Primer probe composition for real-time fluorescent quantitative PCR detection of meloidogyne incognita and detection method of meloidogyne incognita

Abstract

The invention discloses a primer probe composition for real-time fluorescent quantitative PCR (polymerase chain reaction) detection of meloidogyne incognita and a detection method of the primer probe composition, and belongs to the technical field of nucleic acid detection. The invention aims to solve the technical problems of how to screen and obtain the specific target gene of the meloidogyne incognita and how to detect the meloidogyne incognita based on the target gene with both specificity and sensitivity. Therefore, the invention provides a primer probe composition for amplifying and recognizing specific DNA fragments of meloidogyne incognita. The primer probe composition provided by the invention is based on an undisclosed meloidogyne incognita brand-new specific fragment, has the advantages of strong specificity, high sensitivity and high detection efficiency, can be used for quantitative detection, and avoids the problem of false positive result caused by insufficient gene interspecific specificity when a specific primer is designed by using conserved genes such as ITS and the like; powerful technical support is provided for monitoring, prevention and control of the meloidogyne incognita.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid detection, and in particular relates to a primer-probe combination for real-time fluorescence quantitative PCR detection of southern root-knot nematode and a detection method thereof. Background Art

[0002] Root-knot nematodes (Meloidogyne spp.) are a type of nematode that is an obligate endoparasitic nematode of plant roots. The soil-borne diseases they cause are the second most common after fungi. Root-knot nematodes have a wide host range and can infect more than 3,000 plant species, including vegetables, fruits, and grain crops. The four most common root-knot nematodes are the southern root-knot nematode (Meloidogyne incognita), the northern root-knot nematode (M. hapla), the Javan root-knot nematode (M. javanica), and the peanut root-knot nematode (M. arenaria). Among them, the southern root-knot nematode is the main pathogen causing root-knot nematode disease worldwide due to its wide host range and large area of ​​disease. Therefore, accurately diagnosing the population density of southern root-knot nematodes in the soil through reliable technology and formulating targeted prevention and control strategies based on different population densities is of great significance for the effective prevention and control of southern root-knot nematodes.

[0003] With the development of molecular biology techniques, molecular detection methods based on specific target sequences have made root-knot nematode detection and identification more accurate and rapid, and are no longer limited by the tester's knowledge and experience of nematode morphology. Real-time fluorescence quantitative PCR (qPCR) has been widely used in clinical disease diagnosis and plant disease diagnosis due to its rapidity, high sensitivity, and quantitative detection. Currently available quantitative detection systems for southern root-knot nematodes use primer target sequences derived from DNA sequences labeled with the internal transcribed spacer (ITS) region of ribosomal DNA, 18S rRNA, or sequence-specific amplification regions as templates for the design of specific primers. However, the conversion rate of specific sequence amplification markers is low and false positives are prone to occur. Furthermore, due to the conservative nature of the target sequences themselves, primers designed based on sequences such as ITS often suffer from insufficient specificity. For example, the patent application number CN202410073568 is a southern root-knot nematode primer-probe combination and detection method based on droplet digital PCR technology. The Mi-specific primers and probes designed based on the ITS2 conserved region, the amplified products of which were aligned to 64 similar sequences in the NCBI database, of which 20 were southern root-knot nematodes (accounting for 31.25%), 29 were peanut root-knot nematodes (accounting for 45.31%), and 9 were Java root-knot nematodes (accounting for 14.06%). It can be seen that this pair of primers has no specificity for the detection of southern root-knot nematodes, and its detection results may have the problem of false positives. Summary of the Invention

[0004] The technical problem to be solved by the present invention is: how to screen and obtain a target gene specific to southern root-knot nematodes (a southern root-knot nematode-specific DNA fragment), and accurately detect or monitor southern root-knot nematodes based on the target gene.

[0005] In order to solve this technical problem, the present invention provides the following technical solutions:

[0006] The present invention provides a composition for specifically amplifying incognita root-knot nematodes. The composition comprises a primer pair for specifically amplifying a specific DNA fragment of the incognita root-knot nematodes. The nucleotide sequence of the specific DNA fragment of the incognita root-knot nematodes is SEQ ID NO: 1.

[0007] In the present invention, the primer pair consists of primer Mi43481-F and primer Mi43481-R, wherein the primer Mi43481-F is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO: 2; and the primer Mi43481-R is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO: 3.

[0008] In the present invention, the composition may further include a probe that specifically binds to the target fragment, and the nucleotide sequence of the probe is SEQ ID NO: 4.

[0009] In the present invention, the probe may be a DNA probe. The 5' end of the DNA probe may be labeled with a reporter group, and the 3' end of the DNA probe may be labeled with a quencher group.

[0010] In the present invention, the fluorescent group is labeled at the 5' end of the probe.

[0011] In the present invention, the quencher group is labeled at the 3' end of the probe.

[0012] In the present invention, the fluorescent group is selected from at least one of FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LC RED640, LC RED705, Quasar705 and Texas Red.

[0013] In the present invention, the quenching group can be selected from at least one of TAMRA, BHQ1, BHQ2, BHQ3, MGB and Dabcy1.

[0014] In some embodiments of the present invention, the fluorescent group is 6-FAM (6-carboxyfluorescein), and the quencher group is TAMRA-N (5(6)-carboxytetramethylrhodamine N-hydroxysuccinimide ester).

[0015] In some embodiments of the present invention, the first T at the 5' end of the probe is modified with 6-FAM; and the first T at the 3' end is modified with TAMRA-N.

