An indel molecular marker closely linked with the flower variegated color of hedychium coronarium and primer and application thereof
By developing Indel molecular markers and their primers that are closely linked to the color of ginger flower spots, and using BSA-seq and Indel-PCR methods, early selection and genetic improvement of ginger flower spot color were achieved, solving the problems of long breeding time and high cost in existing technologies, and realizing a highly efficient breeding process.
Patent Information
- Application Number
- CN202511157836.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-19
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2045-08-19
AI Technical Summary
Currently, there is no Indel molecular marker technology applied to the assisted selection breeding of ginger flower variegation, which results in long breeding time and high cost.
We developed Indel molecular markers and their primers that are closely linked to the color of ginger flower spots, used BSA-seq technology to mine and validate Indel markers, combined Indel-PCR method for early selection of spot color, and detected spot color by PCR amplification and fluorescent capillary electrophoresis.
This greatly shortens the breeding time, saves manpower and planting costs, and enables early selection and genetic improvement of the color traits of ginger flowers.
Smart Images

Figure CN120666109B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of molecular marker assisted breeding, and particularly relates to an Indel molecular marker closely linked to ginger flower flower spot color, a primer thereof and application. BACKGROUND
[0002] Zingiberaceae is a perennial herb. Hedychium BSA-seq analysis is an important method for developing molecular marker assisted breeding. At present, the molecular markers developed in Zingiberaceae include SSR, SRAP, RAPD, etc., but the number of these markers is very limited, and it is difficult to perform QTL positioning on important traits to obtain related sites or develop molecular markers.
[0003] In the prior art, the first ginger flower genetic map is constructed by using SRAP markers (Gao Lixia, Liu Nian, Huang Banghai. Construction of Zingiberaceae SRAP molecular marker linkage map [J]. Yunnan Plant Research, 2009, 31(04): 317-325), and SSR molecular markers are used for genetic analysis of flower color of hybrid F1 generation of 'white ginger flower' and 'gold ginger flower' (Zhou Yiwu, Xu Guoyu, Wang Qin, Yan Furong, Yu Yunyi, Yu Rangcai, Fan Yanping. Genetic analysis of flower color of hybrid F1 generation of 'white ginger flower' and 'gold ginger flower' and development of related SSR molecular markers [J]. Acta Horticulturae Sinica, 2021, 48(10): 1921-1933). At present, there is no report on development of Indel molecular marker technology and application in ginger flower spot color assisted selection breeding.
[0004] Therefore, the Indel molecular marker closely linked to ginger flower flower spot color, the primer thereof and the application are proposed, hoping to solve the problems in the prior art. SUMMARY
[0005] In view of the fact that there is no report on development of Indel molecular marker technology and application in ginger flower spot color assisted selection breeding, the application aims to provide an Indel molecular marker closely linked to ginger flower flower spot color, a primer thereof and application. The Indel molecular marker can be used for flower color trait selection at the seedling stage in a large population of different ginger flower hybrids, greatly shortening the breeding time and saving labor and planting cost.
[0006] One of the purposes of the application is to provide an Indel molecular marker closely linked to ginger flower flower spot color, wherein the Indel molecular marker site is located at the position of 49592150 bp of ginger chromosome 4, and is named CHR04-49592150-Indel.
[0007] The primer of the Indel molecular marker comprises a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown as SEQ ID NO. 1; and the nucleotide sequence of the reverse primer is shown as SEQ ID NO. 2.
[0008] The forward primer sequence SEQ ID NO. 1 is TGTAAAACGACGGCCAGTTTCGATTTTGACTGAACCCTGTC.
[0009] The reverse primer sequence SEQ ID NO. 2 is AATAAAGGCTCGGGCTGACC.
[0010] The second purpose of the present application is to provide the application of the Indel molecular marker in the qualitative selection of the ginger flower variegated color, which comprises the following steps:
[0011] (1) extracting the genomic DNA of the plant to be tested;
[0012] (2) taking the genomic DNA of the plant to be tested as a template, performing PCR amplification by using the primer of the Indel molecular marker, and performing fluorescent capillary electrophoresis detection on the PCR amplification product;
[0013] (3) identifying the depth of the variegated color of the plant to be tested according to the electrophoresis detection band result.
