the nucleic acid aptamer is used in the preparation of various preparations for the diagnosis and treatment of thyroid cancer and related tumor cells and tissues.
[0022] The drugs used to treat thyroid disorders include one or more of the following: thyroid hormones, glucocorticoids, beta-blockers, and antithyroid drugs.
[0023] It can be applied to the detection of related malignant tumors, including human thyroid cancer, and to the preparation of related therapeutic drugs. Detection applications include, but are not limited to, the identification of specific cell lines, the preparation of tumor markers, the preparation of detection kits, and imaging examinations.
[0024] Compared with existing technologies, the advantages of this invention are as follows: The nucleic acid aptamer for human thyroid cancer cells described in this invention has a unique stem-loop structure, and flow cytometry analysis revealed that it exhibits high binding affinity and specificity, specifically recognizing thyroid cancer cells while not recognizing normal thyroid cells or most other solid tumor cells. The screened nucleic acid aptamers can be further truncated and optimized, resulting in smaller molecular weights, reduced synthesis costs, improved affinity, ease of modification, no cytotoxicity, strong binding specificity, no immunogenicity, and high stability.
[0025] The present invention provides a simple and rapid method for cell detection of related tumor diseases and preparation of therapeutic drugs and test kits. Attached Figure Description
[0026] Figure 1 CELL-SELEX screening process for nucleic acid aptamers for thyroid cancer.
[0027] Figure 2 The secondary structure of TCA-1.
[0028] Figure 3 The dissociation constant (Kd) of TCA-1 and TPC-1.
[0029] Figure 4 The binding specificity of TCA-1 to TPC-1, where ** indicates P<0.01. Detailed Implementation
[0030] The following detailed and complete description, in conjunction with embodiments, of the nucleic acid aptamer for simultaneously recognizing multiple malignant tumor cells, specifically thyroid cancer cells, and its applications. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the invention.
[0031] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments are all commercially available.
[0032] Example 1: Screening for nucleic acid aptamers to identify thyroid glands
[0033] 1. Design of the nucleic acid library and primers used:
[0034] Random nucleic acid library (SEQ ID NO:3): 5'-FAM-AGCAGCACAGAGGTCAGATG-[N40]-CCTATGCGTGCTACCGTGAA-3'
[0035] Upstream primer (SEQ ID NO:4): 5'-fluorescein isothiocyanate-AGCAGCACAGAGGTCAGATG-3'
[0036] Downstream primer (SEQ ID NO:5): 5'-Biotin-CCTATGCGTGCTACCGTGAA-3'.
[0037] Where N represents any random base of A, T, C, or G.
[0038] 2. Screening process:
[0039] This invention uses human thyroid cancer cells TPC-1 as the positive screening target and normal thyroid cells Nthy-ori3-1 as the negative screening target.
[0040] 2.1 Positive screening:
[0041] a. Incubation: Dissolve the above random DNA library in binding buffer, denature at 95°C for 5 min, anneal on ice for 10 min, and then co-incubate with pretreated human thyroid cancer cells with a confluence of about 90% after 24 h of culture at 4°C for 1 h.
[0042] b. Separation: Remove the supernatant after incubation, wash the incubated cells several times with washing buffer, then scrape the washed cells with sterile water and centrifuge tube, denature at 95℃ for 10 min, anneal on ice for 10 min, centrifuge at 5500 rpm for 3 min, and aspirate the supernatant to obtain the first round of screening nucleic acid library for TPC-1 cells.
[0043] c. PCR amplification of the library: Using the library obtained in step b as a template and the primers mentioned above as primers, the amplification conditions were: 95℃, 30s; 55.9℃, 30s; 72℃, 30s for 8 cycles, followed by 72℃, 5min. Preliminary amplification products were obtained, and then, using these products as templates, amplification was performed for a suitable number of cycles for large-scale amplification.
[0044] d DNA single-strand preparation: The antisense strand of the biotin-labeled PCR amplification product from step c was separated using streptavidin-modified agarose beads, and then the DNA double strand was denatured with 0.2M NaOH. The positive sense DNA single-strand library labeled with fluorescein isothiocyanate was collected by desalting.
[0045] 2.2 Reverse screening: The DNA single-stranded library obtained in step d is incubated with reverse screening cells Nthy-ori3-1. The supernatant after incubation is collected to exclude non-specifically bound nucleic acid molecules. The collected supernatant can be incubated with forward screening cells for the next screening step.
