Editing system for repairing amyotrophic lateral sclerosis pathogenic mutant gene

By combining the IS621-bridge-RNA system and the AAV9 vector, the mutation of the ALS pathogenic gene SOD1 was efficiently repaired in neuronal cells, the survival of the mouse model was extended, the problem of low recombination efficiency of the CRISPR-Cas9 system in neurons was solved, and a gene therapy method for ALS was provided.

CN120665952APending Publication Date: 2025-09-19THE SECOND HOSPITAL OF HEBEI MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510615869.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-14
Publication Date
2025-09-19

AI Technical Summary

Technical Problem

The existing CRISPR-Cas9 system has extremely low homologous recombination efficiency in differentiated and mature cells such as neurons, making it difficult to effectively repair mutations in amyotrophic lateral sclerosis (ALS)-causing genes such as SOD1.

Method used

The IS621-bridge-RNA gene editing system is used in combination with the adeno-associated virus AAV9 vector. The IS621 recombinase is used in a vector system targeting motor neurons to achieve site-specific recombination and repair of the mutated SOD1 gene. The target gene is site-specifically recombined in prokaryotic cells through the IS621-bridge-RNA system, and precise repair is achieved in eukaryotic cells using the AAV9 vector.

Benefits of technology

It significantly improved the repair efficiency of the mutant SOD1 gene in eukaryotic cells, prolonged the survival of mouse models expressing the mutant SOD1 gene, increased the number of motor neurons, and provided a potential treatment option for neurodegenerative diseases such as ALS.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120665952A_ABST
    Figure CN120665952A_ABST
Patent Text Reader

Abstract

The invention discloses an editing system for repairing amyotrophic lateral sclerosis pathogenic mutant genes, and relates to an IS621-bridge-RNA gene editing system capable of being applied to eukaryotic cells, an AAV9 virus vector mediated IS621-bridge-RNA gene editing system and application of the AAV9 virus vector mediated IS621-bridge-RNA gene editing system, and the IS621-bridge-RNA gene editing system, a recombinant expression vector and a gene therapy mode are included.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to an editing system for repairing amyotrophic lateral sclerosis pathogenic mutation genes. Background Art

[0002] The first generation of gene editing systems, exemplified by the CRISPR-Cas9 system, achieves therapeutic effects by knocking out mutated genes through nonhomologous end joining. In the presence of homologous sequences, homologous recombination can repair mutated genes. However, in differentiated and mature cells, such as neurons, homologous recombination using the CRISPR-Cas9 system is extremely inefficient.

[0003] Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease. As a type of motor neuron disease (ALS / MND), it is the most common adult-onset motor neuron disease. ALS, like Alzheimer's disease and Parkinson's disease, is a common degenerative neurological disease, but its progression and severity are more severe than the other two degenerative diseases. ALS is more common in sporadic cases, accounting for approximately 90% of patients, while familial forms account for approximately 10%.

[0004] Gene mutations are the definitive cause of ALS. Over 50% of patients with familial amyotrophic lateral sclerosis (FALS) have identified pathogenic genes, including C9orf72 (24%), SOD1 (20%), TDP-43 (5%), and FUS (5%). Patients with sporadic amyotrophic lateral sclerosis (SALS) also have mutations in C9orf72 (4%), SOD1 (2%), TDP-43 (1%), and FUS (1%). Gene editing and repair of mutated genes has the potential to fundamentally prevent motor neuron degeneration.

[0005] Mutations in the SOD1 gene cause amyotrophic lateral sclerosis (ALS) in 20% of familial ALS cases and 2% of sporadic ALS cases. The mechanism by which SOD1 mutations cause motor neuron degeneration remains unclear, but may involve oxidative stress, endoplasmic reticulum stress, mitochondrial dysfunction, abnormalities in the proteasome / autophagy pathway, nutritional disorders, and glial cell activation. However, the neurotoxicity of mutant SOD1 is an acquired toxicity and is not related to loss of function following SOD1 mutation.

[0006] Editing the mutant gene in mutant SOD1 transgenic mice requires a vector system capable of targeting motor neurons. Adeno-associated virus-9 (AAV-9) is a low-toxic, low-immunogenic vector that targets motor neurons via axonal retrograde transport and is clinically applicable. In 2012, the European Medicines Agency approved the use of AAV-mediated delivery of an active LPL gene into muscle cells for the treatment of lipoprotein lipase deficiency. Recent clinical trials have demonstrated that AAV-mediated delivery of therapeutic genes can cure or control disease progression in currently untreatable conditions, such as hemophilia and choroideremia.

[0007] Adeno-associated virus (AAV) vectors, as a new class of safe vectors, are increasingly recognized by researchers. A member of the parvoviridae family, they are non-enveloped, linear, single-stranded DNA viruses with a broad host range, capable of infecting both dividing and non-dividing cells and mediating long-term expression of exogenous genes. As a key member of viral vectors, AAV lacks significant cytotoxicity and does not elicit the strong immune response seen with other viral vectors. Furthermore, when constructing recombinant AAV viruses, their coding sequences can be completely deleted, leaving only the 145-bp terminal repeats, effectively reducing the likelihood of recombination and self-protein expression and further improving safety. Therefore, AAV, as an ideal gene therapy vector, is attracting increasing interest and attention. Summary of the Invention

[0008] To address the shortcomings of existing technologies, the present invention provides an IS621-bridge-RNA gene editing system capable of site-specific recombination of target genes in prokaryotic cells. The IS621 recombinase, a member of the IS110 family, binds simultaneously to both the donor and target nucleic acid sequences in the presence of bridge-RNA, achieving genetic recombination of the donor DNA at the target site. This opens the door to precise repair of mutant genes in eukaryotic cells.

