A molecular marker for identifying shiqi pigeon breed, method and application thereof

By using a multiplex PCR detection method with 50 molecular marker sites in the Shiqi pigeon breed, the problems of accuracy and efficiency in Shiqi pigeon breed identification have been solved, achieving efficient and objective identification results and protecting the genetic resources of Shiqi pigeons.

CN120666046BActive Publication Date: 2026-06-30BAISHI BRANCH OF ZHONGSHAN SHIQI PIGEON BREEDING CO LTD +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
BAISHI BRANCH OF ZHONGSHAN SHIQI PIGEON BREEDING CO LTD
Filing Date
2025-07-11
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently and accurately identifying Shiqi pigeon breeds, especially in the identification of hybrid offspring or phenotypically similar breeds, where confusion and subjectivity exist, affecting the protection of Shiqi pigeon genetic resources and market order.

Method used

Using 50 molecular marker sites, multiplex PCR was used to detect base differences at specific sites in the pigeon genome. The number of SNP sites was counted to determine whether the pigeon belonged to the Shiqi pigeon breed. These included mutation sites such as G/A, A/T, and T/C located on different pigeon genomes. Specific primers were used for identification.

Benefits of technology

This has enabled efficient and accurate identification of Shiqi pigeon breeds, improved the identification rate, and ensured the integrity of Shiqi pigeon genetic resources and the scientific nature of market identification.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

This invention discloses a molecular marker for identifying the Shiqi pigeon breed. This molecular marker includes 50 SNP loci. By detecting these loci and comparing the results with the corresponding bases to determine if they are specific to the Shiqi pigeon breed, the number of SNP loci showing differences is counted. If the number of SNP loci differing from the Shiqi pigeon breed's specific bases is less than 3, the pigeon can be identified as a Shiqi pigeon. If the number of differing SNP loci is between 3 and 5, it is uncertain whether the pigeon is a Shiqi pigeon. If the number of differing SNP loci is greater than 5, the pigeon is not a Shiqi pigeon. This method accurately and efficiently identifies whether a pigeon can be identified as a Shiqi pigeon, effectively protecting the integrity of Shiqi pigeon genetic resources and supporting the breeding and application of superior breeds.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular markers and genetic breeding, and particularly to a molecular marker, method, and application for identifying the Shiqi pigeon breed. Background Technology

[0002] In the wave of commercial breeding, high-yield commercial pigeon breeds have significantly impacted the market due to their economic advantages, squeezing the survival space of Shiqi pigeons. At the same time, the market is rife with individuals that have been crossbred with other breeds, and even unrelated breeds that are merely phenotypically similar are being passed off as Shiqi pigeons. This mixing and counterfeiting not only seriously disrupts market order but also poses a substantial threat to the purity, genetic diversity protection, and sustainable utilization of this precious genetic resource. Therefore, it is urgent to establish a scientific, accurate, and efficient method for identifying Shiqi pigeon breeds to effectively protect the integrity of its genetic resources and support the selection and application of superior breeds. Summary of the Invention

[0003] The purpose of this invention is to provide a molecular marker, method, and application for identifying Shiqi pigeon breeds, so as to achieve efficient and accurate identification of Shiqi pigeon breeds.

[0004] According to a first aspect of the invention, a molecular marker for identifying the Shiqi pigeon breed is provided, comprising the following mutations located on chromosome 1 at position 34348083, A / T mutation at position 43792470, G / A mutation at position 4662968, T / C mutation at position 4664079, T / C mutation at position 4825319, C / T mutation at position 18182842, T / C mutation at position 20543785, A / G mutation at position 21683679, and A / G mutation at position 51365 of chromosome 2. The following mutations are listed: T / C mutation at position 077, G / A mutation at position 51664520 on chromosome 2, G / A mutation at position 2274426 on chromosome 4, T / C mutation at position 2335380 on chromosome 4, C / T mutation at position 30404232 on chromosome 4, A / C mutation at position 5410553 on chromosome 5, A / G mutation at position 21857219 on chromosome 5, G / C mutation at position 44048740 on chromosome 5, A / C mutation at position 46273012 on chromosome 6, A / G mutation at position 42249848 on chromosome 7, T / C mutation at position 46224259 on chromosome 7, and mutation at position 3112 on chromosome 8. The following mutations are listed: T / G mutation at position 5758, C / A mutation at position 35833970 on chromosome 8, A / G mutation at position 415891 on chromosome 9, T / C mutation at position 5995369 on chromosome 9, C / A mutation at position 687812 on chromosome 11, G / A mutation at position 31080652 on chromosome 11, T / C mutation at position 15095086 on chromosome 16, G / A mutation at position 12075890 on chromosome 22, C / T mutation at position 5161735 on chromosome 23, T / C mutation at position 5119132 on chromosome 25, T / A mutation at position 7447512 on chromosome 25. The following mutations are listed: A / C at position 15848385, T / C at position 2599218 on chromosome 26, G / A at position 3700510 on chromosome 27, C / G at position 9898674 on chromosome 27, A / G at position 9921138 on chromosome 27, T / C at position 16395889 on chromosome 27, G / A at position 16811788 on chromosome 27, G / A at position 2167347 on chromosome 28, A / G at position 3077457 on chromosome 28, G / A at position 8395635 on chromosome 30, and C / T at position 1667143 on chromosome 31.The following mutations are listed: G / C mutation at position 9460737 on chromosome 31, T / G mutation at position 4518546 on chromosome 32, T / C mutation at position 8517446 on chromosome 32, T / G mutation at position 4376601 on chromosome 33, G / C mutation at position 6946030 on chromosome 33, A / C mutation at position 6948563 on chromosome 33, C / A mutation at position 6956676 on chromosome 33, C / G mutation at position 6064675 on chromosome 34, and G / A mutation at position 735599 on chromosome 40. Therefore, the aforementioned 50 molecular marker sites can serve as molecular identification identifiers for Shiqi pigeons. By comparing the bases at the corresponding sites to see if they are specific to the Shiqi pigeon breed, and finally counting the number of SNP sites with differing bases, it can be determined whether the pigeon belongs to the Shiqi pigeon breed. This method is accurate, efficient, and has a high identification rate, enabling efficient identification of the Shiqi pigeon breed.

[0005] According to a second aspect of the present invention, the application of the aforementioned molecular markers in identifying Shiqi pigeon breeds is provided. This application overcomes the problems of existing technologies that rely on physical characteristics to determine pigeon breeds, making it difficult to distinguish between hybrid offspring or phenotypic imposters, and are highly subjective and dependent on experience. Identification using the aforementioned molecular markers has a high detection rate and is more scientific and effective, facilitating large-scale application.

[0006] According to a third aspect of the invention, the application of a product that detects the aforementioned molecular marker in the identification of Shiqi pigeon breeds is provided. Using a product capable of detecting the aforementioned molecular marker for Shiqi pigeon breed identification is convenient and efficient.

