Application of PRR5 gene in regulating early flowering under high temperature in soybean
By knocking out the soybean PRR5a and PRR5b genes using CRISPR/Cas9 gene editing technology, a PRR5a prr5b double mutant was constructed, which solved the problem of early flowering in soybeans under high temperatures and achieved the effect of not advancing the flowering time under high temperatures, thus promoting the development of soybean breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-20
- Publication Date
- 2026-04-14
AI Technical Summary
Currently, no gene has been identified that regulates early flowering in soybeans due to high temperatures, which causes the flowering time of soybeans to be affected by high temperature stress, increasing the difficulty of production management.
Using CRISPR/Cas9 gene editing technology, specific gRNA sequences were designed to knock out the soybean PRR5a and PRR5b genes, constructing a PRR5a prr5b double mutant. This mutant was then transferred into soybeans via Agrobacterium-mediated transformation to delay flowering time under high temperatures.
The successful delay of soybean flowering time under high temperature conditions, bringing it to the same level as under normal temperature conditions, relieved the impact of high temperature stress on flowering time, provided new ideas and biological materials for soybean production management, and promoted the development of the breeding industry.
Smart Images

Figure CN120665931B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering, and in particular to the application of the PRR5 gene in regulating early flowering of soybean under high temperature. Background Technology
[0002] Global warming poses a serious threat to plant growth and crop production. Soybean (Glycine max), an important crop, is extremely sensitive to temperature changes in its flowering time. Under high temperatures, soybeans accelerate flowering to quickly complete their reproductive cycle, thus escaping heat stress. Taking Guangdong Province as an example, the province experiences eight months of the year with an average daily maximum temperature greater than or equal to 25°C. Except for extreme weather events, months with an average daily maximum temperature reaching 35°C are rare. This means that temperatures around 30°C are a longer-lasting climatic condition in South China compared to extreme temperatures above 35°C. The flowering time of soybeans determines the plant's transition from vegetative growth to reproductive growth. Fluctuations in flowering time with temperature changes inevitably increase the burden on soybean production management. Therefore, studying the 30°C-mediated mechanism of early flowering in soybeans is crucial for soybean production in Guangdong.
[0003] Regarding the earlier flowering time in plants due to high temperatures, studies in Arabidopsis thaliana have shown that phytochrome B (phyB) acts as a heat sensor in plant thermomorphogenesis. High temperatures promote the conversion of phyB from the active Pfr form to the inactive Pr form, thereby relieving the inhibition of the Phytochrome-Interacting Factor 4 (PIF4) transcription factor and accelerating plant thermomorphogenesis. Furthermore, PIF4 promotes FT transcriptional activation by improving chromatin accessibility at the FT promoter, thus affecting flowering time. However, no genes playing a role in early flowering under high temperatures in soybean have been identified, and there are no reports on how to regulate the flowering time of soybean under high-temperature conditions.
[0004] Therefore, there is an urgent need to provide a method for regulating early flowering of soybeans under high temperatures, so that the flowering time of soybeans is not affected by high temperature stress, so as to facilitate the production management of soybeans under high temperature. Summary of the Invention
[0005] The purpose of this invention is to provide the application of the PRR5 gene in regulating early flowering of soybean under high temperature, so as to solve the problems existing in the prior art. This invention provides new ideas, technical means and biological materials for changing early flowering of soybean under high temperature and enhancing soybean production management. It has broad application prospects in the research of soybean response to high temperature stress and high-yield breeding, and helps to promote the development of the soybean breeding industry.
[0006] To achieve the above objectives, the present invention provides the following solution:
[0007] This invention provides an application of soybean PRR5 protein in any of the following:
[0008] (1) Application in regulating the flowering time of soybean in response to high temperature stress;
[0009] (2) Application in the breeding of soybean varieties that do not flower earlier under high temperature stress;
[0010] The gene encoding the soybean PRR5 protein includes PRR5a as shown in SEQ ID NO.1 and PRR5b as shown in SEQ ID NO.2.
[0011] This invention also provides an application of the PRR5 gene expressing soybean PRR5 protein in any of the following:
[0012] (1) Application in regulating the flowering time of soybean in response to high temperature stress;
[0013] (2) Application in the breeding of soybean varieties that do not flower earlier under high temperature stress;
[0014] The PRR5 gene consists of PRR5a, as shown in SEQ ID NO.1, and PRR5b, as shown in SEQ ID NO.2.