[0009] The IS621-bridge-RNA system is used to perform gene editing on the mutant SOD1 gene, repair the mutant SOD1 gene at the DNA level, and eliminate the acquired toxicity of the mutant SOD1.

[0010] The present invention also uses a SOD1-G93A hemizygous transgenic mouse model to study neuromuscular disorders. These transgenic mice express the G93A mutation in the human SOD1 gene at high copy numbers and exhibit a phenotype similar to that of human ALS. Therefore, the SOD1G93A gene expression pattern makes it a uniquely signature animal model for ALS. Therefore, combining the IS621-bridge-RNA system with the AAV9 vector system for targeted motor neuron delivery to edit the mutant gene is a method that can fundamentally address the degeneration of motor neurons caused by gene mutations. It also provides solutions for other diseases related to gene mutations.

[0011] To achieve the above object, the present invention adopts the following technical solutions:

[0012] The first aspect of the present invention provides an IS621-bridge-RNA gene editing system, comprising a CMV promoter nucleotide sequence, a humanized IS621 recombinase nucleotide sequence, an H1 promoter nucleotide sequence, a bridge RNA nucleotide sequence, and a donor nucleotide sequence connected in sequence; wherein the humanized IS621 recombinase nucleotide sequence is as shown in SEQ ID NO: 1

[0013]

[0014] In some embodiments, the humanized IS621 recombinase nucleotide sequence of SEQ ID NO: 1 may also include a cleavage site for ligation and a Kozak sequence to enhance translation. In some embodiments, the humanized IS621 recombinase nucleotide sequence of SEQ ID NO: 1 includes a Knp-1 cleavage site and / or a Kozak sequence at the front end and an Xho1 cleavage site at the back end. In some embodiments, the humanized IS621 recombinase nucleotide sequence of SEQ ID NO: 1 consists of an IS621 sequence, a 3HA sequence, and a polyA sequence.

[0015] In some embodiments, the nucleotide sequence used in nuclear localization of the humanized IS621 recombinase nucleotide sequence is shown in SEQ ID NO: 10, specifically including Knp-1+kozak sequence-IS621-3HA-polyA+Xho1, and the specific sequence is as follows:

[0016]

[0017] Furthermore, the H1 promoter nucleotide sequence is as shown in SEQ ID NO: 2

[0018] (attcgaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcactaggcgggaacacccagcgcgcgtgcgccctggcaggaagatggctgtgagggacaggggagtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataagttctgtatgagaccacagatctccatactg), or a nucleotide sequence different from SEQ ID NO: 2 due to the degeneracy of the genetic code.

[0019] In some embodiments, a splicing site for connection may be added to the front end of the H1 promoter nucleotide sequence, specifically, an Nhel splicing site.

[0020] Furthermore, the bridge RNA nucleotide sequence is prepared by selecting a mutant gene that causes a neurodegenerative disease.

[0021] Furthermore, the neurodegenerative diseases include ALS, Huntington's disease, hereditary spinocerebellar ataxia, spinocerebellar degeneration, Alzheimer's disease, and Parkinson's disease.

[0022] Furthermore, the neurodegenerative disease is ALS.

[0023] Furthermore, when the type of neurodegenerative disease is ALS, the selection of mutant genes includes C9orf72, SOD1, TDP-43, FUS, etc.; other neurodegenerative disease-related pathogenic gene mutations include HTT, CMT, SCA, SPG, ATP7B, SMN1, Dystrophin, etc.

[0024] In some embodiments, the nucleotide sequence used in the bridge RNA needs to specifically correspond to the mutant gene of the neurodegenerative disease to be treated. In some more specific embodiments, the nucleotide sequence used in the bridge RNA is composed of a stem-loop targeting the SOD1 mutant gene of ALS, a stem-loop targeting the Donor, and a central stem-loop.

[0025] Furthermore, the bridge RNA nucleotide sequence is as shown in either SEQ ID NO: 3 or 4, or a nucleotide sequence different from SEQ ID NO: 3 or 4 due to the degeneracy of the genetic code.

[0026] The nucleotide sequence of SEQ ID NO: 3 is as follows:

[0027] AGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTCCAGGACCTTGGGTTCTAACCTGTCGCCGAGATTTATGCAGCGGACTGCCTTTCTCCCAAAGTGATAAACCGGACAGTATCATGGACCGGTTTTCCCGGTAATCCGTATTTACAAGGTTGGTTTC.

[0028] The nucleotide sequence of SEQ ID NO:4 is as follows:

[0029] AGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTGCGTGGCCTTGGGTTCTAACCTGTTCGCTAGATTTATGCAGCGGACTGCCTTTCTCCCAAAGTGATAAACCGGACAGTATCATGGACCGGTTTTCCCGGTAATCCGTATTTACAAGGCTGGTTTC.

[0030] Furthermore, the bridge RNA nucleotide sequence and the donor nucleotide sequence are connected via a terminal nucleotide sequence, and the terminal nucleotide sequence is as shown in SEQ ID NO: 5

[0031] (ttttttggtaccgctgccgctggaggtgctcaaagagatgga).