[0014] The total volume of the reaction system of the PCR amplification is 15 μL, which comprises 2× PCR Master Mix 7.5, a forward primer (1 μM), 0.2 μL, a reverse primer (1 μM), (1.2 μL), M13 sequence-fluorescent label (1 μM, 1.2 μL), a DNA template of the plant to be tested (20 ng-30 ng), and supplementing ddH2O to 15 μL. Taq
[0015] The PCR amplification reaction program is as follows: firstly, pre-denaturation at 94℃ for 5 min; then entering the first cycle stage, denaturation at 94℃ for 30 s, then annealing at 58℃ for 30 s, and then extension at 72℃ for 60 s, repeating the step for 30 cycles; then entering the second cycle stage, denaturation at 94℃ for 30 s, then annealing at 53℃ for 30 s, and then extension at 72℃ for 60 s, repeating the step for 13 cycles; finally, final extension at 72℃ for 10 min, and then preservation at 4℃.
[0016] Further, the PCR amplification product is detected by using an ABI 3730 DNA analyzer, and the data is analyzed by using GeneMapper 2.2.0 software.
[0017] Further, in step (3), if the PCR amplification product appears 221 bp and 228 bp bands at the same time, the flower spot color of the plant to be tested is dark (orange red or orange yellow); if only 228 bp band appears in the amplification product, the flower spot color of the plant to be tested is light (yellow or light yellow).
[0018] A third object of the present application is to provide a kit for distinguishing the color depth of Zingiber zerumbet flower spots, which comprises the forward primer and the reverse primer of the Indel molecular marker.
[0019] The present application has the following advantages compared with the prior art:
[0020] 1. The present application mines the Indel marker closely linked to the flower spot color in Zingiber zerumbet through BSA-seq technology, and verifies the stability of the association between CHR04-49592150-Indel site and the color depth of Zingiber zerumbet flower spot using Indel-PCR method combined with hybrid offspring of different populations. The Indel molecular marker developed in the present application can assist in identifying the color depth of Zingiber zerumbet flower spot, and has a broad application prospect in early selection and genetic improvement of Zingiber zerumbet flower color.
[0021] 2. The present application develops a molecular marker closely linked to the flower spot color of Zingiber zerumbet for the first time by combining BSA-seq and Indel molecular marker technology. The developed Indel molecular marker can be used for flower color trait selection at seedling stage in a large population of different Zingiber zerumbet hybrid offspring, greatly shortening the breeding time, saving labor and planting cost, and providing a new molecular marker for directional breeding of Zingiber zerumbet flower color.
[0022] 3. The primer pair of the present application can be used to identify the color depth of Zingiber zerumbet flower spot. In Zingiber zerumbet plants with dark flower spots (orange red or orange yellow), 221 bp and 228 bp bands can be amplified by PCR, and in Zingiber zerumbet plants with light flower spots (yellow or light yellow), only 228 bp band can be amplified. BRIEF DESCRIPTION OF DRAWINGS
[0023] Figure 1 Hybrid offspring used for BSA-seq analysis in the examples (obtained by crossing 'Baijianghua' and 'Jinjianghua');
[0024] Figure 2 Indel molecular marker linkage analysis results based on BSA-seq analysis in the examples;
[0025] Figure 3 Part of the amplification band results of the light flower spot F1 hybrid offspring plants obtained by crossing 'Baitai' Zingiber zerumbet and 'Jinjianghua' Zingiber zerumbet for verifying the accuracy of the marker in the examples;
[0026] Figure 4 Part of the amplified band results of the F1 hybrid plants with dark flower spots obtained from‘Baitai’ and‘Jinjianghua’ as parents for verifying the accuracy of the marker in the examples. DETAILED DESCRIPTION
[0027] The present application will be further described in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present application in any form. Unless otherwise specified, the reagents, methods and equipment used in the present application are conventional reagents, methods and equipment in the technical field.
[0028] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.
[0029] The embodiment of the present application provides an Indel molecular marker closely linked to the flower spot color of Hedychium coronarium, a primer thereof and application, the Indel molecular marker site is located at the position of 49592150 bp of chromosome 4 of Hedychium coronarium, and is named CHR04-49592150-Indel.
[0030] The forward primer sequence SEQ ID NO. 1 is TGTAAAACGACGGCCAGTTTCGATTTTGACTGAACCCTGTC.
[0031] The reverse primer sequence SEQ ID NO. 2 is AATAAAGGCTCGGGCTGACC.
[0032] The expected size of the product is 221 bp and 228 bp.