[0016] The present invention also provides the use of the above composition in the following A1)-A6):

[0017] A1) Application in detecting or assisting in detecting the southern root-knot nematode;

[0018] A2) Use in the preparation of a product for detecting or assisting in the detection of southern root-knot nematodes;

[0019] A3) Application in identifying or assisting in identifying the southern root-knot nematode;

[0020] A4) Use in the preparation of a product for identifying or assisting in the identification of incognita root-knot nematodes;

[0021] A5) Application in identifying or assisting in identifying whether a sample to be tested is or contains southern root-knot nematode;

[0022] A6) Use in the preparation of a product for identifying or assisting in identifying whether a sample to be tested is or contains the southern root-knot nematode.

[0023] In the present invention, the product includes but is not limited to a reagent or a kit.

[0024] The present invention also provides a kit for detecting the incognita root-knot nematode, wherein the kit contains any one of the above-mentioned compositions.

[0025] Specifically, the kit contains a primer pair for specifically amplifying a specific DNA fragment of the incognita root-knot nematode, and the nucleotide sequence of the specific DNA fragment of the incognita root-knot nematode is SEQ ID NO: 1.

[0026] In the present invention, the primer pair in the kit consists of primer Mi43481-F and primer Mi43481-R, wherein the primer Mi43481-F is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO: 2; and the primer Mi43481-R is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO: 3.

[0027] In the present invention, the kit further comprises a probe that specifically binds to the target fragment, and the nucleotide sequence of the probe is SEQ ID NO: 4.

[0028] In the present invention, the kit further contains a positive plasmid standard, and the positive plasmid standard contains a specific DNA fragment of the incognita root-knot nematode with a nucleotide sequence of SEQ ID NO: 1.

[0029] In the kit of the present invention, the ratio of the amounts of the primer Mi43481-F, the primer Mi43481-R and the probe is 1:1:1.

[0030] The present invention also provides the use of the above kit in any of the following:

[0031] B1) Application in detecting or assisting in detecting the southern root-knot nematode;

[0032] B2) Application in identifying or assisting in identifying the southern root-knot nematode;

[0033] B3) Application in identifying or assisting in identifying whether a sample to be tested is or contains southern root-knot nematode.

[0034] The present invention also provides a method for detecting or assisting in the detection of southern root-knot nematodes. The method may include using the DNA of a sample to be tested as a template, using the composition or the kit to perform real-time fluorescence PCR and detect a fluorescent signal, and then judging whether the sample to be tested contains or is a candidate for containing the southern root-knot nematode as follows: when the fluorescent signal shows a specific "S"-shaped fluorescence amplification curve and the Ct value is ≤40, it indicates that the sample to be tested contains or is a candidate for containing the southern root-knot nematode; when the fluorescent signal does not show a specific "S"-shaped fluorescence amplification curve, it indicates that the sample to be tested does not contain or is a candidate for not containing the southern root-knot nematode.

[0035] The present invention also provides a method for detecting or assisting in the detection of southern root-knot nematodes. The method may include using the DNA of a sample to be tested as a template, using primers Mi43481-F and primers Mi43481-R in the above-mentioned composition or kit to perform PCR amplification, and then judging whether the sample to be tested contains or is a candidate for containing southern root-knot nematodes as follows: if a specific amplification product is obtained, the sample to be tested contains or is a candidate for containing southern root-knot nematodes; if no specific amplification product is obtained, the sample to be tested does not contain or is a candidate for not containing southern root-knot nematodes, and the specific amplification product is a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 1.

[0036] The present invention also provides a method for identifying or assisting in identifying southern root-knot nematodes. The method may include using the DNA of a sample to be tested as a template, using the composition or the kit to perform real-time fluorescence quantitative PCR and detect a fluorescent signal, and then judging whether the sample to be tested is or is a candidate for the southern root-knot nematode as follows: when the fluorescent signal shows a specific "S"-shaped fluorescence amplification curve and the Ct value is ≤40, it indicates that the sample to be tested is or is a candidate for the southern root-knot nematode; when the fluorescent signal does not show a specific "S"-shaped fluorescence amplification curve, it indicates that the sample to be tested is not or is not a candidate for the southern root-knot nematode.

[0037] More specifically, the positive result determination in the present invention is divided into the following two situations:

[0038] (1) When the fluorescence signal shows a specific "S"-shaped fluorescence amplification curve and the Ct value is ≤35, it indicates that the test sample result is positive;

[0039] (2) When the fluorescent signal shows a specific "S"-shaped fluorescence amplification curve and the Ct value is 35<Ct value≤40, the test needs to be repeated once. If the specific "S"-shaped fluorescence amplification curve still appears, the result is judged as positive; otherwise, it is negative.

[0040] In the present invention, a positive result indicates that the sample to be tested is or is a candidate for being the southern root-knot nematode or the sample to be tested contains or is a candidate for containing the southern root-knot nematode.

[0041] The present invention also provides a method for identifying or assisting in identifying southern root-knot nematodes. The method may include using the DNA of a sample to be tested as a template, using primers Mi43481-F and primers Mi43481-R in the above-mentioned composition or kit to perform PCR amplification, and then judging whether the sample to be tested contains or is a candidate for containing the southern root-knot nematode as follows: if a specific amplification product is obtained, the sample to be tested is or is a candidate for the southern root-knot nematode; if no specific amplification product is obtained, the sample to be tested is not or is not a candidate for the southern root-knot nematode, and the specific amplification product is a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 1.