[0032] In some embodiments, a cleavage site for ligation may be added after the bridge RNA nucleotide sequence, specifically, an Xhol cleavage site.

[0033] Furthermore, the donor nucleotide sequence is as shown in either SEQ ID NO: 6 or 7, or a nucleotide sequence different from SEQ ID NO: 6 or 7 due to the degeneracy of the genetic code.

[0034] A second aspect of the present invention provides a vector comprising the aforementioned IS621-bridge-RNA gene editing system.

[0035] Furthermore, the vector includes a plasmid vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a piggyBac vector or a Sleeping Beauty transposase vector.

[0036] In some specific embodiments of the present invention, the vector is a plasmid or a virus. In some specific embodiments of the present invention, the virus includes but is not limited to adeno-associated virus, lentivirus, adenovirus, herpes simplex virus, rabies virus and related derivatives. More specifically, the virus is adeno-associated virus.

[0037] Furthermore, the adeno-associated viral vector includes ssAAV, scAAV and / or hybrid AAV subtypes.

[0038] Furthermore, the adeno-associated virus vector includes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13.

[0039] Furthermore, the vector adds an ITR nucleotide sequence at the front and / or back end of the aforementioned IS621-bridge-RNA gene editing system, wherein the ITR nucleotide sequence is an adeno-associated virus 2 inverted terminal repeat sequence, and the ITR nucleotide sequence is as shown in SEQ ID NO: 8

[0040] (cctgcaggcagctgcgcgctcgctcgctcactgaggccgcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagaggggagtggccaactccatcactaggggttcctACAGTATCTTGTAT).

[0041] Furthermore, the transcription termination sequence in the humanized IS621 recombinase nucleotide sequence of the IS621-bridge-RNA gene editing system of the vector is a BGH nucleotide sequence, and the BGH nucleotide sequence is shown in SEQ ID NO:9.

[0042] SEQ ID NO: 9 sequence is

[0043] CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTTATGG.

[0044] In some embodiments, the structure of the vector is an AAV9 recombinant expression vector of ITR-CMV promoter-IS621 recombinant protein-BGH poly (A) signal-H1 promoter-bridge RNA-ITR, referred to as AAV9-IS621-bridge RNA. Specifically, it includes ITR (adeno-associated virus 2 inverted terminal repeat sequence), CMV promoter (the cytomegalovirus promoter), IS621, BGH (Bostaurus growth hormone) polyA (polyadenylic acid), H1 promoter, bridge RNA, and ITR (adeno-associated virus 2 inverted terminal repeat sequence).

[0045] Furthermore, the vector is administered by intracerebroventricular and / or intrathecal injection.

[0046] In some embodiments, the vector may also contain other appropriate "regulatory elements" or "regulatory sequences," including, but not limited to, enhancers; transcription factors; transcription terminators; efficient RNA processing signals, such as splicing and polyadenylation signals (polyA); sequences that stabilize cytoplasmic mRNA, such as the woodchuck hepatitis virus (WHV) posttranscriptional regulatory element (WPRE); sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and, if desired, sequences that enhance secretion of the encoded product. In certain embodiments, examples of polyA include SV40, bovine growth hormone (bGH), and TK polyA. In certain embodiments, examples of enhancers include the α-fetoprotein enhancer, the TTR minimal promoter / enhancer, LSP (TH-binding globulin promoter / α1-microglobulin / bikunin enhancer), and other enhancers.

[0047] In some embodiments, the adeno-associated viruses used in the present invention include various types of registered AAV, including but not limited to 13 different serotypes of AAV (i.e., AAV1-AAV13) in primates, among which AAV2, AAV3, and AAV9 are derived from humans themselves. In some embodiments, AAVs of different serotypes can hybridize, and the hybridized AAVs will have the characteristics of both hybrids. Therefore, the adeno-associated viruses used in the present invention also include AAV subtypes after AVV hybridization, including but not limited to rAAV2 / 1 (with tissue affinity to the nervous system (high titer anterograde transsynaptic), muscle, skeletal muscle, myocardium, and smooth muscle), rAAV2 / 2 (with tissue affinity to the retina, nervous system, muscle, liver, and vascular smooth muscle), rAAV2 / 3 (with tissue affinity to muscle, liver, lung, and eye), rAAV2 / 4 (with tissue affinity to the nervous system, muscle, eye, and brain), rAAV2 / 5 (with tissue affinity to the nervous system, lung, retina, liver, and synovial joint), rAAV2 / 6 (with tissue affinity to the nervous system, lung, muscle, and heart), rAAV2 / 7 (with tissue affinity to muscle and liver), rAAV2 / 8 (with tissue affinity to the nervous system, liver, muscle, adipose tissue, pancreas, and retina). Tissue affinity), rAAV2 / 9 (tissue affinity for the nervous system, myocardium, lung, retina, and skin), rAAV2-retro (tissue affinity for the nervous system (retrograde non-transsynaptic)), AAV-PHP.eB (tissue affinity for blood-brain barrier), AAV-PHP.S (tissue affinity for all peripheral nerves), AAV-PAN (tissue affinity for pancreas), AAV-LUNG (tissue affinity for lung), AAV-DJ (tissue affinity for retina, lung, kidney, and cells infected in vitro), AAV-7m8 (has tissue affinity for the retina), AAV-ShH10Y (has tissue affinity for retinal Muller cells), AAV-Rh10 (has tissue affinity for liver, blood, heart, and cells infected in vitro), AAV-Anc80L65 (has tissue affinity for the inner ear, retina, skeletal muscle, and liver), and AAV-SCH9 (has tissue affinity for neural stem cells in the SVZ region).