[0015] Furthermore, knocking out the PRR5 gene in soybeans delayed the flowering time of the soybeans in response to high temperature stress.
[0016] The present invention also provides the application of a knockout vector targeting the above-mentioned PRR5 gene in any of the following:
[0017] (1) Application in regulating the flowering time of soybean in response to high temperature stress;
[0018] (2) Application in the cultivation of soybean varieties that do not flower earlier under high temperature stress.
[0019] The present invention also provides the use of engineered bacteria comprising the above-described knockout vector in any of the following:
[0020] (1) Application in regulating the flowering time of soybean in response to high temperature stress;
[0021] (2) Application in the cultivation of soybean varieties that do not flower earlier under high temperature stress.
[0022] The present invention also provides a method for delaying the flowering time of soybean in response to high temperature stress, including the step of knocking out the PRR5 gene in soybean;
[0023] The PRR5 gene consists of PRR5a, as shown in SEQ ID NO.1, and PRR5b, as shown in SEQ ID NO.2.
[0024] Furthermore, the knockout of the PRR5 gene in soybean includes the following steps: constructing knockout vectors using PRR5a and PRR5b as target sites, respectively;
[0025] The knockout vector was transferred into soybean using Agrobacterium-mediated transformation to obtain a double mutant that knocks out both PRR5a and PRR5b, thus completing the knockout of the PRR5 gene.
[0026] The present invention also provides a method for cultivating soybeans that do not flower prematurely under high temperature stress, including the step of knocking out the PRR5 gene in soybeans;
[0027] The PRR5 gene consists of PRR5a, as shown in SEQ ID NO.1, and PRR5b, as shown in SEQ ID NO.2.
[0028] Furthermore, the knockout of the PRR5 gene in soybean includes the following steps: constructing knockout vectors using PRR5a and PRR5b as target sites, respectively;
[0029] The knockout vector was transferred into soybean using Agrobacterium-mediated transformation to obtain a double mutant that knocks out both PRR5a and PRR5b, thus completing the knockout of the PRR5 gene.
[0030] The present invention discloses the following technical effects:
[0031] This invention targets the soybean PRR5 gene and utilizes CRISPR technology to construct a double mutant, prr5a prr5b, which simultaneously knocks out the nucleotide sequences of PRR5a (SEQ ID NO. 1) and PRR5b (SEQ ID NO. 2). Experimental results show that the flowering time of this double mutant is consistent at high temperature (30℃) and normal temperature (25℃), indicating that knocking out the PRR5 gene eliminates the response mechanism of early flowering in soybeans under high temperature. This invention provides new ideas, technical means, and biological materials for modifying early flowering in soybeans under high temperature and enhancing soybean production management under high temperature. This invention has broad application prospects in the research and breeding of soybean responses to high temperature stress and will contribute to the development of the soybean breeding industry. Attached Figure Description
[0032] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0033] Figure 1 The figures show the experimental results of flowering time of W82, prr5a, prr5b and prr5a prr5b mutant plants at different temperatures; where A is the observation results of flowering time typology of different plants; B is the statistical results of flowering time of different plants; different letters indicate significant differences through Student's t test (P<0.05); flowering time is expressed as mean ± standard deviation (SD) of four biological replicates. Detailed Implementation
[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0035] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0036] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0037] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0038] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0039] 1) Clear molecular mechanism:
[0040] This invention reveals for the first time the key regulatory roles of PRR5a and PRR5b genes in early flowering of soybean under high temperatures, providing an important molecular basis for understanding the mechanism of flowering time regulation in soybean under high-temperature conditions. Through gene editing technology, the specific functions of PRR5a and PRR5b in high-temperature-induced early flowering were clarified, filling a gap in existing research.
[0041] 2) Highly efficient gene editing technology:
[0042] By designing specific gRNA sequences using CRISPR / Cas9 gene editing technology, double mutants of PRR5a and PRR5b were successfully generated. This technology is highly efficient and specific, enabling precise editing of target genes, avoiding off-target effects, and improving the success rate and reliability of gene editing.
[0043] 3) Precise phenotypic analysis:
[0044] The flowering time variations of the PRR5a and PRR5b double mutants were analyzed in detail through phenotypic observation and flowering time recording under 25℃ and 30℃ conditions. The results showed that the flowering time of the double mutants was unaffected by high temperatures, indicating that PRR5a and PRR5b are key regulatory factors for high-temperature-induced early flowering. This precise phenotypic analysis provides important data support for subsequent breeding and applications.