[0042] In the present invention, the sample to be tested may be plant tissue, soil, etc. More specifically, the sample to be tested may be plant root tissue and / or rhizosphere soil, rhizosphere soil, etc.

[0043] In the present invention, the sample to be tested may also be nematode tissue, worm eggs, etc.

[0044] The present invention also provides a method for quantifying the amount of incognita root-knot nematodes in a sample to be tested, the method comprising the following steps:

[0045] D1) performing real-time fluorescent PCR using the DNA of the sample to be tested as a template using the above-mentioned composition or kit and detecting the fluorescent signal to obtain the sample Ct value;

[0046] D2) performing a serial dilution of the positive plasmid standard to obtain serially diluted positive plasmid standards, performing real-time fluorescence PCR with reference to D1) and detecting the fluorescence signal to obtain the sample Ct value; and plotting a standard curve with the positive plasmid standard concentration as the abscissa and the reaction cycle threshold (Ct) as the ordinate;

[0047] D3) performing quantitative analysis of the incognita root-knot nematode in the sample according to the Ct value of the sample and the standard curve.

[0048] In some embodiments of the present invention, the method specifically comprises the following steps:

[0049] 1) Obtaining genomic DNA of the sample to be tested;

[0050] 2) Prepare the probe-based qPCR reaction system: 0.5 μL rTaq, 3 μL MgCl2, 2.5 μL 10× PCR Buffer, 2 μL dNTPs, 1 μL probe, 2 μL primers (1 μL each of forward and reverse primers), 5 μL 0.1% BSA, 4 μL H2O, and 5 μL genomic DNA of the test sample.

[0051] 3) Perform qPCR reaction: Use the prepared 25 μL reaction system to perform real-time fluorescence quantitative PCR according to the set program and collect the fluorescence signal to obtain the sample Ct value.

[0052] 4) Establish a standard curve: Use a 10-fold serial dilution of the positive plasmid standard as a template and perform the same qPCR as for the sample. Draw a standard curve with the standard plasmid concentration as the horizontal axis and the reaction cycle threshold (Ct) as the vertical axis.

[0053] 5) Data analysis: qualitative or quantitative analysis of the southern root-knot nematode situation in the sample is performed based on the Ct value of the test result of the sample to be tested.

[0054] In the present invention, the sample to be tested in step 1) can be plant root tissue, rhizosphere soil, etc.

[0055] In the present invention, the concentrations of the forward primer, reverse primer and probe in step 2) are all 10 μmol·L -1 .

[0056] In the present invention, the qPCR amplification program set in step 3) is: 95°C pre-denaturation for 5 min, 1 cycle; 95°C denaturation for 60 s, 58°C annealing for 45 s, 45 cycles.

[0057] In some embodiments of the present invention, the method for preparing the positive plasmid standard in step 4) is as follows: constructing the target fragment of the southern root-knot nematode into the pMD18-T vector, then transforming it into DH5α competent cells, picking positive clones and sequencing them to determine if they are correct, expanding the culture and extracting the plasmid DNA, linearizing the extracted plasmid DNA and then recovering and purifying it, measuring the DNA concentration, and calculating the DNA copy number contained in the recombinant plasmid per unit volume according to Moore's law.

[0058] The calculation formula is as follows:

[0059] Recombinant plasmid copy number (copies·μL -1 )=[plasmid concentration (ng·μL -1 )×6.023×10 23 (copies·mol -1 )] / [(vector length bp + fragment length bp) × 660 g·mol -1 ×1×10 9 ]

[0060] In some embodiments of the present invention, the qualitative judgment method for the results of southern root-knot nematode in step 5) is: when the Ct value of the tested sample is ≤35 and a specific "S"-shaped fluorescence amplification curve appears, the tested sample can be judged as positive; when the Ct value of the tested sample is 35<Ct value≤40 and a specific "S"-shaped fluorescence amplification curve appears, the test needs to be repeated once. If the specific "S"-shaped fluorescence amplification curve still appears, the tested sample can be judged as positive, otherwise it is judged as negative; if there is no Ct value and no specific "S"-shaped fluorescence amplification curve, the tested sample is judged as negative.

[0061] In some embodiments of the present invention, the quantitative determination method of the incognita root-knot nematode results in step 5) is as follows: according to the established standard curve, the obtained Ct value is substituted into the standard curve equation to calculate the copy number of the incognita root-knot nematode target gene in the sample.

[0062] Compared with the prior art, the present invention has the following beneficial effects:

[0063] 1. The qPCR primers, probes, and detection methods designed in this invention are based on a novel, unpublished, specific fragment of the southern root-knot nematode. They demonstrate strong specificity, high sensitivity, and high detection efficiency, enabling quantitative detection, providing powerful technical support for the monitoring and control of southern root-knot nematodes. Based on a comparative analysis of the entire genome of southern root-knot nematodes, this invention designs specific primers and probes targeting differentially expressed genes unique to southern root-knot nematodes. This avoids the problem of false positives often encountered when designing specific primers based on conserved genes, such as ITS genes, due to insufficient interspecies specificity.

[0064] 2. The detection method established by the present invention has a wide range of applications and can be applied to the detection of southern root-knot nematodes in single nematodes, diseased plant tissues and soil.

[0065] 3. Compared with traditional morphological analysis, the present invention uses qPCR to detect southern root-knot nematodes, which requires less morphological identification experience of the test personnel and has a lower instrument price than digital PCR, making it easier to promote and apply on a large scale. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 Figure 3 is an amplification curve of the southern root-knot nematode detection system for the gradient dilution of the positive plasmid standard. The horizontal axis represents the number of reaction cycles, the vertical axis represents the fluorescence signal intensity, and NTC in the figure represents the negative control (ddH2O).