[0048] A third aspect of the present invention provides the use of the aforementioned IS621-bridge-RNA gene editing system or the aforementioned vector in the preparation of a drug for treating neurodegenerative diseases.

[0049] Furthermore, the neurodegenerative disease is a neurodegenerative disease caused by gene mutation.

[0050] Furthermore, the neurodegenerative diseases caused by the gene mutation include ALS, Huntington's disease, hereditary spinocerebellar ataxia, spinocerebellar degeneration, Alzheimer's disease, and Parkinson's disease.

[0051] In some embodiments, the genetic variation is not limited to neurodegenerative diseases, but also includes diseases caused by single nucleotide polymorphisms, missense mutations, stop mutations, frameshift mutations, insertions and deletions, microsatellites, microsatellite instability, copy number variation, DNA methylation, deletion fusion genes, etc.

[0052] The fourth aspect of the present invention provides a medicine kit, which includes the medicine prepared in the above application.

[0053] In some embodiments, the medicament further comprises a pharmaceutically acceptable additive. Generally, such medicaments use components that do not significantly disrupt the biological properties of the antibody or antigen-binding fragment thereof, such as binding to its specific epitope (e.g., binding to an epitope on the RSV F protein). Each component is pharmaceutically and physiologically acceptable in the sense that it is compatible with the other ingredients and does not harm the patient. The drug can be conventionally presented in unit dosage form and can be prepared by methods well known in the pharmaceutical field, including but not limited to tablets, pills, powders, liquid solutions or suspensions (e.g., including injectable, absorbable and topical preparations (e.g., eye drops, gels or ointments), aerosols (e.g., nasal sprays), liposomes, suppositories, injectable and infusible solutions and sustained-release forms. Pharmaceutically acceptable additives include but are not limited to water, buffers, saline solutions, phosphate buffered saline solutions, various types of wetting agents, sterile solutions, alcohol, gum arabic, vegetable oils, benzyl alcohol, gelatin, glycerol, carbohydrates (e.g., lactose, sucrose, amylose or starch), magnesium stearate, talc, silicic acid, viscous paraffin, aromatics. Sesame oil, fatty acid monoglyceride and diglyceride, pentaerythritol fatty acid ester, hydroxymethyl cellulose, powder, etc. The medicine provided by the present invention may contain other additives, including, for example, antioxidants, preservatives, antimicrobial agents, analgesics, binders, disintegrants, colorants, diluents, excipients, extenders, glidants, solubilizers, stabilizers, tonicity agents, vehicles, thickeners, flavorings, emulsions (such as oil / water emulsions), emulsifying and suspending agents (such as gum arabic, agar, alginic acid, sodium alginate, bentonite, carbomer, carrageenan, carboxymethyl cellulose, cellulose, cholesterol, gelatin, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, methyl cellulose, octoxynol-9 (octoxynol 9), oleyl alcohol, polyvinyl pyrrolidone, propylene glycol monostearate, sodium lauryl sulfate, sorbitan esters, stearyl alcohol, tragacanth gum, xanthan gum and its derivatives), solvents, and various ingredients such as crystalline cellulose, microcrystalline cellulose, citric acid, dextrin, glucose, liquid glucose, lactic acid, lactose, magnesium chloride, potassium metaphosphate, and starch. Such carriers and / or additives can be prepared by conventional methods and administered to a subject at an appropriate dose.

[0054] A fifth aspect of the present invention provides a method for preparing the aforementioned medicine kit, the method comprising:

[0055] The aforementioned IS621-bridge-RNA gene editing system or the aforementioned vector is transformed into a host cell for expression, and the expression product is collected to obtain the active ingredient in the drug kit.

[0056] In a sixth aspect, the present invention provides the use of the humanized IS621 recombinase nucleotide sequence described in SEQ ID NO: 1, the H1 nucleotide sequence shown in SEQ ID NO: 2, and the donor nucleotide sequence shown in SEQ ID NO: 6 or 7 in preparing a eukaryotic cell IS621-bridge-RNA gene editing system with high shearing efficiency and recombination efficiency.

[0057] Furthermore, the eukaryotic cells include human or non-human mammalian cells.

[0058] Furthermore, the eukaryotic cells include humans, monkeys, apes, mice, rats, guinea pigs, rabbits, cows, sheep, pigs, horses, dogs, and cats.

[0059] Advantages and beneficial effects of the present invention:

[0060] The present invention provides an IS621-bridge-RNA gene editing system that can be used in eukaryotic cells, an AAV9 viral vector-mediated IS621-bridge-RNA gene editing system, and its uses, comprising the IS621-bridge-RNA gene editing system, a recombinant expression vector, and a gene therapy approach. Using this gene editing system, the amyotrophic lateral sclerosis (ALS) pathogenic gene SOD1 was successfully repaired, significantly extending the lifespan of model mice expressing a mutant SOD1 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 This is a fluorescence microscopy observation of the m-cherry protein recombination results, where A is the target site and Donor-mcherry sequence; B is the structural prediction model of brige-RNA4 and brige-RNA5; C is the experimental combination; D is the red light expressed by the Donor-mcherry sequence after recombination at the genomic target site.