[0007] In some embodiments, the product includes probes or primers or kits capable of detecting the molecular markers of claim 1.

[0008] In some embodiments, the primers are mixed primers with sequences as shown in SEQ ID No:1-100.

[0009] According to a fourth aspect of the present invention, a method for identifying the breed of Shiqi pigeon is provided, wherein the method comprises the following steps:

[0010] S1: Samples are taken from the pigeons to be identified, and DNA is extracted;

[0011] S2: Perform multiplex PCR detection on the DNA extracted in step S1. The multiplex PCR primers are a mixture of primers with sequences as shown in SEQ ID No:1-100.

[0012] S3: Sequencing the multiplex PCR results to determine the bases at the sites where the molecular markers are located;

[0013] S4: Record the number of SNP sites whose bases differ from those of the Shiqi pigeon breed: When the number of SNP sites differing from those of the Shiqi pigeon breed is less than 3, it can be identified as the Shiqi pigeon breed; when the number of differing SNP sites is between 3 and 5, it is uncertain whether it is the Shiqi pigeon breed; when the number of differing SNP sites is greater than 5, the breed is not the Shiqi pigeon breed.

[0014] Therefore, this method can efficiently, accurately, and objectively identify Shiqi pigeon breeds with a high identification rate, and can be promoted and used.

[0015] In some embodiments, the breed-specific bases of the Shiqi pigeon include the G base at position 34348083 on chromosome 1 of the pigeon genome GCA_028654425.1, the A base at position 43792470 on chromosome 1, the G base at position 4662968 on chromosome 2, the T base at position 4664079 on chromosome 2, the T base at position 4825319 on chromosome 2, the C base at position 18182842 on chromosome 2, the T base at position 20543785 on chromosome 2, the A base at position 21683679 on chromosome 2, the T base at position 51365077 on chromosome 2, and the base at position 51664520 on chromosome 2. G base, G base at position 2274426 on chromosome 4, T base at position 2335380 on chromosome 4, C base at position 30404232 on chromosome 4, A base at position 5410553 on chromosome 5, A base at position 21857219 on chromosome 5, G base at position 44048740 on chromosome 5, A base at position 46273012 on chromosome 6, A base at position 42249848 on chromosome 7, T base at position 46224259 on chromosome 7, T base at position 31125758 on chromosome 8, C base at position 35833970 on chromosome 8, and G base at position 415891 on chromosome 9. The A base at position 5995369 on chromosome 9, the T base at position 687812 on chromosome 11, the G base at position 31080652 on chromosome 11, the T base at position 15095086 on chromosome 16, the G base at position 12075890 on chromosome 22, the C base at position 5161735 on chromosome 23, the T base at position 5119132 on chromosome 25, the T base at position 7447512 on chromosome 25, the A base at position 15848385 on chromosome 25, the T base at position 2599218 on chromosome 26, the G base at position 3700510 on chromosome 27, and the base at position 27 on chromosome 27. The following bases are listed: C at position 9898674, A at position 9921138 on chromosome 27, T at position 16395889 on chromosome 27, G at position 16811788 on chromosome 27, G at position 2167347 on chromosome 28, A at position 3077457 on chromosome 28, G at position 8395635 on chromosome 30, C at position 1667143 on chromosome 31, G at position 9460737 on chromosome 31, C at position 4518546 on chromosome 32, T at position 8517446 on chromosome 32, and T at position 4376601 on chromosome 33.The G base at position 6946030 on chromosome 33, the A base at position 6948563 on chromosome 33, the C base at position 6956676 on chromosome 33, the C base at position 6064675 on chromosome 34, and the G base at position 735599 on chromosome 40.

[0016] In some embodiments, the concentration of each primer is 0.2 μM.

[0017] According to a fifth aspect of the present invention, the application of the above-described method in the identification of Shiqi pigeon breeds is provided. This application allows for efficient, accurate, and objective identification of Shiqi pigeon breeds with a high identification rate, and it can be widely adopted.

[0018] According to a fifth aspect of the present invention, primers for identifying the Shiqi pigeon breed are provided, the primers being a mixture of primers with sequences as shown in SEQ ID No:1-100. Therefore, using this mixture of primers, the Shiqi pigeon breed can be identified efficiently, accurately, and objectively, with a high identification rate, and can be widely used.

[0019] The beneficial effects of this invention are:

[0020] This invention discloses a molecular marker for identifying the Shiqi pigeon breed. This molecular marker includes 50 SNP loci. By detecting these loci and comparing the results with the corresponding bases to determine if they are specific to the Shiqi pigeon breed, the number of SNP loci showing differences is counted. If the number of SNP loci differing from the Shiqi pigeon breed's specific bases is less than 3, the pigeon can be identified as a Shiqi pigeon. If the number of differing SNP loci is between 3 and 5, it is uncertain whether the pigeon is a Shiqi pigeon. If the number of differing SNP loci is greater than 5, the pigeon is not a Shiqi pigeon. This method accurately and efficiently identifies whether a pigeon can be identified as a Shiqi pigeon, effectively protecting the integrity of Shiqi pigeon genetic resources and supporting the breeding and application of superior breeds. Detailed Implementation

[0021] Based on the data of "ASM2865442v1" in the pigeon reference genome "GCA_028654425.1" in GenBank, analysis was performed. SNPs with maf < 0.05 and deletion rate > 0.1 were filtered out. Using a 100bp window and a sliding distance of 5 SNPs, SNPs with LD > 0.2 were filtered out. After initial screening by GWAS and LD analysis, 628,689 SNPs were retained. Due to the limitations of the Python random forest package, all SNPs were split into 3 RF models. The SNPs with the highest importance among the 3 models were selected as high-quality SNPs. High eigenvalue SNPs were extracted by random forest. The MeanDecreaGini eigenvalue of each SNP was scored using the RF model algorithm to extract the top 1000 and top 2000 breed characteristic sequences of Shiqi pigeons in Guangdong. Using the top 2000 most important SNP loci, the minimum allele frequency of the purebred Shiqi pigeon population was calculated. Loci with a variation frequency less than 0.016 were screened and compared with the number of variation loci in other pigeon breeds. Finally, 50 specific molecular markers for identifying Shiqi pigeons were selected. These 50 molecular markers include the following 50 SNP loci:

[0022] The sq_tag1 site is a G / A mutation located at position 34348083 on chromosome 1 of the pigeon genome GCA_028654425.1. When the base at this site is G, it can be identified as a Shiqi pigeon breed. This G base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag1 site are:

[0023] sq_P1f(SEQ ID No:1):ACTGCTCAACTTCAACAGGGAGATG,

[0024] sq_P1r(SEQ ID No:2):TCCTTGCAGCTGGTCATGGGGA;

[0025] The sq_tag2 site is an A / T mutation located at position 43792470 on chromosome 1 of the pigeon genome GCA_028654425.1. When the base at this site is A, it can be identified as a Shiqi pigeon breed. This base A is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag2 site are:

[0026] sq_P2f(SEQ ID No:3):AATAATGCCCACGGCGTGCT,

[0027] sq_P2r(SEQ ID No:4):TTCTGAAAAGTCCTTGATGTTGCAC;

[0028] The sq_tag3 locus is a G / A mutation located at position 4662968 on chromosome 2 of the pigeon genome GCA_028654425.1. When the base at this locus is G, the pigeon breed can be identified as Shiqi pigeon. This G base is specific to the Shiqi pigeon breed. The primers used to detect the sq_tag3 locus are:

[0029] sq_P3f(SEQ ID No:5):ACCTGCCTGTTTCTCTCCGTTT,

[0030] sq_P3r(SEQ ID No:6):TGGCATTTTGGTGCATTCTGTG;

[0031] The sq_tag4 locus is a T / C mutation located at position 4664079 on chromosome 2 of the pigeon genome GCA_028654425.1. When the base at this locus is T, it can be identified as a Shiqi pigeon breed. This T base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag4 locus are:

[0032] sq_P4f(SEQ ID No:7):CCCATACCAGCAACCACGGG,

[0033] sq_P4r(SEQ ID No:8):GGTGTTAACTTTGCTTTCCTGGTTT;

[0034] The sq_tag5 locus is a T / C mutation located at position 4825319 on chromosome 2 of the pigeon genome GCA_028654425.1. When the base at this locus is T, it can be identified as a Shiqi pigeon breed. This T base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag5 locus are:

[0035] sq_P5f(SEQ ID No:9):TGTCCCACCTCCTCATGGGCCAG,

[0036] sq_P5r(SEQ ID No:10):ATGTGGCTGGTCAGAGCTGCCTT;

[0037] The sq_tag6 locus is a C / T mutation located at position 18182842 on chromosome 2 of the pigeon genome GCA_028654425.1. When the base at this locus is C, it can be identified as a Shiqi pigeon breed. This C base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag6 locus are:

[0038] sq_P6f (SEQ ID No: 11): TGCTAATGCTGAGCCGCCCC,

[0039] sq_P6r (SEQ ID No: 12): TGCACCTTGGGGAGCAGGACAA;

[0040] The sq_tag7 locus is a T / C mutation located at position 20543785 on chromosome 2 of the pigeon genome GCA_028654425.1. When the base at this locus is T, it can be identified as a Shiqi pigeon breed. This T base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag7 locus are:

[0041] sq_P7f(SEQ ID No:13):TGCTGGTTTGCAAGCACCCCG,

[0042] sq_P7r(SEQ ID No:14):GCAACTGCCCTCGCTGACCC;

[0043] The sq_tag8 site is an A / G mutation located at position 21683679 on chromosome 2 of the pigeon genome GCA_028654425.1. When the base at this site is A, it can be identified as a Shiqi pigeon breed. This base A is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag8 site are:

[0044] sq_P8f(SEQ ID No:15):AGCCCGCTTTATGGCATAGTGTTT,

[0045] sq_P8r(SEQ ID No:16):GCGCTGGCATCATACCAACCTTGA;

[0046] The sq_tag9 locus is a T / C mutation located at position 51365077 on chromosome 2 of the pigeon genome GCA_028654425.1. When the base at this locus is T, it can be identified as a Shiqi pigeon breed. This T base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag9 locus are:

[0047] sq_P9f(SEQ ID No:17):GCATGCTGGCAGAAAGTCTGGT,

[0048] sq_P9r (SEQ ID No: 18): TGCTCAGTGGCTCTGCTTGGC;

[0049] The sq_tag10 locus is a G / A mutation located at position 51664520 on chromosome 2 of the pigeon genome GCA_028654425.1. When the base at this locus is G, it can be identified as a Shiqi pigeon breed. This G base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag10 locus are:

[0050] sq_P10f(SEQ ID No:19):ACCTTCTGCTGACCCGGAGGA,

[0051] sq_P10r(SEQ ID No:20):CCCTTCCCAAGCTCTAGATGTGGT;

[0052] The sq_tag11 site is a G / A mutation located at position 2274426 on chromosome 4 of the pigeon genome GCA_028654425.1. When the base at this site is G, it can be identified as a Shiqi pigeon breed. This G base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag11 site are:

[0053] sq_P11f (SEQ ID No: 21): GTCTTCATGAGCTGTCAGTGTTGT,

[0054] sq_P11r (SEQ ID No: 22): GCAGCCTGCACTTGAGCACAT;

[0055] The sq_tag12 locus is a T / C mutation located at position 2335380 on chromosome 4 of the pigeon genome GCA_028654425.1. When the base at this locus is T, it can be identified as a Shiqi pigeon breed. This T base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag12 locus are:

[0056] sq_P12f(SEQ ID No:23):AGCTCGCTGCTCCACGTTGC,

[0057] sq_P12r(SEQ ID No:24):TTGTGCACTGAGGTGAAGGGC;

[0058] The sq_tag13 locus is a C / T mutation located at position 30404232 on chromosome 4 of the pigeon genome GCA_028654425.1. When the base at this locus is C, it can be identified as a Shiqi pigeon breed. This C base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag13 locus are:

[0059] sq_P13f (SEQ ID No: 25): AGGAGGACCTAGATCAGCCCTGGAA, sq_P13r (SEQ ID No: 26): CTCCACCCTTCTGGCGGGCTT;

[0060] The sq_tag14 locus is an A / C mutation located at position 5410553 on chromosome 5 of the pigeon genome GCA_028654425.1. When the base at this locus is A, it can be identified as a Shiqi pigeon breed. This base A is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag14 locus are:

[0061] sq_P14f (SEQ ID No: 27): TGTTCCCCCAACACTTCCCCCT,

[0062] sq_P14r(SEQ ID No:28):CTTTCACAAGCTGGGGATGAAGAGA;

[0063] The sq_tag15 locus is an A / G mutation located at position 21857219 on chromosome 5 of the pigeon genome GCA_028654425.1. When the base at this locus is A, it can be identified as a Shiqi pigeon breed. This base A is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag15 locus are:

[0064] sq_P15f (SEQ ID No: 29): TGCTCAGCTCCCTCCAACCTCT,

[0065] sq_P15r(SEQ ID No:30):GGGCAGTGCATGTTCCCACCTC;

[0066] The sq_tag16 locus is a G / C mutation located at position 44048740 on chromosome 5 of the pigeon genome GCA_028654425.1. When the base at this locus is G, the pigeon breed can be identified as Shiqi pigeon. This G base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag16 locus are:

[0067] sq_P16f(SEQ ID No:31):CAGCTCTGCTACGGCTGCAACT,

[0068] sq_P16r(SEQ ID No:32):TTCTGCAGTAATGGTGGTATTGCCT;

[0069] The sq_tag17 locus is an A / C mutation located at position 46273012 on chromosome 6 of the pigeon genome GCA_028654425.1. When the base at this locus is A, it can be identified as a Shiqi pigeon breed. This base A is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag17 locus are:

[0070] sq_P17f(SEQ ID No:33):ACAGCAATGTGCAGGAGCTGGAA,

[0071] sq_P17r(SEQ ID No:34):TCTCAGAGCTGGGCAAGCATGGAT;

[0072] The sq_tag18 locus is an A / G mutation located at position 42249848 on chromosome 7 of the pigeon genome GCA_028654425.1. When the base at this locus is A, it can be identified as a Shiqi pigeon breed. This base A is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag18 locus are:

[0073] sq_P18f(SEQ ID No:35):GCCACCTGACCAGGAAGGCTGAG,

[0074] sq_P18r(SEQ ID No:36):CCCCATGAGCGCCTCGTTGCT;

[0075] The sq_tag19 locus is a T / C mutation located at position 46224259 on chromosome 7 of the pigeon genome GCA_028654425.1. When the base at this locus is T, it can be identified as a Shiqi pigeon breed. This T base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag19 locus are:

[0076] sq_P19f(SEQ ID No:37):AACTGACCAGTCTGTCGTGCT,

[0077] sq_P19r(SEQ ID No:38):CACTGGCTTTGCAGAACCGAGAC;

[0078] The sq_tag20 locus is a T / G mutation located at position 31125758 on chromosome 8 of the pigeon genome GCA_028654425.1. When the base at this locus is T, it can be identified as a Shiqi pigeon breed. This T base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag20 locus are:

[0079] sq_P20f (SEQ ID No: 39): TTTGGGCTCCTGTAAATGTGACT,

[0080] sq_P20r (SEQ ID No: 40): AGCACAGGTAATGCAGAAGGGT;

[0081] The sq_tag21 locus is a C / A mutation located at position 35833970 on chromosome 8 of the pigeon genome GCA_028654425.1. When the base at this locus is C, it can be identified as a Shiqi pigeon breed. This C base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag21 locus are:

[0082] sq_P21f (SEQ ID No: 41): TGCACCATGCCCGTTCTCTGGG,

[0083] sq_P21r (SEQ ID No: 42): ACACAGACGAATGCAGGAGCCA;

[0084] The sq_tag22 locus is an A / G mutation located at position 415891 on chromosome 9 of the pigeon genome GCA_028654425.1. When the base at this locus is A, it can be identified as a Shiqi pigeon breed. This base A is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag22 locus are:

[0085] sq_P22f (SEQ ID No: 43): TGTCTGGCACAGCCACAGCCTT,

[0086] sq_P22r(SEQ ID No:44):GGGCTGTTCCCCTTGTGTGCG;

[0087] The sq_tag23 locus is a T / C mutation located at position 5995369 on chromosome 9 of the pigeon genome GCA_028654425.1. When the base at this locus is T, it can be identified as a Shiqi pigeon breed. This T base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag23 locus are:

[0088] sq_P23f(SEQ ID No:45):GGAGTGTATGCCCCTGGTTCCTCC,

[0089] sq_P23r(SEQ ID No:46):TTGGCAGTGGGGCTGATACCT;

[0090] The sq_tag24 locus is a C / A mutation located at position 687812 on chromosome 11 of the pigeon genome GCA_028654425.1. When the base at this locus is C, it can be identified as a Shiqi pigeon breed. This C base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag24 locus are:

[0091] sq_P24f(SEQ ID No:47):GCATGGATCTGTTTCCAGTGCAGC,

[0092] sq_P24r(SEQ ID No:48):TCCTCCCTCAGAGTCCTTTGCT;

[0093] The sq_tag25 locus is a G / A mutation located at position 31080652 on chromosome 11 of the pigeon genome, GCA_028654425.1. When the base at this locus is G, the pigeon breed can be identified as Shiqi pigeon. This G base is specific to the Shiqi pigeon breed. The primers used to detect the sq_tag25 locus are:

[0094] sq_P25f (SEQ ID No: 49): TGGCTGAATACCTGGAAGCTGGGG,

[0095] sq_P25r(SEQ ID No:50):ACGCATGCAAGGGCAAAGTGCT;

[0096] The sq_tag26 locus is a T / C mutation located at position 15095086 on chromosome 16 of the pigeon genome GCA_028654425.1. When the base at this locus is T, it can be identified as a Shiqi pigeon breed. This T base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag26 locus are:

[0097] sq_P26f(SEQ ID No:51):GGCAGCTCGTGAGAGCAGGCA,

[0098] sq_P26r(SEQ ID No:52):AGTGCTCAACCACAGGTTCCCCT;

[0099] The sq_tag27 locus is a G / A mutation located at position 12075890 on chromosome 22 of the pigeon genome GCA_028654425.1. When the base at this locus is G, the pigeon breed can be identified as Shiqi pigeon. This G base is specific to the Shiqi pigeon breed. The primers used to detect the sq_tag27 locus are:

[0100] sq_P27f(SEQ ID No:53):TCAGCAAGCCTGGCAAGAGGAGAA,

[0101] sq_P27r(SEQ ID No:54):ACACAGCAGGACTGTGGGGCA;

[0102] The sq_tag28 locus is a C / T mutation located at position 5161735 on chromosome 23 of the pigeon genome GCA_028654425.1. When the base at this locus is C, it can be identified as a Shiqi pigeon breed. This C base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag28 locus are:

[0103] sq_P28f(SEQ ID No:55):ACTTTTCTCACTTCAGCTCCCCTGT,

[0104] sq_P28r(SEQ ID No:56):ACCTGAGCGTTTCCTTTTAGGCTGT;

[0105] The sq_tag29 locus is a T / C mutation located at position 5119132 on chromosome 25 of the pigeon genome GCA_028654425.1. When the base at this locus is T, it can be identified as a Shiqi pigeon breed. This T base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag29 locus are:

[0106] sq_P29f (SEQ ID No: 57): TCCCTTGGGTCTGGCTTGCAG,

[0107] sq_P29r (SEQ ID No: 58): AGCTCCATCACTGAACAGCTTCACA;

[0108] The sq_tag30 locus is a T / A mutation located at position 7447512 on chromosome 25 of the pigeon genome GCA_028654425.1. When the base at this locus is T, it can be identified as a Shiqi pigeon breed. This T base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag30 locus are:

[0109] sq_P30f(SEQ ID No:59):GGGTGGGTGGGCAGTTAAGGGG,

[0110] sq_P30r(SEQ ID No:60):TGTCCCACTCCAGGTCCAGCAGA;

[0111] The sq_tag31 locus is an A / C mutation located at position 15848385 on chromosome 25 of the pigeon genome GCA_028654425.1. When the base at this locus is A, it can be identified as a Shiqi pigeon breed. This base A is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag31 locus are:

[0112] sq_P31f(SEQ ID No:61):ACTGGGCAGGACAAGCCTGAAC,

[0113] sq_P31r(SEQ ID No:62):CCTGCAACGCAAAGGAAGGAAGCA;