[0067] Figure 2 A standard curve was established for the southern root-knot nematode detection system based on the gradient dilution of the positive plasmid standard.

[0068] Figure 3 This is a sensitivity amplification curve of the southern root-knot nematode detection system for gradiently diluted nematode eggs. The horizontal axis represents the number of reaction cycles, the vertical axis represents the fluorescence signal intensity, and NTC in the figure represents the blank control.

[0069] Figure 4 This is the standard curve of the southern root-knot nematode detection system's sensitivity to nematode eggs.

[0070] Figure 5 This is a map of the recombinant vector pMD18-Mi43481. DETAILED DESCRIPTION

[0071] 1. Terms used in the present invention:

[0072] Any references cited herein, including, for example, all patents, published patent applications, and non-patent publications, are hereby incorporated by reference in their entirety.

[0073] When used in a list of two or more items, the term "and / or" or "or / and" means that any of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either or both of A and B, i.e., A alone, B alone, or a combination of A and B. The expression "A, B, and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B, and C.

[0074] The term "comprising" is not intended to be limiting, but rather inclusive and means that there may be additional elements other than the listed elements and can be interpreted as "including but not limited to". The term "comprising" also encompasses the terms "consisting of" and "consisting essentially of". The terms "including" and "comprising" are used interchangeably herein.

[0075] As used herein, a "primer" is an isolated polynucleotide that anneals to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA, which is then extended along the target DNA strand by a polymerase (e.g., a DNA polymerase). A primer refers to its use in amplifying a target polynucleotide, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods. "PCR" or "polymerase chain reaction" is a technique used to amplify specific DNA fragments.

[0076] The probe and primer both have sufficient nucleotide length to engage with the target DNA sequence and can specifically detect and / or identify the polynucleotide having the target sequence. The operator can determine the hybridization conditions or reaction conditions to achieve this result, which has been verified. This length can be any length sufficient for use in the preferred detection method. The length commonly used is 8, 11, 14, 16, 18, 20, 22, 24, 26, 28, 30, 40, 50, 75, 100 or more nucleotides, or a length of about 11-20, 20-30, 30-40, 40-50, 50-100 or more nucleotides. Such probes and primers can specifically hybridize with the target sequence under high stringency hybridization conditions.

[0077] The rhizosphere is the area of ​​soil directly affected by plant root activity, including the root surface and surrounding soil microregions where significant changes in microbial, chemical, and physical properties occur. In this context, it refers to the soil within a 5-10 cm radius centered on the taproot.

[0078] The rhizosphere generally refers to the soil part in the rhizosphere close to the root system (usually 1 to 2 mm from the root surface). It is a micro-region where soil-root-microorganisms interact, and is also a specific micro-ecosystem formed by different plant species or varieties, soil and environmental conditions.

[0079] The Ct value, also known as the cycle threshold, is the number of cycles from baseline to the inflection point of exponential growth. The Ct value is linearly related to the logarithm of the starting copy number of the template. Higher starting template concentrations result in lower Ct values, while lower starting template concentrations result in higher Ct values.

[0080] The threshold is generally 10 times the standard deviation of the baseline. Fluorescence signals above the threshold are considered to be true signals. Generally speaking, the threshold is 10 times the standard deviation of the fluorescence signal of PCR cycles 3-15, that is, threshold = 10×Sdcycle 3-15.

[0081] The baseline typically refers to the signal level during the first few cycles of PCR (generally cycles 3 to 15), when there is minimal fluorescence signal variation. This low baseline signal corresponds to the background or "noise" of the reaction. The baseline for each real-time PCR reaction can be determined empirically by the user or automatically by analyzing the amplification curve.

[0082] 2. Example

[0083] In view of the problem that the existing technology may result in inaccurate detection results, the present invention is based on a comparative analysis of the whole genome of the southern root-knot nematode, designs specific primers and probes with the differentially expressed genes unique to the southern root-knot nematode as the target, and establishes a real-time fluorescence quantitative PCR (qPCR) detection system for the southern root-knot nematode, aiming to provide more active and accurate technical support for the quantitative detection and effective prevention and control of the southern root-knot nematode.

[0084] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0085] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0086] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0087] Example 1. Development of qPCR primers for Meloidogyne incognita based on whole-genome comparative analysis

[0088] The reported genome sequence of the southern root-knot nematode (M. incognita) was compared with the genome data of the closely related peanut root-knot nematode (M. arenaria) and Java root-knot nematode (M. javanica) to identify genes unique to the southern root-knot nematode. GO and KEGG enrichment analysis were performed on these genes. Finally, genes that existed simultaneously and had significant differences in GO analysis and KEGG analysis were screened as detection targets, and primer3 was used to design qPCR primers and probes.

[0089] Whole-genome comparison revealed 1,484 species-specific orthologous groups among the 43,718 coding DNA sequences (cds) of M. incognita (Table 1). Gene annotation was performed and shared data with p-adjust < 0.05 in the GO and KEGG databases were selected. Ultimately, 10 gene sequences (M. incognita-specific DNA fragments) involved in four pathways and not belonging to ITS or 16s rDNA sequences were identified. Specific primers and probes were then designed.

[0090] Table 1 Comparison of genome sequences of three nematode species

[0091]

[0092] The genomic DNA of the incognita root-knot nematode was extracted and used as template DNA. The designed primers and probes were used for qPCR reaction to screen out a set of primers and probes with the highest amplification efficiency. Each reaction was repeated three times.