[0033] Embodiment 1: An Indel molecular marker closely linked to the flower spot color of Hedychium coronarium, a primer thereof and application, comprising the following steps:
[0034] S1, obtaining a hybrid F1 population of‘Baitai’ and‘Jinjianghua’;
[0035] S2, extraction of plant genomic DNA and construction of flower spot color extreme difference gene pool:
[0036] According to the observation results of the petal color of the hybrid F1 offspring, 20 plants with dark flower spots and 20 plants with light flower spots are selected, Figure 1 genomic DNA is extracted by using a kit, and the comparative DNA pools SS (dark flower spot DNA pool) and QS (light flower spot DNA pool) of the flower spot color are constructed;
[0037] S3, BSA-seq analysis:
[0038] BSA-seq sequencing is performed on the two parents and the DNA pools SS and QS, and the reference genome is compared with the reference genome, and the reference genome is Hedychium coronarium.Hedychium coronarium ) Chromosome level reference genome (contig total length 921.54 Mb, contig N50 1.09 Mb), identify Indel markers between DNA pools; use ED and Delta Index methods to determine the positioning interval, and screen Indel molecular markers closely linked to ginger flower mottling color according to the positioning interval Figure 2 ) ;
[0039] S4, verification of Indel markers:
[0040] Obtain the F1 generation population of 'Baitai' ginger flower and 'Jinjianghua', select 30 representative plants with different flower mottling colors to extract genomic DNA, use Primer 3 to design primer sequences according to the sequences on both sides of the Indel site (named CHR04-49592150-Indel) located at the position of 49592150 bp of chromosome 4, perform Indel-PCR analysis using the newly extracted DNA as a template, and use fluorescent capillary electrophoresis to analyze the PCR amplification product to confirm the availability of the Indel marker.
[0041] In a preferred embodiment of the present application, in steps S2 and S4, the genomic DNA extraction method comprises: collecting young leaves of parents and F1 hybrid offspring, using the fast plant genomic DNA extraction kit (DP321) of Tiangen Biochemical Technology (Beijing) Co., Ltd. to extract genomic DNA, and using agarose gel electrophoresis and NanoDrop 2000 spectrophotometer to evaluate the DNA quality.
[0042] In a preferred embodiment of the present application, in step S3, the method of BSA-seq analysis comprises:
[0043] (1) After the extracted DNA samples ('Baitai' ginger flower, 'Jinjianghua' and 40 F1 hybrid offspring) are detected and qualified, they are randomly broken into fragments with a length of 350 bp by a Covaris crusher. TruSeq Library Construction Kit is used for library construction, and strictly recommended reagents and consumables are used according to the instructions. The DNA fragments are subjected to end repair, poly A tailing, sequencing adapter addition, purification, PCR amplification and other steps to complete the whole library preparation. The constructed library is sequenced by ILLUMINA HiSeq TM PE150.
[0044] (2) The raw sequencing data was filtered using FASTP software. The filtering criteria were as follows: 1) Read pairs containing adapter sequences were filtered out; 2) When the N content in a single-end sequencing read exceeded 10% of the read length, the paired reads needed to be removed; 3) When the number of low-quality (Q≤5) bases in a single-end sequencing read exceeded 50% of the read length, the paired reads needed to be removed. After the above strict filtering of the sequencing data, high-quality clean data was obtained. The sequencing data of all samples from the parents and offspring were statistically analyzed, including the number of sequencing reads, data output, sequencing error rate, and Q. 20 Q 30 GC content, etc.
[0045] (3) The effective data were aligned to the reference genome sequence using BWA-mem2 software. The alignment results were sorted and deredundanted using samtools, and variant detection was performed using GATK software to obtain a large amount of variant detection data. Subsequently, hard filtering was performed using QD<2.0 || MQ<40.0 || FS>60.0 || QUAL<30.0 || MQrankSum<-12.5 || ReadPosRankSum<-8.0 -clusterSize 2 -clusterWindowSize 5. After filtering, high-quality SNP and INDEL data were obtained and used for downstream analysis. Based on the physical location of the variant detection, SNP and INDEL annotation was performed using snpEff software.
[0046] (4) Linkage analysis between mottled color and Indel markers was performed based on the Euclidean distance (ED) algorithm and the ΔIndex index. The results located a 5.26 Mb fragment between 43,600,000 bp and 60,660,000 bp on chromosome 4, such as... Figure 2 As shown.