[0046] 2.3 Screening process cycle: Repeat the screening processes in 2.1 and 2.2 until a nucleic acid aptamer library with strong binding to TPC-1 in target cells is found. This process needs to be repeated several to more than ten times.
[0047] 2.4 High-throughput sequencing: The final round of screening, using the library with the largest binding affinity, underwent high-throughput sequencing. The binding affinity of the obtained sequences to TPC-1 cells was analyzed by flow cytometry to determine the aptamers. Fluorescence detection was performed using flow cytometry, with the initial randomized DNA library serving as a control. The 13th round of screening products reached maximum enrichment and did not bind to thyroid cells.
[0048] The sequence of the obtained specific aptamer TCA-1 is shown below (SEQ ID NO:2): 5'-AGCAGCACAGAGGTCAGATG AATGACGGGAGGACCTGTTCGATGTCGTATAACTTTATAGCCTATGCGTGCTACCGTGAA-3'.
[0049] Its secondary structure is as follows Figure 2 As shown.
[0050] Example 2
[0051] Cy5-labeled aptamer TCA-1 was prepared into binding solutions with final concentrations of 500 nM, 400 nM, 300 nM, 250 nM, 200 nM, 100 nM, 50 nM, 25 nM, 12.5 nM, 6.25 nM, 3.125 nM, 1.565 nM, 0.785 nM, 0.395 nM, and 0.195 nM, respectively. These solutions were incubated with 500,000 target cells at 4°C for 1 hour, followed by washing twice with washing buffer. The fluorescence intensity on the cell surface was detected by flow cytometry. After subtracting the fluorescence intensity of the corresponding random library concentration, the binding and dissociation constants of the aptamer were calculated using the formula Y = BmaxX / (Kd+X). The results are shown below. Figure 3 As shown.
[0052] The binding dissociation constant Kd between TCA-1 and TPC-1 cells is 6.528 nM.
[0053] Example 3: TCA-1 binding specificity to target cells
[0054] Cy5-labeled aptamer TCA-1 was prepared into a binding solution with a final concentration of 250 nM. This solution was then incubated with 500,000 cells of thyroid cancer cell line TPC-1, breast cancer cell line MDA-MB-453, gastric cancer cell line MGC803, lung cancer cell line A549, rectal cancer cell line HCT116, and ovarian cancer cell line A-1847 at 37°C for 1 hour. The cells were then washed twice with washing buffer, and the fluorescence intensity on the cell surface was detected by flow cytometry. The binding strength with each cell type was found to be as follows: Figure 4 As shown.
[0055] The binding affinity of the TCA-1 aptamer of this invention to the thyroid cancer cell line TPC-1 was significantly different compared to other cancer cell lines (P<0.01). This indicates that the TCA-1 aptamer has strong specificity in recognizing thyroid cancer cell lines. It holds promise for applications in kits for the specific detection of thyroid cancer, including but not limited to the identification of specific cell lines, the preparation of tumor markers, the preparation of detection kits, and imaging examinations.
[0056] It can also be used in combination with commonly used drugs or antibodies for the treatment of thyroid cancer to prepare targeted therapeutic drugs, and can also be used to find cancer target molecules to carry out research on the mechanism of the disease and targeted diagnosis and treatment of related tumor diseases.
[0057] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.
Claims
1. A nucleic acid aptamer for specifically detecting thyroid cancer, characterized in that, The aptamer sequence is shown as SEQ ID NO:
2.
2. The aptamer of claim 1, wherein, The upstream primer for amplifying the nucleic acid aptamer is shown as SEQ ID NO: 4, and the downstream primer is shown as SEQ ID NO:
5.
3. The nucleic acid aptamer for detecting thyroid cancer according to any one of claims 1-2, wherein, The nucleic acid aptamer sequence is modified by radio labeling, fluorescence labeling or biotin labeling at both ends or one end.
4. A kit for non-invasive detection of thyroid cancer, characterized by, The kit comprises the nucleic acid aptamer according to any one of claims 1-3.
5. Use of the nucleic acid aptamer according to any one of claims 1-3 or the kit according to claim 4 in the preparation of a preparation for detecting or diagnosing thyroid cancer.