[0114] The sq_tag32 locus is a T / C mutation located at position 2599218 on chromosome 26 of the pigeon genome GCA_028654425.1. When the base at this locus is T, it can be identified as a Shiqi pigeon breed. This T base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag32 locus are:

[0115] sq_P32f (SEQ ID No: 63): AATTTGGCTGCTCTGCAGTTTGGC,

[0116] sq_P32r (SEQ ID No: 64): ACCTGGCGAGATTTGGCTTTCCGT;

[0117] The sq_tag33 locus is a G / A mutation located at position 3700510 on chromosome 27 of the pigeon genome GCA_028654425.1. When the base at this locus is G, it can be identified as a Shiqi pigeon breed. This G base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag33 locus are:

[0118] sq_P33f (SEQ ID No: 65): ACACGGCCACACAACAGTATCCC,

[0119] sq_P33r (SEQ ID No: 66): GCCAGGGCGGCCATCTTTGT;

[0120] The sq_tag34 locus is a C / G mutation located at position 9898674 on chromosome 27 of the pigeon genome GCA_028654425.1. When the base at this locus is C, it can be identified as a Shiqi pigeon breed. This C base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag34 locus are:

[0121] sq_P34f (SEQ ID No: 67): ACTGGAGCAGCATGCAACAAACCCA, sq_P34r (SEQ ID No: 68): GGATGCAGCGTCTTCCTCCAAGGG;

[0122] The sq_tag35 locus is an A / G mutation located at position 9921138 on chromosome 27 of the pigeon genome GCA_028654425.1. When the base at this locus is A, it can be identified as a Shiqi pigeon breed. This base A is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag35 locus are:

[0123] sq_P35f(SEQ ID No:69):CCACAAGCCTGCCCAAGCCCA,

[0124] sq_P35r (SEQ ID No:70): AGTGTATCTCCAACAACGTGGTGCC;

[0125] The sq_tag36 locus is a T / C mutation located at position 16395889 on chromosome 27 of the pigeon genome GCA_028654425.1. When the base at this locus is T, it can be identified as a Shiqi pigeon breed. This T base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag36 locus are:

[0126] sq_P36f(SEQ ID No:71):GTCCCTCCGGCTCCGGTCCCCT,

[0127] sq_P36r(SEQ ID No:72):AGCCCGCACTGCCACAGCTCCA;

[0128] The sq_tag37 locus is a G / A mutation located at position 16811788 on chromosome 27 of the pigeon genome GCA_028654425.1. When the base at this locus is G, the pigeon breed can be identified as Shiqi pigeon. This G base is specific to the Shiqi pigeon breed. The primers used to detect the sq_tag37 locus are:

[0129] sq_P37f (SEQ ID No:73): CGGGACGGGTCACCTCGGGAA,

[0130] sq_P37r(SEQ ID No:74):CACGCAGCTTTCTACATCACCGCAA;

[0131] The sq_tag38 locus is a G / A mutation located at position 2167347 on chromosome 28 of the pigeon genome GCA_028654425.1. When the base at this locus is G, the pigeon breed can be identified as Shiqi pigeon. This G base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag38 locus are:

[0132] sq_P38f(SEQ ID No:75): CCGCCAGTACTTGCAGCCGGGA,

[0133] sq_P38r(SEQ ID No:76):CAGGCCACTGACGGGCGGGA;

[0134] The sq_tag39 locus is an A / G mutation located at position 3077457 on chromosome 28 of the pigeon genome GCA_028654425.1. When the base at this locus is A, it can be identified as a Shiqi pigeon breed. This base A is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag39 locus are:

[0135] sq_P39f (SEQ ID No:77): GCCTTGAGGTCTGCCAGCTCCCCCC,

[0136] sq_P39r(SEQ ID No:78):TGCCAGAGCCCAACAGAAACACCCT;

[0137] The sq_tag40 locus is a G / A mutation located at position 8395635 on chromosome 30 of the pigeon genome GCA_028654425.1. When the base at this locus is G, it can be identified as a Shiqi pigeon breed. This G base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag40 locus are:

[0138] sq_P40f (SEQ ID No: 79): ACACTGAAACACTTGTCGGGGTGA, sq_P40r (SEQ ID No: 80): CCCGCTCGTTGTGTCTGGGACTCCA;

[0139] The sq_tag41 locus is a C / T mutation located at position 1667143 on chromosome 31 of the pigeon genome GCA_028654425.1. When the base at this locus is C, it can be identified as a Shiqi pigeon breed. This C base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag41 locus are:

[0140] sq_P41f(SEQ ID No:81):CCCAGGTCCCAAGAGGAGGTGTAG,

[0141] sq_P41r(SEQ ID No:82):AGCTCTGGCAGGGGCACTTCA;

[0142] The sq_tag42 locus is a G / C mutation located at position 9460737 on chromosome 31 of the pigeon genome GCA_028654425.1. When the base at this locus is G, it can be identified as a Shiqi pigeon breed. This G base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag42 locus are:

[0143] sq_P42f(SEQ ID No:83):GCTGGGAAACCTCCAGTGTGCTGCC,

[0144] sq_P42r (SEQ ID No:84):TGGCTGCAGCTCCATTCAGGCAA;

[0145] The sq_tag43 locus is a C / G mutation located at position 4518546 on chromosome 32 of the pigeon genome GCA_028654425.1. When the base at this locus is C, it can be identified as a Shiqi pigeon breed. This C base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag43 locus are:

[0146] sq_P43f(SEQ ID No:85):ACTGTGCCCCCAGCCGTGCCAG,

[0147] sq_P43r(SEQ ID No:86):GGATGCAGCCCTCAGCACCCCT;

[0148] The sq_tag44 locus is a T / C mutation located at position 8517446 on chromosome 32 of the pigeon genome GCA_028654425.1. When the base at this locus is T, it can be identified as a Shiqi pigeon breed. This T base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag44 locus are:

[0149] sq_P44f(SEQ ID No:87):GACTCCGGCCATCCACCCGCA,

[0150] sq_P44r (SEQ ID No:88): TCCGTGGCTGGTGTTACCTGTGTCC;

[0151] The sq_tag45 locus is a T / G mutation located at position 4376601 on chromosome 33 of the pigeon genome GCA_028654425.1. When the base at this locus is T, it can be identified as a Shiqi pigeon breed. This T base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag45 locus are:

[0152] sq_P45f (SEQ ID No:89): TTGGCCAGCACCCGGGACAGCC,

[0153] sq_P45r (SEQ ID No:90): AGCCCAGCGGCACCTCCACTCC;

[0154] The sq_tag46 locus is a G / C mutation located at position 6946030 on chromosome 33 of the pigeon genome GCA_028654425.1. When the base at this locus is G, the pigeon breed can be identified as Shiqi pigeon. This G base is specific to the Shiqi pigeon breed. The primers used to detect the sq_tag46 locus are:

[0155] sq_P46f (SEQ ID No:91): CCTGCGGGCGCCAGAGGAGAACG,

[0156] sq_P46r(SEQ ID No:92):CAGCCTCGGAGCCCTTGGCCGT;

[0157] The sq_tag47 locus is an A / C mutation located at position 6948563 on chromosome 33 of the pigeon genome GCA_028654425.1. When the base at this locus is A, it indicates the Shiqi pigeon breed. This base A is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag47 locus are:

[0158] sq_P47f(SEQ ID No:93):ACCTGCCCTCGGGCGCCTTCT,

[0159] sq_P47r (SEQ ID No:94):GAGCGAGCGTCCCGTTGCCTCCC;

[0160] The sq_tag48 locus is a C / A mutation located at position 6956676 on chromosome 33 of the pigeon genome GCA_028654425.1. When the base at this locus is C, it can be identified as a Shiqi pigeon breed. This C base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag48 locus are:

[0161] sq_P48f(SEQ ID No:95):GCCATCAGCAAGGCTGGCTACTCCT,

[0162] sq_P48r(SEQ ID No:96):TGCTGCAGCCACGTACTACCCACC;

[0163] The sq_tag49 locus is a C / G mutation located at position 6064675 on chromosome 34 of the pigeon genome GCA_028654425.1. When the base at this locus is C, it can be identified as a Shiqi pigeon breed. This C base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag49 locus are:

[0164] sq_P49f(SEQ ID No:97): CCGCCGCACCTGCATGGCTTT,

[0165] sq_P49r (SEQ ID No:98): TTCTGGCAGACTCCTGGCGTGTGT;

[0166] The sq_tag50 locus is a G / A mutation located at position 735599 on chromosome 40 of the pigeon genome GCA_028654425.1. When the base at this locus is G, the pigeon breed can be identified as Shiqi pigeon. This G base is a breed-specific base for Shiqi pigeons. The primers used to detect the sq_tag50 locus are:

[0167] sq_P50f(SEQ ID No:99):ATGCCCTCGGGCGCTGGTGCTG,

[0168] sq_P50r(SEQ ID No:100):GGAGCAGGAGGGGGTCGGAGGT.

[0169] To verify the effectiveness of the aforementioned 50 SNP loci in identifying Shiqi pigeon breeds, different breeds of pigeons were selected for testing, including European meat pigeons Mimas, White Cano pigeons, Shiqi pigeons (white-feathered strain), Shiqi pigeons (grey-feathered strain), Silver King pigeons, and White King pigeons. The experimental procedure is as follows:

[0170] 1. DNA Extraction: DNA was extracted from pigeon blood samples using the DC112 Blood Genomic DNA Extraction Kit from Nanjing Novizan Biotechnology Co., Ltd., following the instructions. Agarose gel electrophoresis was used to check DNA integrity, and Qubit 4.0 was used to determine DNA concentration and OD value. DNA extracts that passed the concentration and OD value tests were immediately stored at -20℃ for later use.

[0171] 2. Conventional Multiplex PCR: PCR reaction system: 8.5 μl DNA sample, 10 μl multiplex PCR primer mixture (primer powder diluted with water and mixed at a concentration of 0.2 μM per primer), 31.5 μl 2X Multiplex Mix. Reaction conditions: 98℃ for 2 min; 98℃ for 15 sec, 65℃ for 4 min, 20 cycles (decreasing by 0.5℃ per cycle, finally decreasing from 65℃ to 55℃); 98℃ for 15 sec, 55℃ for 4 min, 7 cycles; 72℃ for 5 min; 4℃. The multiplex PCR primers are a mixed primer for detecting sq_tag1-50 sites, and the specific sequences are shown in SEQ ID No:1-100.

[0172] 3. Compare the detected SNPs results with the above 50 SNP sites, and record the number of SNP sites whose bases differ from the breed-specific bases of Shiqi pigeons.

[0173] 4. Experimental Results: The results and statistical data of the detection of the above 50 SNP loci in six breeds of European meat pigeons, namely Mimas, White Canu, Shiqi (white-feathered strain), Shiqi (grey-feathered strain), Silver King, and White King, are shown in Tables 1-3.

[0174] To analyze different pigeon breeds, the above 50 SNP sites were detected, and the number of SNP sites that differed from the breed-specific bases of Shiqi pigeons was counted. The results are shown in Table 1:

[0175]

[0176]

[0177] The results in Table 1 show that among non-Shiqi pigeon breeds (European meat pigeons Mimas, White Cano, Silver King, and White King), the number of differentially expressed SNP loci ranged from a minimum of 3 to a maximum of 22; while among Shiqi pigeon breeds (including White and Gray strains), the number of differentially expressed SNP loci ranged from a minimum of 0 to a maximum of 3. Therefore, a differentially expressed SNP loci count of 3 may be a critical value.

[0178] To further determine the criteria for identifying the Shiqi pigeon breed, the number of SNP loci with differences of 0, 1, 2, and ≥3 were statistically analyzed among six breeds of pigeons: European meat pigeon Mimas, White Cano pigeon, Shiqi pigeon (white-feathered strain), Shiqi pigeon (grey-feathered strain), Silver King pigeon, and White King pigeon. The results are shown in Table 2.

[0179]

[0180] Table 2 shows that among non-Shiqi pigeon breeds (European meat pigeon Mimas, White Cano pigeon, Silver King pigeon, White King pigeon), the number of pigeons with a difference of <3 (0, 1, 2) SNP loci is 0, and all are ≥3; while among Shiqi pigeons (white-feathered strain), the number of pigeons with a difference of 0 SNP loci is 1, the number of pigeons with a difference of 1 is 22, the number of pigeons with a difference of 2 is 8, and the number of pigeons with a difference of ≥3 is 0; among Shiqi pigeons (grey-feathered strain), the number of pigeons with a difference of 0 SNP loci is 27, the number of pigeons with a difference of 1 is 11, the number of pigeons with a difference of 2 is 16, and the number of pigeons with a difference of ≥3 is 2. Therefore, it can be concluded that by detecting the above 50 molecular markers (sq_tag1-50) and recording the number of SNP sites whose bases differ from those of the Shiqi pigeon breed: when the number of SNP sites differing from those of the Shiqi pigeon breed is less than 3, it can be identified as the Shiqi pigeon breed; when the number of differing SNP sites is between 3 and 5, it is uncertain whether it is the Shiqi pigeon breed; when the number of differing SNP sites is greater than 5, the breed is not the Shiqi pigeon breed.

[0181] Therefore, a method for identifying Shiqi pigeon breeds can be obtained:

[0182] S1: Samples are taken from the pigeons to be identified, and DNA is extracted;

[0183] S2: Perform multiplex PCR detection on the DNA extracted in step S1. The multiplex PCR primers are a mixture of primers with sequences as shown in SEQ ID No:1-100.