[0062] Figure 2 Figures 1 and 2 show the results of recombination and expression observed by confocal microscopy. A shows IS621 and mCherry expression observed by confocal microscopy. B and C show the recombination efficiency of the donor-mCherry sequence at the genomic target site (mean ± SE, n = 3, ***P < 0.001). D and F show the collection of mCherry-positive cells and PCR amplification.

[0063] Figure 3Figure 1 shows the improvement in recombination efficiency achieved by different vector donor sequences. A shows optimized vector donor sequences 1-5; B shows combinations of IS621-bridge-RNA with different vector donors; C shows combinations of IS621-bridge-RNA with Donor3 at varying ratios. DE shows the mCherry positivity rate (mean ± SE, n = 3, ***P < 0.001). FH show the collection of mCherry-positive cells and PCR analysis. I shows Sanger sequencing.

[0064] Figure 4 Figures 5 and 6 show the results of confocal microscopy imaging. AB are the evaluation of mCherry and HA double-positive cells (n=3). C is the detection of SOD1 expression in 293FT cells transfected with IbRT4 and IbRT5, respectively. mCherry-positive cells are marked with white dotted lines, and mCherry-negative cells are marked with yellow dotted lines. DE are the analysis of SOD1 expression levels in mCherry-positive and -negative cells (n=10-11, ***P<0.001).

[0065] 0.001).

[0066] Figure 5 Figure 5 is a graph showing the results of fluorescence reporter assays for cleavage efficiency. A shows cleavage of the GFP reporter gene; B shows GFP fluorescence assessed in 293FT cells transfected with the IbRT0-GFP-stop reporter gene, the IbRT4-GFP-stop reporter gene, the IbRT5-GFP-stop reporter gene, and the IbRT8-GFP-stop reporter gene. C shows the percentage of GFP-positive cells in each group (n=3, ***P<0.001). D shows the different targets in the Gaussia-stop reporter gene. EF shows the levels of Gaussia detected in different groups, including the Gaussia-stop (Gaus), Gaus+IS621, Gaus+bridge RNA4, Gaus+IbRT0, Gaus+IbRT4, Gaus+IbRT5, and Gaus+IbRT8 groups (n=3, *P<0.05, **P<0.01, ***P<0.001).

[0067] Figure 6 This figure shows the therapeutic effects of IS621-bridge RNAtarget4 expressed via AAV in SOD1 mutant mice. AB represents the constructs of the AAV expression vector. CD shows the statistical results of the survival and neuron number of the model mice. E shows the targeting results of Donor and T4 targets in the anterior horn of the spinal cord in the model mice as observed by mCherry fluorescence. DETAILED DESCRIPTION

[0068] The present invention will be further described below with reference to specific examples. It should be understood that the specific embodiments described herein are presented by way of example and are not intended to limit the present invention. The main features of the present invention may be applied to various embodiments without departing from the scope of the present invention.

[0069] In an embodiment of the present invention, the IS621-bridge-RNA gene editing system includes a nucleotide sequence encoding a nucleus-localized humanized IS621 recombinase under the CMV promoter, a nucleotide sequence of a bridge-RNA under the H1 promoter, and an optimized donor sequence.

[0070] In an embodiment of the present invention, after IS621-bridge-RNA and donor gene sequences are delivered to neurons using AAV9 viral vectors, IS621-bridge-RNA complexes are formed through transcription, and the mutant gene is repaired in the presence of an optimized donor sequence.

[0071] The AAV9 viral vector provided by the present invention is biologically active and has the potential to become a candidate virus for ALS gene therapy.

[0072] In an embodiment of the present invention, due to the degeneracy of the genetic code, the nucleotide sequence displayed in the present invention is not a unique sequence. On the basis of codon degeneracy, the nucleotide sequence can be presented as a nucleotide sequence with at least 70% homology to the nucleotide sequence displayed in the present invention, and further, a nucleotide sequence with at least 75%, 80%, 85%, 90%, 95% homology.

[0073] Experiments of the present invention demonstrate that the gene recombination efficiency of the designed unoptimized IS621-bridge-RNA system is 1.4-1.6%.

[0074] Experiments in the present invention demonstrate that the designed Donor sequence is optimized. The optimized Donor vector is 5000 bp in size and has a recombination efficiency of up to 13%.

[0075] Experiments of the present invention demonstrate that the gene cutting efficiency of the designed IS621-bridge-RNA system is 24%.

[0076] The recombinant vector was further packaged into AAV virus using a three-plasmid co-transfection method, purified, and concentrated, and its final titer was determined by real-time PCR. AAV type 9 was selected for its superior affinity for neuronal cells. Newborn SOD1G93A transgenic mice were injected intracerebroventricularly with 3E13 vg / ml of AAV9-GFP and AAV9-IS621-bridgeRNA-t4, respectively. Intrathecal injection of AAV9-IrBT4 and AAV9-Donor significantly prolonged the survival of SOD1 G93A model mice by 13 days and increased the number of motor neurons by 1.6-fold. Further tissue staining confirmed expression of the Donor red fluorescent protein in the retained motor neurons, indicating precise insertion into the Target4 position of the mutant SOD1. AAV9-IS621-bridge RNA-t4 is a promising candidate for gene therapy for ALS.