[0093] Real-time fluorescence quantitative PCR (qPCR) is a common procedure in the field under the conditions where the target sequence, primer and probe sequences are known. An exemplary reaction system and reaction amplification procedure are provided below. The rTaq, MgCl2, 10× PCR Buffer, dNTPs and Bovine Serum Albumin (BSA) in the reaction system were all obtained from Dalian Takara Biotechnology Co., Ltd. Among them, the rTaq (Cat. No.: R001WZ) was used at a concentration of 5U·μL -1 MgCl2 (Cat. No. 9151AM) was used at a concentration of 25 mM; 10× PCR Buffer (Cat. No. 9151AM) was used at a concentration of 100 mM Tris-HCl (pH 8.9), 500 mM KCl; and BSA (Cat. No. 2320) was used at a concentration of 1 mg mL -1 ; The probe was used at a concentration of 10 μM; the forward and reverse primers were used at a concentration of 10 μM.

[0094] Reaction system: rTaq 0.5 μL, MgCl2 3 μL, 10× PCR Buffer 2.5 μL, dNTPs 2 μL, probe 1 μL, primers 2 μL (forward primer, reverse primer 1 μL each), 0.1% BSA 5 μL, H2O 4 μL, sample genomic DNA 5 μL.

[0095] The amplification reaction program was as follows: 1 cycle of pre-denaturation at 95°C for 5 min, followed by 45 cycles of denaturation at 95°C for 30 s and annealing at 60°C for 45 s.

[0096] Table 2 Amplification results of different primer and probe combinations

[0097] Serial number Primer and probe combinations Ct average SD CV / % 1 mi26747 - - - 2 mi29804 - - - 3 mi08946 - - - 4 mi21528 31.73 0.06 0.20 5 mi25959 33.42 0.15 0.44 6 mi31783 33.61 0.01 0.04 7 mi43481-1 30.84 0.06 0.21 8 mi43481-2 30.79 0.04 0.14 9 mi44849 30.92 0.09 0.28 10 mi37561 31.66 0.16 0.50 11 mi16638 30.59 0.84 2.75 12 <![CDATA[ddH2O]]> - - -

[0098] As shown in Table 2, under the same template and different primer conditions, the amplification Ct value of the primer and probe combination mi43481-2 is smaller than the Ct values ​​of other primers and the fluorescence signal value is higher, and the SD and CV values ​​are also lower. This indicates that the number of amplification cycles corresponding to the fluorescence signal of the amplified product of the primer combination mi43481-2 reaching the optimal fluorescence threshold automatically set by the software is small, the sensitivity is high, and the reaction is relatively stable. Therefore, it can be used as the southern root-knot nematode-specific primer and probe used in the present invention. The nucleotide sequence of the primer and probe combination mi43481-2 for amplifying and identifying the target gene is shown in SEQ ID NO: 1. The primer and probe combination of the primer and probe combination mi43481-2 includes a forward primer Mi43481-F, a reverse primer Mi43481-R, and a TaqMan probe Mi43481-P. The nucleotide sequences of the forward primer Mi43481-F, the reverse primer Mi43481-R, and the TaqMan probe Mi43481-P are as follows:

[0099] Forward primer Mi43481-F: CCCAGAGCTCGAGTTAGTGT (SEQ ID NO: 2);

[0100] Reverse primer Mi43481-R: GTAACATGGTCTGCACCTCC (SEQ ID NO: 3);

[0101] TaqMan probe Mi43481-P: TTGGTTTCAGAGGCAGGCGTTGGT (SEQ ID NO: 4);

[0102] TaqMan probe is a DNA probe in which the first T at the 5' end is modified with 6-FAM (6-carboxyfluorescein); the first T at the 3' end is modified with TAMRA-N (5(6)-carboxytetramethylrhodamine N-hydroxysuccinimide ester).

[0103] Target DNA: CCCAGAGCTCGAGTTAGTGTCAAATTGGTTTCAGAGGCAGGCGTTGGTATTGTTTCTGCAAAGGTGGCTAAAGGAGGTGCAGACCATGTTAC (SEQ ID NO: 1).

[0104] In the following examples, the primer and probe combination mi43481-2 is named as the incognita root-knot nematode detection system.

[0105] Example 2: Optimization of reaction amplification procedures and result interpretation

[0106] 2.1 Optimization of reaction amplification procedures

[0107] Referring to the reaction system and initial reaction amplification program in Example 1, the reaction annealing temperature was optimized, using two different annealing temperatures: 58°C and 62°C. The initial reaction amplification program was: 95°C pre-denaturation for 5 minutes, 1 cycle; 95°C denaturation for 30 seconds, annealing for 45 seconds, 45 cycles.

[0108] Table 3 Reaction annealing temperature optimization results

[0109] Annealing temperature / ℃ Ct average SD CV / % 58 19.67 0.39 1.91 60 30.79 0.04 0.13 62 28.09 0.36 1.29

[0110] As shown in Table 3, when the reaction annealing temperature is 58°C, the average Ct value is the lowest, so the optimal annealing temperature of the reaction system is 58°C.

[0111] The tentative reaction amplification program was as follows: pre-denaturation at 95°C for 5 min, 1 cycle; denaturation at 95°C for 30 s, annealing at 58°C for 45 s, 45 cycles (i.e., the original program in Table 4).

