SNP molecular marker combination for identifying length and width of cottonseed of upland cotton and application thereof
By combining SNP molecular markers on the A07 chromosome of upland cotton with PCR and fluorescence detection, the problem of early prediction and screening of cotton seed length and width traits was solved, improving the accuracy of cotton breeding efficiency and the prediction of cotton seed utilization value.
Patent Information
- Application Number
- CN202511163885.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-20
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2045-08-20
AI Technical Summary
Existing technologies have limited research on cotton and cottonseed-related traits, making it difficult to predict and effectively screen for cottonseed length and width traits in the early stages, which affects cotton breeding efficiency and the utilization value of cottonseed.
We provide 12 SNP molecular markers on chromosome A07 of upland cotton that are significantly associated with seed length and width. Through genome-wide association analysis, combined with PCR technology and a fluorescence detection platform, we can quickly identify the length and width traits of cotton seeds and apply them to marker-assisted selection breeding of upland cotton seed length and width traits.
It enables early prediction and rapid screening of cottonseed length and width traits, improving the efficiency and accuracy of cotton breeding. It is suitable for early prediction of the oil and feed value of cottonseed and supports the analysis of morphological genetic background related to cottonseed and molecular marker-assisted selection.
Smart Images

Figure CN120666110B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biotechnology, and relates to a SNP molecular marker combination for identifying the length and width of cotton seeds of Gossypium hirsutum and application thereof. BACKGROUND
[0002] Cotton is an important economic crop and is crucial to the national economy. The economic value of cotton mainly comes from cotton fibers, which differentiate from seed epidermal cells. Therefore, the characteristics of cotton seeds may potentially affect the quality and yield of cotton fibers. In addition, current research on cotton is overly focused on traditional cotton fiber yield and quality traits, and there are few reports on cotton seed-related traits. The biomass output ratio of cotton fiber to cotton seed is 1:1.5, cotton seeds have both oil and feed values, the global cotton seed oil yield is nearly 5 million tons, and the protein content in cotton seeds is as high as 50%-60%. Therefore, it is of great theoretical and practical significance to strengthen the genetic research on cotton seeds.
[0003] Genome-wide association study (GWAS) is a powerful genetic research method for mining genetic variations (usually SNPs) significantly associated with important plant phenotypic traits (such as yield, stress resistance, quality, etc.). The advantage of GWAS is that it can simultaneously scan the entire genome without the need to pre-construct a genetic population, locate multiple candidate genes or sites with different effects, and provide key information for analyzing the genetic basis of complex traits, developing molecular markers, and accelerating plant molecular design breeding.
[0004] Using genome-wide association analysis, identifying SNP molecular markers related to cotton seed length and width will be beneficial to the analysis and screening of the genetic background of cotton seeds and provide strong technical support for molecular marker-assisted selection breeding of cotton seed length and width sites. SUMMARY
[0005] The purpose of the present application is to provide SNP molecular markers significantly associated with the length and width of cotton seeds of Gossypium hirsutum on chromosome A07 and applications thereof to solve the problems existing in the prior art. The SNP molecular markers provided in the present application are associated with the length and width of cotton seeds of Gossypium hirsutum and can be used to identify the morphological traits of cotton seeds of Gossypium hirsutum and realize early prediction of the utilization potential of cotton seeds of Gossypium hirsutum.
[0006] To achieve the above purpose, the present application provides the following solutions:
[0007] The first aspect of the present application provides 12 SNP molecular markers significantly associated with the length and width of cotton seeds of Gossypium hirsutum on chromosome A07, wherein the SNP sites are located on chromosome A07 of the genetic standard line TM-1 reference genome (CRI TM-1V1.0; Yang et al., Nature Communications, 2019) of Gossypium hirsutum, and the positions of the SNP sites and their polymorphism information are shown in Table 1:
[0008] Table 1 SNP molecular marker information
[0009]
[0010] The second aspect of the present application provides the application of the above-mentioned SNP molecular marker combination in the marker-assisted selection of the length and width traits of Gossypium hirsutum L. cotton seeds.
[0011] The third aspect of the present application provides the application of the primer pair combination for amplifying the above-mentioned SNP molecular marker combination in the preparation of a product for identifying the length and width traits of Gossypium hirsutum L. cotton seeds.
[0012] Further, the product comprises a Gossypium hirsutum L. genome detection reagent or a Gossypium hirsutum L. genome detection kit or a Gossypium hirsutum L. whole genome SNP chip.
[0013] The fourth aspect of the present application provides a product for identifying the length and width traits of Gossypium hirsutum L. cotton seeds, comprising a primer pair combination for amplifying the above-mentioned SNP molecular marker combination.