[0077] Example 1: IS621-bridge-RNA system achieves gene recombination in eukaryotic cells

[0078] Two target regions, Target4 and Target5, were selected for SOD1 exon 1, and the fluorescent protein m-cherry ( Figure 1 A); Two Bridge RNAs are formed according to the target region and Donor sequence ( Figure 1 B); establishing IS621 plasmid, donor plasmid, U6-initiated bridge RNA plasmid (divided into U6-bridge RNA sod1-5-terminal as shown in SEQ ID NO: 11, and U6-bridge RNA sod1-4-terminal as shown in SEQ ID NO: 12, both of which use kpn1-XhoI as cleavage sites), H1-initiated bridge RNA plasmid (divided into H1-bridge RNA sod1-4-terminal as shown in SEQ ID NO: 13, and H1-bridge RNA sod1-5-terminal as shown in SEQ ID NO: 14, both of which use NheI-XhoI cleavage sites) ( Figure 1 C). ( Figure 1 D) Ordinary fluorescence microscopy results show that H1-bridge RNA, IS621 plasmid and donor can achieve m-cherry protein recombination in the two target regions Target4 and Target5 of SOD1 exon 1 ( Figure 1D), whereas the bridge RNA plasmid using the U6 promoter could not reconstruct the m-cherry protein. Therefore, it was concluded that the H1 promoter, but not the U6 promoter, could achieve m-cherry protein reconstruction in the two targeting regions of SOD1 exon 1, Target4 and Target5.

[0079] Wherein, the sequence of SEQ ID NO:11 is as follows:

[0080] GGTACCGagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatac gtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatat cttgtggaaaggacgaaacaccgAGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTGCGTGGCCTTGGGTTCTAACCTGTTCGCTAGATTTATGCAGCGGA CTGCCTTTCTCCCAAAGTGATAAACCGGACAGTATCATGGACCGGTTTTCCCGGTAATCCGTATTTACAAGGCTGGTTTCttttttacgcgtgatcctctagaactatagCTCGAG.

[0081] The sequence of SEQ ID NO: 12 is as follows:

[0082] GGTACCGagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgAGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTCCAGGACCTTGGGTTCTAACCTGTCGCCGAGATTTATGCAGCGGACTGCCTTTCTCCCAAAGTGATAAACCGGACAGTATCATGGACCGGTTTTCCCGGTAATCCGTATTTACAAGGTTGGTTTCttttttacgcgtgatcctctagaactatagCTCGAG。

[0083] The sequence of SEQ ID NO:13 is as follows:

[0084] GCTAGCAAGCTTattcgaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcactaggcgggaacacccagcgcgcgtgcgccctggcaggaagatggctgtgagggacaggggagtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataagttctgtatgagaccacagatctccatactgAGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTCCAGGACCTTGGGTTCTAACCTGTCGCCGAGATTTATGCAGCGGACTGCCTTTCTCCCAAAGTGATAAACCGGACAGTATCATGGACCGGTTTTCCCGGTAATCCGTATTTACAAGGTTGGTTTCttttttggtaccgctgccgctggaggtgctcaaagagatggaCTCGAG。

[0085] The sequence of SEQ ID NO:14 is as follows:

[0086] GCTAGCAAGCTTattcgaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcactaggcgggaacacccagcgcgcgtgcgccctggcaggaagatggctgtgag ggacaggggagtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataagttctgtatgagaccacaga tctccatactgAGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTGCGTGGCCTTGGGTTCTAACCTGTTCGCTAGATTTATGCAGCGGACTGCCTTTCTCC CAAAGTGATAAACCGGACAGTATCATGGACCGGTTTTCCCGGTAATCCGTATTTACAAGGCTGGTTTCttttttggtaccgctgccgctggaggtgctcaaagagatggaCTCGAG.

[0087] Example 2: Evaluation of the efficiency of the IS621-bridge-RNA system in achieving gene recombination in eukaryotic cells

[0088] Confocal microscopy further confirmed that the Donor-mcherry sequence was recombined at the target site of the genome, and it was observed that IS621 was expressed in both the nucleus and cytoplasm of the cells ( Figure 2 A). The recombination efficiency of IS621-H1 bridge RNA4 and IS621-H1 bridge RNA5 was similar, averaging 1.4% ( Figure 2 BC). PCR verification after mCherry gene was recombined into SOD1 target4 site ( Figure 2 DF). The PCR product amplified by the upstream and downstream primers of the SOD1 gene is 449 bp. The PCR product amplified by the upstream primer of the SOD1 gene and the downstream primer of mCherry is 889 bp.

[0089] Example 3: Donor sequence optimization

[0090] The optimized Donor sequence 1-5 plasmids were established, Donor1: 1678 bp; Donor2: 2930 bp; Donor3: 5257 bp; Donor4: 5848 bp; Donor5: 7490 bp, as shown in SEQ ID NO: 15, 16, 6, 17, 7, respectively ( Figure 3 A). The optimized donor sequence 3 (Donor3) significantly improved the recombination efficiency, reaching 13% ( Figure 3 BE). mCherry positive cells were collected, and PCR showed that the positive cells had achieved recombination at the T4 position of the SOD1 untranslated region ( Figure 3 FH). Figure 3 I sequencing further confirmed the precise recombination at the T4 position.