[0112] The extension program was further added and the optimized reaction amplification program was changed to: pre-denaturation at 95°C for 5 min, 1 cycle; denaturation at 95°C for 30 s, annealing at 58°C for 45 s, and extension at 72°C for 30 s, for 45 cycles (i.e., the updated program in Table 4).

[0113] Table 4 Reaction amplification program optimization results

[0114] Reaction steps Ct average SD CV / % Original program 20.36 0.39 1.91 Updater 27.82 0.14 0.50

[0115] As shown in Table 4, the updated protocol did not achieve the expected effect of reducing Ct values ​​and improving reaction efficiency. Therefore, the optimal amplification protocol was finally determined: 1 cycle of pre-denaturation at 95°C for 5 minutes, followed by 45 cycles of denaturation at 95°C for 30 seconds and annealing at 58°C for 45 seconds.

[0116] 2.2 Interpretation of results

[0117] Under the reaction system shown in Example 1 and the optimal reaction amplification procedure in 2.1, the result judgment criteria are as follows:

[0118] (1) When the sample shows a specific "S"-shaped fluorescence amplification curve and the Ct value is ≤35, the sample can be judged as positive;

[0119] (2) When the sample shows a specific "S"-shaped fluorescence amplification curve and the Ct value is 35<Ct value≤40, the test is repeated once. If the specific "S"-shaped fluorescence amplification curve still appears, the result is judged as positive; otherwise, it is negative;

[0120] (3) If there is no specific “S”-shaped fluorescence amplification curve and no Ct value, the sample is judged to be negative.

[0121] In addition to qPCR, those skilled in the art can also use the DNA of the test sample as a template, use primers Mi43481-F and primers Mi43481-R to perform conventional PCR amplification, and then judge the result of the test sample as follows: if a specific amplification product (DNA fragment shown in SEQ ID NO: 1) is obtained, the test result of the test sample is positive for insects; if no specific amplification product is obtained, the test result of the test sample is negative.

[0122] A positive result indicates that the sample to be tested is or is a candidate for being the southern root-knot nematode or that the sample to be tested contains or is a candidate for containing the southern root-knot nematode.

[0123] Negative indicates that the sample to be tested is not or is not a candidate for being the southern root-knot nematode or the sample to be tested does not contain or is not a candidate for containing the southern root-knot nematode.

[0124] Example 3: Specificity analysis

[0125] The genomic DNA of the southern root-knot nematode was used as a positive sample, ddH2O was used as a negative control, and the genomic DNA of the northern root-knot nematode, peanut root-knot nematode, soybean cyst nematode, beet cyst nematode, stem nematode, Steinberger's brachyrhizoctonia solani, Verticillium dahliae, Rhizoctonia solani AG-1, Rhizoctonia solani AG-4, Fusarium oxysporum wilt-specific type FOV7, Fusarium oxysporum watermelon-specific type Fon, Fusarium oxysporum cucumber-specific type FOC1-2-11 and Colletotrichum gloeosporioides were used as templates to perform probe-based real-time fluorescence quantitative PCR amplification using the reaction system provided in Example 1 and the reaction conditions optimized in Example 2 to verify the specificity of the method established in the present invention. The samples to be tested for the above-mentioned specific analysis are all owned by the Institute of Plant Protection, Hebei Academy of Agriculture and Forestry Sciences. Among them, the southern root-knot nematode, northern root-knot nematode, and peanut root-knot nematode are recorded in the document "Occurrence and Distribution of Root-knot Nematodes in Hebei Province"; the soybean cyst nematode is recorded in the document "Study on Pathogenicity Differentiation of Soybean Cyst Nematodes in Hebei Province"; the sweet potato stem nematode is recorded in the document "Effect of Combined Application of Thiazophos and Amino Oligosaccharides on the Control of Sweet Potato Stem Nematode Disease"; the dahliae is recorded in the document "Preliminary Analysis of Antimicrobial Proteins of Bacillus subtilis NCD_2 Strain"; the Rhizoctonia solani AG-1 and AG-4 are recorded in the document "Study on Hyphae Fusion Groups and Pathogenicity of Rhizoctonia solani on Cotton in Hebei Province"; and the Fusarium is recorded in the document "Effects of ComX on the Biocontrol Properties of Bacillus velezensis B31 and the Inhibition of Tomato Fusarium wilt Activity".

[0126] The results are shown in Table 5. The southern root-knot nematode detection system established by the present invention can specifically amplify the southern root-knot nematode samples, generating a specific "S"-shaped fluorescence amplification curve and a corresponding detection value (Ct), while no specific "S"-shaped fluorescence amplification curve and detection value (Ct) were produced for other samples, indicating that the method established by the present invention has good specificity.

[0127] Table 5 Specificity analysis of the southern root-knot nematode detection system

[0128]

[0129] Example 4: Primer sensitivity analysis and establishment of a standard curve

[0130] Construction of a standard plasmid: The genomic DNA of the southern root-knot nematode was amplified by PCR using the specific primers designed in the present invention. The amplified specific fragment was recovered and purified. The purified product was ligated into the vector pMD18-T (Takara Biotech, Cat. No. 6011) to construct the recombinant vector pMD18-Mi43481 (i.e., the positive plasmid standard). The structure of the recombinant vector pMD18-Mi43481 is as follows: the DNA fragment shown in SEQ ID NO: 1 was inserted between the EcoRI restriction enzyme recognition sites of pMD18-T, while the other nucleotide sequences of pMD18-T remained unchanged. The map of the recombinant vector pMD18-Mi43481 is shown in FIG. Figure 5 The constructed vector was transformed into DH5α competent cells, and plasmid DNA from positive clones was screened and extracted. After sequencing, the cells were expanded and the plasmid DNA was extracted. The extracted plasmid was linearized with the EcoRI endonuclease and recovered and purified. The concentration and purity of the recovered plasmid DNA were measured using a Nanodrop ND-2000, and the DNA copy number per unit volume of the recombinant plasmid was calculated according to Moore's law.