[0045] 4) Broad application prospects:
[0046] This invention is not only significant in basic research but also has broad application prospects in practical applications. The editing sites of the PRR5a and PRR5b genes can be used to regulate early flowering in soybeans under high temperatures. Furthermore, these gene editing sites can also be applied to the wide adaptability improvement, breeding, and variety improvement of soybeans, providing new methods and ideas for breeding new soybean varieties adapted to different environmental conditions.
[0047] Example 1
[0048] 1. Gene editing
[0049] Using CRISPR / Cas9 gene editing technology, specific guide RNAs (gRNAs) were designed targeting the soybean PRR5a and PRR5b genes to obtain double mutants.
[0050] Specific steps:
[0051] (1) gRNA design
[0052] We selected conserved regions of the PRR5a gene (SEQ ID NO.1) and the PRR5b gene (SEQ ID NO.2) to design specific gRNA sequences. We ensured that the gRNA sequences had high specificity and efficiency, avoiding off-target effects.
[0053] SEQ ID NO.1:
[0054]
[0055] SEQ ID NO.2:
[0056]
[0057] The online tool (CRISPR-PLANT) was used for gRNA design and off-target prediction to select the optimal gRNA sequences, namely gRNA1 (SEQ ID NO.3) that targets the knockout of PRR5a and gRNA2 (SEQ ID NO.4) that targets the knockout of PRR5b.
[0058] SEQ ID NO.3: AAGGAAGATAGTGGTGGAAGTGG;
[0059] SEQ ID NO. 4: CCTGCAGTGTTAATTAACTTCTC.
[0060] (2) Constructing the editing platform
[0061] The designed gRNA sequence was cloned into the CRISPR / Cas9 expression vector (pYLCRISPR / CasPubi-B), and a co-expression vector containing Cas9 and gRNA was constructed using primers.
[0062] GmPRR5-ATU3d-F1: GTCAAGGAAGATAGTGGTGGAAG (SEQ ID NO.5);
[0063] GmPRR5-ATU3d-R1: AAACCTTCCACCACTATCTTCCT (SEQ ID NO.6);
[0064] GmPRR5-ATU3b-F2: GTCATGCTGTTCCTGATGGCTTGA (SEQ ID NO.7);
[0065] GmPRR5-ATU3b-R2: AAACTCAAGCCATCAGGAACAGCA (SEQ ID NO. 8);
[0066] GmPRR5-ATU6-1-F3:ATTGTGAGAGTGTTGCACAACAGA (SEQ ID NO.9);
[0067] GmPRR5-ATU6-1-R3: AAACTCTGTTGTGCAACACTCTCA (SEQ ID NO. 10);
[0068] GmPRR5-ATU6-29-F4: ATTGAGAAGTTAATTAACACTGC (SEQ ID NO. 11);
[0069] GmPRR5-ATU6-29-R4: AAACGCAGTGTTAATTAACTTCT (SEQ ID NO. 12).
[0070] The 35S promoter was selected to drive the expression of Cas9 and gRNA, ensuring efficient expression in soybean plants.
[0071] (3) Genetic transformation
[0072] Using Agrobacterium-mediated transformation, the constructed CRISPR / Cas9 vector was transformed into callus tissue of soybean Williams 82 (hereinafter referred to as W82, which has been published in the literature Wang, Longfei et al. "A telomere-to-telomere gap-free assembly of soybean genome." Molecular plant vol. 16, 11(2023):1711-1714.).
[0073] Transgenic callus tissue was obtained by selecting marker genes to screen for positive transformants.
[0074] (4) Regenerated plants
[0075] The selected positive callus tissues were regenerated and cultured to induce the formation of complete plants.
[0076] The genotype of the mutant was verified by PCR and sequencing to ensure double mutation of the PRR5a and PRR5b genes.
[0077] 2. Phenotypic observation and analysis
[0078] (1) Phenotypic observation
[0079] Mutant plant culture: W82 plants, obtained prr5a or prr5b single mutant plants, and prr5a prr5b double mutant plants were cultured under standard growth conditions (12h light / 12h dark) to ensure consistent environmental conditions.