[0091] mCherry and HA double positive cells were evaluated by confocal microscopy ( Figure 4 AB). Figure 4 C The expression of SOD1 was detected in 293FT cells transfected with IbRT4 and IbRT5, respectively. mCherry-positive cells are marked with white dotted lines, and mCherry-negative cells are marked with yellow dotted lines. The expression levels of SOD1 in mCherry-positive and mCherry-negative cells were analyzed ( Figure 4 DE), confocal microscopy results showed that the recombination efficiency using Donor 3 was 20%, and the gene expression level decreased significantly after replacing a reporter at the UTR position, with the decrease reaching 60% calculated by fluorescence value.

[0092] SEQ ID NO: 15 (Donor-mcherry-1, 1678 bp) is as follows:

[0093]

[0094] SEQ ID NO: 16 (Donor-IRES2-mcherry-2, 2930 bp) is as follows:

[0095]

[0096] SEQ ID NO: 6 (Donor-mcherry-3, 5257 bp) is as follows:

[0097]

[0098] SEQ ID NO: 17 (itr Donor-mcherry-4, 5848 bp) is as follows:

[0099]

[0100] SEQ ID NO: 7 (Donor-mcherry-5, 7490 bp) is as follows:

[0101]

[0102] Example 4: Evaluation of the cleavage efficiency of the IS621-bridge-RNA system

[0103] The established cleavage reporter gene contains a STOP sequence and a gene cleavage targeting sequence. After the reporter gene is cleaved, the repeated sequences at the N-terminus and C-terminus of GFP will be reassembled into a complete GFP gene to express green fluorescence. The sequences constructed based on the four targets are: H1-bridger sod1-T0 (also known as IS621-bridge RNA Target 0, IbRT0) as shown in SEQ ID NO:20, H1-bridger sod1-T8 (also known as IS621-bridge RNA Target 8, IbRT8) as shown in SEQ ID NO:21, H1-bridger sod1-T4 (also known as IS621-bridge RNA Target 4, IbRT4) as shown in SEQ ID NO:22, and H1-bridger sod1-T5 (also known as IS621-bridge RNA Target 5, IbRT5) as shown in SEQ ID NO:23. The sequences constructed by the above four targets all use the XhoI-Xba1 cleavage site. The cleavage efficiency of IS621-bridge-RNA was further evaluated by the fluorescence quantity ( Figure 5 A). After 24 and 48 hours of transfection, the cleavage efficiency of the four targets increased significantly, among which IS621-bride RNATarget8 had the highest efficiency, reaching 24% ( Figure 5 BF).

[0104] The sequence of SEQ ID NO: 20 is as follows:

[0105] CTCGAGAAGCTTattcgaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcactaggcgggaacacccagcgcgcgtgcgccctggcaggaagatggctgtgagggacaggggagtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataagttctgtatgagaccacagatctccatactgAGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTGTGCGTGCTTGGGTTCTAACCTGTCCTTCAGATTTATGCAGCGGACTGCCTTTCTCCCAAAGTGATAAACCGGACAGTATCATGGACCGGTTTTCCCGGTAATCCGTATTTACAAGCATGGTTTCACTttttttggtaccgctgccgctggaggtgctcaaagagatggatctaga。

[0106] The sequence of SEQ ID NO:21 is as follows:

[0107] CTCGAGAAGCTTattcgaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcactaggcgggaacacccagcgcgcgtgcgccctggcaggaagatggctgtgagggacaggggagtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataagttctgtatgagaccacagatctccatactgAGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTTAATCCTCTTGGGTTCTAACCTGTTGGATAGATTTATGCAGCGGACTGCCTTTCTCCCAAAGTGATAAACCGGACAGTATCATGGACCGGTTTTCCCGGTAATCCGTATTTACAAGAGTGGTTTCACTttttttggtaccgctgccgctggaggtgctcaaagagatggatctaga。

[0108] The sequence of SEQ ID NO:22 is as follows:

[0109] CTCGAGAAGCTTattcgaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcactaggcgggaacacccagcgcgcgtgcgccctggcaggaagatggctgtgagggacaggggagtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataagttctgtatgagaccacagatctccatactgAGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTCCAGGACCTTGGGTTCTAACCTGTCGCCGAGATTTATGCAGCGGACTGCCTTTCTCCCAAAGTGATAAACCGGACAGTATCATGGACCGGTTTTCCCGGTAATCCGTATTTACAAGGTTGGTTTCACTttttttggtaccgctgccgctggaggtgctcaaagagatggatctaga。

[0110] The sequence of SEQ ID NO:23 is as follows:

[0111] CTCGAGAAGCTTattcgaacgctgacgtcatcaacccgctccaaggaatcgcgggcccagtgtcactaggcgggaacacccagcgcgcgtgcgccctggcaggaagatggctgtgag ggacaggggagtggcgccctgcaatatttgcatgtcgctatgtgttctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataagttctgtatgagaccacagat ctccatactgAGTGCAGAGAAAATCGGCCAGTTTTCTCTGCCTGCAGTCCGCATGCCGTGCGTGGCCTTGGGTTCTAACCTGTTCGCTAGATTTATGCAGCGGACTGCCTTTCTCCCA AAGTGATAAACCGGACAGTATCATGGACCGGTTTTCCCGGTAATCCGTATTTACAAGGCTGGTTTCACTttttttggtaccgctgccgctggaggtgctcaaagagatggatctaga.