[0131] The calculation formula is as follows:

[0132] Recombinant plasmid copy number (copies·μL -1 )=[plasmid concentration (ng·μL -1 )×6.023×10 23 (copies·mol -1 )] / [(vector length bp + fragment length bp) × 660 g·mol -1 ×1×10 9 ]

[0133] The establishment of plasmid standard curve: the quantitative plasmid DNA was diluted 10 times to 10 0 to 10 8 Copies / μl, using plasmids of various concentrations as templates, qPCR amplification was performed using the primers and probes designed by the present invention to determine the sensitivity of the southern root-knot nematode detection system, and a plasmid standard curve was established with the common logarithm of the copy number as the horizontal axis and the Ct value as the vertical axis. The amplification efficiency E=10 was calculated. (-1 / 斜率) -1.

[0134] The standard curve amplification curve of the standard plasmid is as follows Figure 1 The results show that the standard curve was drawn with the common logarithm of the plasmid concentration as the horizontal axis and the Ct value as the vertical axis. Figure 2 The amplified template and Ct value have a good linear relationship y=-3.1851x+37.6263, R 2=0.9891, reaction amplification efficiency E = 106.0%. Wherein, y is the Ct value, and x is the common logarithm of the plasmid concentration (i.e., the logarithm of the plasmid concentration with base 10).

[0135] The southern root-knot nematode detection system has a specific "S"-shaped fluorescence amplification curve when the copy number in the sample is not less than 10 copies / μl, and there is no specific "S"-shaped fluorescence amplification curve when the copy number in the sample is 1 copy / μl. Therefore, the southern root-knot nematode detection system has a detection sensitivity of 10 copies / μl for recombinant plasmid DNA templates.

[0136] Example 5: Sensitivity of the Southern Root-Knot Nematode Detection System for Detecting Southern Root-Knot Nematodes in Soil

[0137] Incognita root-knot nematode eggs were quantitatively added to 100 grams of dry soil and thoroughly mixed to prepare soils containing 10,000, 1,000, 100, 10, 1, 0.1, 0.01, and 0.001 nematode eggs per gram of soil. Soil without nematodes was used as a blank control. DNA was extracted from the soils at these gradient concentrations, and qPCR reactions were performed using the method provided by the present invention to determine the sensitivity of the incognita root-knot nematode detection system for detecting incognita root-knot nematodes in soil.

[0138] The amplification curve of the southern root-knot nematode detection system for nematode eggs is shown in the figure. Figure 3 As shown in the figure, the standard curve diagram established is as follows Figure 4 The results show that the detection sensitivity of the southern root-knot nematode detection system disclosed in the present invention for southern root-knot nematode eggs in dry soil is 1 egg / gram of soil, and the detection Ct value has a good linear relationship with the number of nematode eggs in the soil. 2 The value is 0.981, indicating that the southern root-knot nematode detection system disclosed in the present invention can effectively detect the number of southern root-knot nematodes in the soil.

[0139] Compared with the method disclosed in the document “Real-time fluorescence PCR detection and quantification of southern root-knot nematodes in soil, Journal of Plant Protection, 2012, 40(3): 255-260”, the sensitivity of this method was investigated by gradient dilution of DNA extract containing 100 nematode eggs. The test results showed that its sensitivity was 10 -1Eggs, but this evaluation result is only for pure nematode samples, which is too cumbersome and lacks practicality in actual applications. Taking into account practical applications, the present invention does not adopt the same method, but uses a soil mixture with more complex DNA and more impurities that inhibit PCR reactions to extract DNA for the sensitivity test of the southern root-knot nematode detection system. Although the results obtained are slightly inferior to those of the comparative documents, considering practical applications, the southern root-knot nematode detection system disclosed in the present invention can fully meet the needs of actual detection, and has shown good adaptability to complex soil environments. The sensitivity results have better practical reference value.

[0140] Table 6 Sensitivity of the southern root-knot nematode detection system for nematode eggs in dry soil

[0141] Concentration (egg / g soil) Ct average SD CV / % 1 35.26 0.76 2.16 10 32.73 0.40 1.22 100 30.83 0.69 2.24 1000 28.39 0.32 1.13 10000 24.41 1.30 5.33

[0142] In summary, the real-time fluorescence quantitative PCR detection method for southern root-knot nematodes established in the present invention can effectively perform quantitative detection of southern root-knot nematodes, and has the advantages of strong specificity, high sensitivity and quantitative detection, and can provide effective technical support for the early diagnosis, prediction and scientific prevention and control of crop root-knot nematode disease.

[0143] The present application has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present application, and without the need to carry out unnecessary experiments, the present application can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present application provides specific embodiments, it should be understood that further improvements can be made to the present application. In short, according to the principles of the present application, the present application is intended to include any changes, uses or improvements to the present application, including changes that depart from the disclosed scope in the present application and are made using conventional techniques known in the art.

Claims

1. A composition for specifically amplifying the incognita root-knot nematode, the composition comprising a primer pair for specifically amplifying a specific DNA fragment of the incognita root-knot nematode, the nucleotide sequence of the specific DNA fragment of the incognita root-knot nematode being SEQ ID NO:

1.