[0080] Two temperature treatment groups were set up: 25℃ (normal temperature) and 30℃ (high temperature), with 8 plants in each treatment group.
[0081] (2) Record of flowering time
[0082] From the time of sowing, observe the growth of the plants every day and record the flowering time (based on the opening of the first flower).
[0083] Record the flowering time of all plants in each treatment group and calculate the average flowering time.
[0084] (3) Observation results
[0085] The flowering time of the prr5a and prr5b double mutant plants was observed at different temperatures, and the results are as follows: Figure 1 As shown, the flowering time of this mutant is about 20 days under both 25℃ and 30℃ conditions, indicating that the flowering time of the double mutant plant is not sensitive to high temperature.
[0086] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. The application of reducing soybean PRR5 protein expression in breeding soybean varieties that do not flower prematurely under high temperature stress, characterized by: The gene encoding the soybean PRR5 protein has a nucleotide sequence as shown in SEQ ID NO.
1. PRR5a And as shown in SEQ ID NO.2 PRR5b composition; The method for reducing the expression level of soybean PRR5 protein includes the following steps: using the... PRR5a and stated PRR5b We constructed a knockout vector targeting the target site. The knockout vector was transferred into soybeans using Agrobacterium-mediated transformation to obtain the knockout vector. PRR5a and knockout PRR5b The double mutant, that is, the complete knockout of the PRR5 protein.
2. Knockout PRR5 The application of genes in breeding soybean varieties that do not flower prematurely under high temperature stress is characterized by, The PRR5 The gene consists of a nucleotide sequence as shown in SEQ ID NO.
1. PRR5a And as shown in SEQ ID NO.2 PRR5b composition; The knockout PRR5 The gene includes the following steps: respectively using the described PRR5a and stated PRR5b We constructed a knockout vector targeting the target site. The knockout vector was transferred into soybeans using Agrobacterium-mediated transformation to obtain the knockout vector. PRR5a and knockout PRR5b The double mutant, that is, the complete knockout of the above. PRR5 Gene.
3. A targeting method as described in claim 2 PRR5 The application of gene knockout vectors in breeding soybean varieties that do not flower prematurely under high temperature stress is characterized by, The knockout vector was transferred into soybeans using Agrobacterium-mediated transformation to obtain the knockout vector. PRR5a and knockout PRR5b The double mutant, that is, the complete knockout of the above. PRR5 Genes were used to obtain soybean varieties that do not flower earlier under high temperature stress.
4. The application of an engineered bacterium containing the knockout vector as described in claim 3 in cultivating soybean varieties whose flowering time is not advanced under high temperature stress, characterized in that, The engineered bacteria were transferred into soybeans to obtain the knockout strain. PRR5a and knockout PRR5b The double mutant, that is, the complete knockout of the above. PRR5 Genes were used to obtain soybean varieties that do not flower earlier under high temperature stress.
5. A method for delaying the flowering time of soybean in response to high temperature stress, characterized in that, Including knockout in soybeans PRR5 The steps of gene generation; The PRR5 The gene consists of a nucleotide sequence as shown in SEQ ID NO.
1. PRR5a And as shown in SEQ ID NO.2 PRR5b composition; The knockout in soybeans PRR5 The gene includes the following steps: respectively using the described PRR5a and stated PRR5b We constructed a knockout vector targeting the target site. The knockout vector was transferred into soybeans using Agrobacterium-mediated transformation to obtain the knockout vector. PRR5a and knockout PRR5b The double mutant, that is, the complete knockout of the above. PRR5 Gene.
6. A method for cultivating soybeans whose flowering time is not advanced under high temperature stress, characterized in that, Including knockout in soybeans PRR5 The steps of gene generation; The PRR5 The gene consists of a nucleotide sequence as shown in SEQ ID NO.
1. PRR5a And as shown in SEQ ID NO.2 PRR5b composition; The knockout in soybeans PRR5 The gene includes the following steps: respectively using the described PRR5a and stated PRR5b We constructed a knockout vector targeting the target site. The knockout vector was transferred into soybeans using Agrobacterium-mediated transformation to obtain the knockout vector. PRR5a and knockout PRR5b The double mutant, that is, the complete knockout of the above. PRR5 Gene.
Citation Information
Patent Citations
Application of coding sites of soybean PRR5a and PRR5b genes in regulation and control of salt tolerance
CN119351459A