[0112] Example 5. AAV9-IS621-bridge RNA-t4 cloning and viral packaging

[0113] The IS621-bridge RNA target4 with high cutting efficiency was cloned into the AAV expression vector and packaged in a three-plasmid system. The effect of gene repair was verified in mutant SOD1 mice ( Figure 6 AB). The results showed that AAV9-IrBT4+AAV9-Donor significantly prolonged the survival of model mice by 13 days, and a larger number of neurons were retained ( Figure 6 CD). Further staining of terminal mouse tissues showed that mCherry fluorescence was observed in neurons of the anterior horn of the spinal cord in the AAV9-IrBT4+AAV9-Donor treatment group, suggesting that Donor was precisely inserted into the T4 target site ( Figure 6 E).

[0114] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

[0115] The above embodiments are only provided for understanding the method and core concept of the present invention. It should be noted that, without departing from the principles of the present invention, a number of improvements and modifications may be made to the present invention by a person skilled in the art, and such improvements and modifications shall fall within the scope of protection of the claims of the present invention.

Claims

1. An IS621-bridge-RNA gene editing system, comprising a CMV promoter nucleotide sequence, a humanized IS621 recombinase nucleotide sequence, an H1 promoter nucleotide sequence, a bridge RNA nucleotide sequence, and a donor nucleotide sequence connected in sequence; in, The nucleotide sequence of the humanized IS621 recombinase is shown in SEQ ID NO: 1, or a nucleotide sequence different from SEQ ID NO: 1 due to the degeneracy of the genetic code.

2. The IS621-bridge-RNA gene editing system of claim 1, wherein the H1 promoter nucleotide sequence is as shown in SEQ ID NO: 2, or a nucleotide sequence different from SEQ ID NO: 2 due to the degeneracy of the genetic code; Preferably, the bridge RNA nucleotide sequence is prepared by selecting a mutant gene that causes a neurodegenerative disease; Preferably, the neurodegenerative diseases include ALS, Huntington's disease, hereditary spinocerebellar ataxia, spinocerebellar degeneration, Alzheimer's disease, and Parkinson's disease; Preferably, the neurodegenerative disease is ALS; Preferably, when the type of neurodegenerative disease is ALS, the mutated genes include C9orf72, SOD1, TDP-43, and FUS; Preferably, the bridge RNA nucleotide sequence is as shown in either SEQ ID NO: 3 or 4, or a nucleotide sequence different from SEQ ID NO: 3 or 4 due to the degeneracy of the genetic code; preferably, the bridge RNA nucleotide sequence and the donor nucleotide sequence are connected by a terminal nucleotide sequence, and the terminal nucleotide sequence is shown in SEQ ID NO: 5; Preferably, the donor nucleotide sequence is as shown in either SEQ ID NO: 6 or 7, or a nucleotide sequence different from SEQ ID NO: 6 or 7 due to the degeneracy of the genetic code.

3. A vector comprising the IS621-bridge-RNA gene editing system according to claim 1 or 2.

4. The vector according to claim 3, wherein the vector comprises a plasmid vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a piggyBac vector or a Sleeping Beauty transposable vector; Preferably, the adeno-associated viral vector includes ssAAV, scAAV and / or hybrid AAV subtypes; preferably, the adeno-associated viral vector includes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13.

5. The vector according to claim 3, wherein the vector has an ITR nucleotide sequence added to the front and / or back end of the IS621-bridge-RNA gene editing system according to claim 1, the ITR nucleotide sequence is an adeno-associated virus 2 inverted terminal repeat sequence, and the ITR nucleotide sequence is shown in SEQ ID NO: 8; Preferably, the transcription termination sequence in the humanized IS621 recombinase nucleotide sequence of the IS621-bridge-RNA gene editing system of claim 1 in the vector is a BGH nucleotide sequence, and the BGH nucleotide sequence is shown in SEQ ID NO: 9; Preferably, the vector is administered by intracerebroventricular and / or intrathecal injection.

6. Use of the IS621-bridge-RNA gene editing system according to claim 1 or 2, or the vector according to any one of claims 3 to 5, in the preparation of a drug for treating neurodegenerative diseases.

7. The use according to claim 6, wherein the neurodegenerative disease is a neurodegenerative disease caused by gene mutation; Preferably, the neurodegenerative diseases caused by the gene mutation include ALS, Huntington's disease, hereditary spinocerebellar ataxia, spinocerebellar degeneration, Alzheimer's disease, and Parkinson's disease.

8. A medicine kit comprising the medicine prepared in the use according to claim 6 or 7.

9. A method for preparing the medicine kit according to claim 8, comprising: The IS621-bridge-RNA gene editing system described in claim 1 or 2, or the vector described in any one of claims 3 to 5, is transformed into a host cell, expressed, and the expression product is collected to obtain the active ingredient in the drug kit.

10. Use of the humanized IS621 recombinase nucleotide sequence described in SEQ ID NO: 1, the H1 nucleotide sequence described in SEQ ID NO: 2, and the donor nucleotide sequence described in SEQ ID NO: 6 or 7 in preparing a eukaryotic IS621-bridge-RNA gene editing system with high shearing and recombination efficiency; Preferably, the eukaryotic cells include human or non-human mammalian cells; Preferably, the eukaryotic cells include humans, monkeys, apes, mice, rats, guinea pigs, rabbits, cows, sheep, pigs, horses, dogs, and cats.