2. The composition according to claim 1, wherein: The primer pair consists of primer Mi43481-F and primer Mi43481-R, wherein the primer Mi43481-F is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO: 2; and the primer Mi43481-R is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO:

3.

3. The composition according to claim 1 or 2, characterized in that: The composition further comprises a probe that specifically binds to the target fragment, and the nucleotide sequence of the probe is SEQ ID NO:

4.

4. Use of the composition according to any one of claims 1 to 3 in the following A1) to A6): A1) Application in the detection of southern root-knot nematodes; A2) Use in the preparation of a product for detecting incognita root-knot nematodes; A3) Application in identifying or assisting in identifying the southern root-knot nematode; A4) Use in the preparation of a product for identifying or assisting in the identification of incognita root-knot nematodes; A5) Application in identifying or assisting in identifying whether a sample to be tested is or contains southern root-knot nematode; A6) Use in the preparation of a product for identifying or assisting in identifying whether a sample to be tested is or contains the southern root-knot nematode.

5. A kit for detecting southern root-knot nematodes, characterized in that: The kit comprises the composition according to any one of claims 1 to 3.

6. The kit according to claim 5, wherein: The kit further comprises a positive plasmid standard, wherein the positive plasmid standard contains a DNA fragment having a nucleotide sequence of SEQ ID NO:

1.

7. The kit according to claim 5 or 6, characterized in that: In the kit, the ratio of the amount of the primer Mi43481-F, the primer Mi43481-R and the probe is 1:1:

1.

8. Use of the kit according to any one of claims 5 to 7 in any one of the following: B1) Application in the detection of southern root-knot nematodes; B2) Application in identifying or assisting in identifying the southern root-knot nematode; B3) Application in identifying or assisting in identifying whether a sample to be tested is or contains southern root-knot nematode.

9. The method according to any one of C1) to C4) below: C1) Methods for detecting or assisting in detecting southern root-knot nematodes, including: Using the DNA of the test sample as a template, performing real-time fluorescent PCR using the composition of any one of claims 1 to 3 or the kit of any one of claims 5 to 7 and detecting the fluorescent signal, and then determining whether the test sample contains or is a candidate for containing southern root-knot nematodes according to the following steps (a1) or (a2): (a1) the fluorescence signal shows a specific "S"-shaped fluorescence amplification curve and the Ct value is ≤40, indicating that the sample to be tested contains or is likely to contain southern root-knot nematode; (a2) the fluorescence signal does not show a specific "S"-shaped fluorescence amplification curve, indicating that the sample to be tested does not contain or is not likely to contain southern root-knot nematodes; C2) A method for detecting or assisting in the detection of southern root-knot nematodes, comprising: using DNA of a sample to be tested as a template, performing PCR amplification using the composition of any one of claims 1 to 3 or the primers Mi43481-F and Mi43481-R in the kit of any one of claims 5 to 7, and then determining whether the sample to be tested contains or is a candidate for containing southern root-knot nematodes according to the following steps (b1) or (b2); (b1) If a specific amplification product is obtained, the sample to be tested contains or is a candidate for containing the southern root-knot nematode; (b2) if no specific amplification product is obtained, the sample to be tested does not contain or is a candidate for not containing incognita root-knot nematode; The specific amplification product is a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 1; C3) A method for identifying or assisting in identifying southern root-knot nematodes, comprising: using DNA of a sample to be tested as a template, performing real-time fluorescence PCR using the composition of any one of claims 1 to 3 or the kit of any one of claims 5 to 7 and detecting the fluorescent signal, and then determining whether the sample to be tested is or is a candidate for southern root-knot nematodes according to the following steps (c1) or (c2): (c1) the fluorescence signal shows a specific "S"-shaped fluorescence amplification curve and the Ct value is ≤40, indicating that the sample to be tested contains or is a candidate for containing southern root-knot nematode; (c2) the fluorescence signal does not show a specific "S"-shaped fluorescence amplification curve, indicating that the sample to be tested is not or the candidate is not southern root-knot nematode; C4) A method for identifying or assisting in identifying southern root-knot nematodes, comprising: using DNA of a sample to be tested as a template, performing PCR amplification using the composition of any one of claims 1 to 3 or the primers Mi43481-F and Mi43481-R in the kit of any one of claims 5 to 7, and then determining whether the sample to be tested contains southern root-knot nematodes according to the following steps (d1) or (d2): (d1) obtaining a specific amplification product, then the sample to be tested is or is a candidate for incognita root-knot nematode; (d2) if no specific amplification product is obtained, then the sample to be tested is not or the candidate is not incognita; The specific amplification product is a DNA fragment with a nucleotide sequence as shown in SEQ ID NO:

1.

10. A method for quantifying the amount of southern root-knot nematodes in a sample, the method comprising the following steps: D1) performing real-time fluorescent PCR using the composition of any one of claims 1 to 3 or the kit of any one of claims 5 to 7, respectively, using the DNA of the sample to be tested as a template, and detecting the fluorescent signal to obtain a Ct value of the sample; D2) performing a gradient dilution on the positive plasmid standard described in claim 6 to obtain a gradient diluted positive plasmid standard, performing real-time fluorescence PCR with reference to D1) and detecting the fluorescence signal to obtain a sample Ct value; and plotting a standard curve with the positive plasmid standard concentration as the abscissa and the reaction cycle threshold as the ordinate; D3) performing quantitative analysis of the incognita root-knot nematode in the sample according to the Ct value of the sample and the standard curve.

Images