[0184] S3: Sequencing the multiplex PCR results to determine the bases at the sites of the 50 molecular markers (sq_tag1-50 SNP sites);

[0185] S4: Record the number of SNP sites whose bases differ from those of the Shiqi pigeon breed: When the number of SNP sites differing from those of the Shiqi pigeon breed is less than 3, it can be identified as the Shiqi pigeon breed; when the number of differing SNP sites is between 3 and 5, it is uncertain whether it is the Shiqi pigeon breed; when the number of differing SNP sites is greater than 5, the breed is not the Shiqi pigeon breed.

[0186] Using this method for identifying Shiqi pigeon breeds, the detection rate of Shiqi pigeon breeds was further analyzed based on the test data in Table 2. The results are shown in Table 3:

[0187]

[0188] As shown in Table 3, using the above method for identifying Shiqi pigeon breeds, the detection rate of Shiqi pigeons (white-feathered strain) was 100%, the detection rate of Shiqi pigeons (grey-feathered strain) was 95.65%, and the total detection rate of Shiqi pigeons (white-feathered + grey-feathered strain) was 97.87%; while the detection rate of non-Shiqi pigeon breeds (European meat pigeon Mimas, White Cano pigeon, Silver King pigeon, and White King pigeon) was 0%. This indicates that the method for identifying Shiqi pigeon breeds is efficient and accurate, and can be widely used for identifying Shiqi pigeon breeds.

[0189] In summary, the sq_tag1-50 SNP locus can be used for the identification of Shiqi pigeon breeds, with a detection rate as high as 97.87%. This avoids the problems of existing methods that rely on physical characteristics to determine pigeon breeds, making it difficult to distinguish between hybrid offspring or phenotypic imposters, and is highly subjective and dependent on experience. The molecular markers disclosed in this invention can be effectively used for specific genetic locus screening for Shiqi pigeon breed identification, showing a good identification rate for all Shiqi pigeons. Therefore, each locus and its combination can be effectively used for the identification of Shiqi pigeon breeds. This molecular marker containing 50 loci forms a molecular identity card for Shiqi pigeon breed identification, with a high detection rate and more scientific and effective methods, facilitating large-scale promotion and use.

Claims

1. The application of a molecular marker for identifying Shiqi pigeon breeds in the identification of Shiqi pigeon breeds, wherein, The molecular markers used to identify the Shiqi pigeon breed include the following mutations located on chromosome 1 (G / A mutation at position 34348083), chromosome 1 (A / T mutation at position 43792470), chromosome 2 (G / A mutation at position 4662968), chromosome 2 (T / C mutation at position 4664079), chromosome 2 (T / C mutation at position 4825319), chromosome 2 (C / T mutation at position 18182842), chromosome 2 (T / C mutation at position 20543785), chromosome 2 (A / G mutation at position 21683679), chromosome 2 (T / C mutation at position 51365077), and chromosome 2 (…). The following mutations are listed: G / A mutation at position 51664520 on chromosome 4, G / A mutation at position 2274426 on chromosome 4, T / C mutation at position 2335380 on chromosome 4, C / T mutation at position 30404232 on chromosome 4, A / C mutation at position 5410553 on chromosome 5, A / G mutation at position 21857219 on chromosome 5, G / C mutation at position 44048740 on chromosome 5, A / C mutation at position 46273012 on chromosome 6, A / G mutation at position 42249848 on chromosome 7, T / C mutation at position 46224259 on chromosome 7, T / G mutation at position 31125758 on chromosome 8, and so on. C / A mutation at position 35833970, A / G mutation at position 415891 on chromosome 9, T / C mutation at position 5995369 on chromosome 9, C / A mutation at position 687812 on chromosome 11, G / A mutation at position 31080652 on chromosome 11, T / C mutation at position 15095086 on chromosome 16, G / A mutation at position 12075890 on chromosome 22, C / T mutation at position 5161735 on chromosome 23, T / C mutation at position 5119132 on chromosome 25, T / A mutation at position 7447512 on chromosome 25, A / C mutation at position 15848385 on chromosome 25, and chromosome 26. The following mutations are listed: T / C mutation at chromosome 2599218; G / A mutation at chromosome 3700510; C / G mutation at chromosome 9898674; A / G mutation at chromosome 9921138; T / C mutation at chromosome 16395889; G / A mutation at chromosome 16811788; G / A mutation at chromosome 2167347; A / G mutation at chromosome 3077457; G / A mutation at chromosome 8395635; C / T mutation at chromosome 1667143; and G / C mutation at chromosome 9460737.The following mutations are involved: T / G mutation at position 4518546 on chromosome 32; T / C mutation at position 8517446 on chromosome 32; T / G mutation at position 4376601 on chromosome 33; G / C mutation at position 6946030 on chromosome 33; A / C mutation at position 6948563 on chromosome 33; C / A mutation at position 6956676 on chromosome 33; C / G mutation at position 6064675 on chromosome 34; and G / A mutation at position 735599 on chromosome 40.

2. The application of products containing molecular markers used to identify Shiqi pigeon breeds in the identification of Shiqi pigeon breeds, wherein, The molecular markers used to identify the Shiqi pigeon breed include the following mutations located on chromosome 1 (G / A mutation at position 34348083), chromosome 1 (A / T mutation at position 43792470), chromosome 2 (G / A mutation at position 4662968), chromosome 2 (T / C mutation at position 4664079), chromosome 2 (T / C mutation at position 4825319), chromosome 2 (C / T mutation at position 18182842), chromosome 2 (T / C mutation at position 20543785), chromosome 2 (A / G mutation at position 21683679), chromosome 2 (T / C mutation at position 51365077), and chromosome 2 (…). The following mutations are listed: G / A mutation at position 51664520 on chromosome 4, G / A mutation at position 2274426 on chromosome 4, T / C mutation at position 2335380 on chromosome 4, C / T mutation at position 30404232 on chromosome 4, A / C mutation at position 5410553 on chromosome 5, A / G mutation at position 21857219 on chromosome 5, G / C mutation at position 44048740 on chromosome 5, A / C mutation at position 46273012 on chromosome 6, A / G mutation at position 42249848 on chromosome 7, T / C mutation at position 46224259 on chromosome 7, T / G mutation at position 31125758 on chromosome 8, and so on. C / A mutation at position 35833970, A / G mutation at position 415891 on chromosome 9, T / C mutation at position 5995369 on chromosome 9, C / A mutation at position 687812 on chromosome 11, G / A mutation at position 31080652 on chromosome 11, T / C mutation at position 15095086 on chromosome 16, G / A mutation at position 12075890 on chromosome 22, C / T mutation at position 5161735 on chromosome 23, T / C mutation at position 5119132 on chromosome 25, T / A mutation at position 7447512 on chromosome 25, A / C mutation at position 15848385 on chromosome 25, and chromosome 26. The following mutations are listed: T / C mutation at chromosome 2599218; G / A mutation at chromosome 3700510; C / G mutation at chromosome 9898674; A / G mutation at chromosome 9921138; T / C mutation at chromosome 16395889; G / A mutation at chromosome 16811788; G / A mutation at chromosome 2167347; A / G mutation at chromosome 3077457; G / A mutation at chromosome 8395635; C / T mutation at chromosome 1667143; and G / C mutation at chromosome 9460737.The following mutations are involved: T / G mutation at position 4518546 on chromosome 32; T / C mutation at position 8517446 on chromosome 32; T / G mutation at position 4376601 on chromosome 33; G / C mutation at position 6946030 on chromosome 33; A / C mutation at position 6948563 on chromosome 33; C / A mutation at position 6956676 on chromosome 33; C / G mutation at position 6064675 on chromosome 34; and G / A mutation at position 735599 on chromosome 40.