[0047] In a preferred embodiment of the present invention, the verification method for the Indel marker in step S4 includes:
[0048] (1) Based on the BSA-seq analysis results in step S3, and based on the sequences flanking the Indel marker (CHR04-49592150-Indel) located at position 49592150bp on chromosome 4, primer sequences were designed using Primer 3. The M13 sequence fragment TGTAAAACGACGGCCAGT was added to the 5' of the forward primer, and the forward primer sequence SEQ ID NO.1 was TGTAAAACGACGGCCAGTTTCGATTTTGACTGAACCCTGTC, and the reverse primer sequence SEQ ID NO.2 was AATAAAGGCTCGGGCTGACC;
[0049] (2) After the extracted DNA samples (30 F1 hybrid offspring obtained by crossing 'Golden Ginger Flower' as the male parent and 'White Tai' Ginger Flower as the female parent) passed the tests, PCR amplification was performed using the above DNA as a template and primer pair (SEQ ID NO.1 and SEQ ID NO.2). The total volume of the PCR amplification system was 15 μL, including 2× Taq The PCR Master Mix 7.5 consisted of 0.2 μL of forward primer (1 μM), 1.2 μL of reverse primer (1 μM), 1.2 μL of M13 sequence-fluorescent tag (1 μM), and 20-30 ng of DNA template from the plant to be tested. ddH2O was added to a final volume of 15 μL. The PCR amplification procedure was as follows: First, pre-denaturation was performed at 94℃ for 5 min; then, the first cycle was performed, with denaturation at 94℃ for 30 s, followed by annealing at 58℃ for 30 s, and extension at 72℃ for 60 s. This step was repeated 30 times. The second cycle was then performed, with denaturation at 94℃ for 30 s, followed by annealing at 53℃ for 30 s, and extension at 72℃ for 60 s. This step was repeated 13 times. Finally, a final extension was performed at 72℃ for 10 min, followed by storage at 4℃.
[0050] (3) The PCR amplification products obtained in (2) were analyzed using an ABI 3730 DNA analyzer, and then the data were analyzed using GeneMapper 2.2.0 software. It was found that the bands amplified from 30 tested plants were consistent with the expected fragment size, including bands of 221bp and 228bp. Among them, 11 plants had a genotype of 228 / 228, and 19 plants had a genotype of 221 / 228. Some representative plant flower color images and genotypes are shown below. Figure 3 and Figure 4 As shown. Using Tassel 4.0 software, association analysis of genotype data and mottled color data revealed a highly significant positive correlation between the genotype at this Indel locus and the mottled color data. p<0.001), further verifying the association between the CHR04-49592150-Indel site and the color intensity of the mottled patches.
[0051] In summary, this invention has identified an Indel marker closely linked to the color of flower spots in ginger flowers using BSA-seq technology, and verified the stability of the association between the CHR04-49592150-Indel site and the color intensity of ginger flower spots using the Indel-PCR method in combination with hybrid offspring from different populations. This invention has good application potential in molecular marker-assisted selection breeding for the flower color trait of ginger flowers.
[0052] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. The application of a primer for detecting Indel molecular markers in the qualitative selection of ginger flower mottle color, characterized in that, Includes the following steps: (1) Extract genomic DNA from the plants to be tested; (2) Using the genomic DNA of the plant to be tested as a template, PCR amplification was performed using primers with Indel molecular markers, and the PCR amplification products were detected by fluorescent capillary electrophoresis. The primers for the Indel molecular marker include a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO.1; the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2; (3) Identify the depth of color of the spots on the plant under test based on the electrophoretic detection band results; If both 221 bp and 228 bp bands appear in the PCR amplification product, the color of the mottled patches on the tested plant will be orange-red or orange-yellow; if only the 228 bp band appears in the amplification product, the color of the mottled patches on the tested plant will be yellow or pale yellow. The ginger flower is one of the following: white ginger flower, golden ginger flower, white Thai ginger flower, F1 generation of hybrids of white ginger flower and golden ginger flower, and F1 generation of hybrids of white Thai ginger flower and golden ginger flower.
2. The application according to claim 1, characterized in that, The PCR amplification reaction procedure is as follows: First, pre-denaturation is performed at 94℃ for 5 min; then, the first cycle is performed, with denaturation at 94℃ for 30 s, followed by annealing at 58℃ for 30 s, and extension at 72℃ for 60 s, and this step is repeated for 30 cycles; then, the second cycle is performed, with denaturation at 94℃ for 30 s, followed by annealing at 53℃ for 30 s, and extension at 72℃ for 60 s, and this step is repeated for 13 cycles; finally, a final extension is performed at 72℃ for 10 min, and then the sample is stored at 4℃.
3. The application according to claim 1, characterized in that, The PCR amplification products were detected using an ABI 3730 DNA analyzer, and the data were analyzed using GeneMapper 2.2.0 software.
4. A reagent kit for distinguishing the color intensity of ginger flower spots, characterized in that, The kit includes the forward and reverse primers for the Indel molecular marker described in claim 1; The ginger flower is one of the following: white ginger flower, golden ginger flower, white Thai ginger flower, F1 generation of hybrids of white ginger flower and golden ginger flower, and F1 generation of hybrids of white Thai ginger flower and golden ginger flower.
Citation Information
Patent Citations
Major QTL and SNP molecular marker for controlling Nelumbo nucifera color traits as well as detection primer and application thereof
CN111979349A
Method for identifying authenticity of Hedychium coronarium and Hedychium coronarium interspecific hybridization F1 hybrid by using SSR marker
CN115044656A