3. The application according to claim 2, wherein, The products used to detect molecular markers for identifying Shiqi pigeon breeds include probes, primers, or kits that can detect the molecular markers.

4. The application according to claim 3, wherein, The primers are a mixture of primers with sequences as shown in SEQ ID No:1-100.

5. A method for identifying Shiqi pigeon breeds, wherein, The method includes the following steps: S1: Samples are taken from the pigeons to be identified, and DNA is extracted; S2: Perform multiplex PCR detection on the DNA extracted in step S1. The multiplex PCR primers are a mixture of primers with sequences as shown in SEQ ID No:1-100. S3: Sequencing the results of multiplex PCR detection to determine the bases at the sites of molecular markers used to identify the Shiqi pigeon breed; S4: Record the number of SNP sites whose bases differ from those of the Shiqi pigeon breed: When the number of SNP sites that differ from those of the Shiqi pigeon breed is less than 3, it can be identified as the Shiqi pigeon breed; when the number of differing SNP sites is between 3 and 5, it is uncertain whether it is the Shiqi pigeon breed; when the number of differing SNP sites is greater than 5, the breed is not the Shiqi pigeon breed. The molecular markers used to identify the Shiqi pigeon breed include the following mutations located on chromosome 1 (G / A mutation at position 34348083), chromosome 1 (A / T mutation at position 43792470), chromosome 2 (G / A mutation at position 4662968), chromosome 2 (T / C mutation at position 4664079), chromosome 2 (T / C mutation at position 4825319), chromosome 2 (C / T mutation at position 18182842), chromosome 2 (T / C mutation at position 20543785), chromosome 2 (A / G mutation at position 21683679), chromosome 2 (T / C mutation at position 51365077), and chromosome 2 (…). The following mutations are listed: G / A mutation at position 51664520 on chromosome 4, G / A mutation at position 2274426 on chromosome 4, T / C mutation at position 2335380 on chromosome 4, C / T mutation at position 30404232 on chromosome 4, A / C mutation at position 5410553 on chromosome 5, A / G mutation at position 21857219 on chromosome 5, G / C mutation at position 44048740 on chromosome 5, A / C mutation at position 46273012 on chromosome 6, A / G mutation at position 42249848 on chromosome 7, T / C mutation at position 46224259 on chromosome 7, T / G mutation at position 31125758 on chromosome 8, and so on. C / A mutation at position 35833970, A / G mutation at position 415891 on chromosome 9, T / C mutation at position 5995369 on chromosome 9, C / A mutation at position 687812 on chromosome 11, G / A mutation at position 31080652 on chromosome 11, T / C mutation at position 15095086 on chromosome 16, G / A mutation at position 12075890 on chromosome 22, C / T mutation at position 5161735 on chromosome 23, T / C mutation at position 5119132 on chromosome 25, T / A mutation at position 7447512 on chromosome 25, A / C mutation at position 15848385 on chromosome 25, and chromosome 26. The following mutations are listed: T / C mutation at chromosome 2599218; G / A mutation at chromosome 3700510; C / G mutation at chromosome 9898674; A / G mutation at chromosome 9921138; T / C mutation at chromosome 16395889; G / A mutation at chromosome 16811788; G / A mutation at chromosome 2167347; A / G mutation at chromosome 3077457; G / A mutation at chromosome 8395635; C / T mutation at chromosome 1667143; and G / C mutation at chromosome 9460737.The following mutations are involved: T / G mutation at position 4518546 on chromosome 32; T / C mutation at position 8517446 on chromosome 32; T / G mutation at position 4376601 on chromosome 33; G / C mutation at position 6946030 on chromosome 33; A / C mutation at position 6948563 on chromosome 33; C / A mutation at position 6956676 on chromosome 33; C / G mutation at position 6064675 on chromosome 34; and G / A mutation at position 735599 on chromosome 40. The specific bases for the Shiqi pigeon breed include the G base at position 34348083 on chromosome 1 of the pigeon genome GCA_028654425.1, the A base at position 43792470 on chromosome 1, the G base at position 4662968 on chromosome 2, the T base at position 4664079 on chromosome 2, the T base at position 4825319 on chromosome 2, the C base at position 18182842 on chromosome 2, the T base at position 20543785 on chromosome 2, the A base at position 21683679 on chromosome 2, the T base at position 51365077 on chromosome 2, the G base at position 51664520 on chromosome 2, and the base at position 2 on chromosome 4. The following bases are listed: G base at position 274426, T base at position 2335380 on chromosome 4, C base at position 30404232 on chromosome 4, A base at position 5410553 on chromosome 5, A base at position 21857219 on chromosome 5, G base at position 44048740 on chromosome 5, A base at position 46273012 on chromosome 6, A base at position 42249848 on chromosome 7, T base at position 46224259 on chromosome 7, T base at position 31125758 on chromosome 8, C base at position 35833970 on chromosome 8, A base at position 415891 on chromosome 9, and G base at position 599 on chromosome 9. The following bases are listed: T base at position 5369, C base at position 687812 on chromosome 11, G base at position 31080652 on chromosome 11, T base at position 15095086 on chromosome 16, G base at position 12075890 on chromosome 22, C base at position 5161735 on chromosome 23, T base at position 5119132 on chromosome 25, T base at position 7447512 on chromosome 25, A base at position 15848385 on chromosome 25, T base at position 2599218 on chromosome 26, G base at position 3700510 on chromosome 27, C base at position 9898674 on chromosome 27, and so on. The following bases are associated with chromosome 20: A base at position 9921138, T base at position 16395889, G base at position 16811788, G base at position 2167347, A base at position 3077457, G base at position 8395635, C base at position 1667143, G base at position 9460737, C base at position 4518546, T base at position 8517446, T base at position 4376601, and G base at position 6946030.The A base at position 6948563 on chromosome 33, the C base at position 6956676 on chromosome 33, the C base at position 6064675 on chromosome 34, and the G base at position 735599 on chromosome 40.

6. The method according to claim 5, wherein, The concentration of each primer is 0.2 μM.

7. The application of the method according to claim 5 or 6 in the identification of Shiqi pigeon breeds.