[0014] Further, the product comprises a Gossypium hirsutum L. genome detection reagent or a Gossypium hirsutum L. genome detection kit or a Gossypium hirsutum L. whole genome SNP chip.
[0015] The fifth aspect of the present application provides the application of the above-mentioned product in identifying the length and width traits of Gossypium hirsutum L. cotton seeds or marker-assisted breeding or whole genome association analysis.
[0016] The sixth aspect of the present application provides a method for identifying the length and width of Gossypium hirsutum L. cotton seeds, comprising the following steps:
[0017] (1) extracting the genomic DNA of the sample to be tested from the leaves of Gossypium hirsutum L.;
[0018] (2) amplifying the DNA fragment containing the SNP site in claim 1 by PCR technology with the genomic DNA as the template to obtain the PCR product;
[0019] (3) detecting the PCR product by using a fluorescence detection platform, and judging the length and width of the Gossypium hirsutum L. cotton seeds according to the polymorphism of the SNP molecular marker reflected by the obtained fluorescence signal;
[0020] (4) when the base of the SNP molecular marker is one of SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 13, SEQ ID NO. 15, SEQ ID NO. 17, SEQ ID NO. 19, SEQ ID NO. 21 or / and SEQ ID NO. 23 at the 51st position, the cottonseed of Gossypium hirsutum is longer and wider; when the base of the SNP molecular marker is one of SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 14, SEQ ID NO. 16, SEQ ID NO. 18, SEQ ID NO. 20, SEQ ID NO. 22 or / and SEQ ID NO. 24 at the 51st position, the cottonseed of Gossypium hirsutum is shorter and narrower.
[0021] Advantages of the present application:
[0022] The SNP molecular marker provided by the present application is directly in the form of DNA, can be detected in various tissues and development stages of cotton, is not limited by environment and season, is not affected by problems such as expression or not, does not need to analyze the length of a segment, is suitable for rapid, large-scale and automatic screening. The SNP molecular marker provided by the present application can be used for identifying the length and width of cottonseed of Gossypium hirsutum, realizing early prediction of the utilization value of cottonseed of Gossypium hirsutum for oil and feed, and can also be used for genetic background analysis and screening of cottonseed morphology and molecular marker assisted selection breeding of the length and width of cottonseed of Gossypium hirsutum, and has a wide application prospect. The SNP site provided by the present application can be applied to fine mapping, cloning of cottonseed length and width related genes and whole genome selection of breeding materials, and improves the efficiency and accuracy of cotton molecular breeding. BRIEF DESCRIPTION OF DRAWINGS
[0023] Figure 1 Manhattan plot obtained by whole genome association analysis of cottonseed length and width.
[0024] Figure 2 LD block analysis and haplotype analysis of the cottonseed length and width site on A07 chromosome; **** P<0.0001, *** P<0.001. DETAILED DESCRIPTION
[0025] The following detailed description of the application is not to be taken as limiting the application, but rather as a description of certain aspects, features, and embodiments of the application. It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Additionally, the use of "including," "comprising," "having," "containing," and variations thereof herein is meant to encompass the items listed thereafter and equivalents thereof as well as additional items. Unless otherwise indicated, all ranges, amounts, or other values stated herein should be read as being open-ended ranges, amounts, or values to the maximum extent allowed by the discipline (and vice versa). Thus, for example, a stated range of "1 to 10" should be considered to include the values of 1-10 and all of the individual values and sub-ranges falling within the indicated range. Unless otherwise indicated, the use of "or" herein is meant to encompass both a and b, but not a and / or b. Unless otherwise indicated, the use of "and" herein is meant to encompass one and the other, but not both.
[0026] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. The citation of any reference is not an admission that it is prior art with respect to the present application.
[0027] Many modifications and variations of the present application described in the specification are possible without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples are illustrative only.
[0028] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.
[0029] Description of Sequence Listing: Underscored bases indicate polymorphic SNP sites
[0030] SEQ ID NO. 1: CAATCCTTATCCCCAATGATCAAATTGTGGAAATTATAGTTGCAAAGCAT G TAAATTCTCCCAATTTGCATCATCAAGAAAGGTGTTGGCCCATTCAACTA
[0031] SEQ ID NO. 2: CAATCCTTATCCCCAATGATCAAATTGTGGAAATTATAGTTGCAAAGCAT A TAAATTCTCCCAATTTGCATCATCAAGAAAGGTGTTGGCCCATTCAACTA
[0032] SEQ ID NO. 3: CCCAATGATCAAATTGTGGAAATTATAGTTGCAAAGCATGTAAATTCTCC C AATTTGCATCATCAAGAAAGGTGTTGGCCCATTCAACTAAGACCTCAGTA
[0033] SEQ ID NO. 4:
[0034] CCCAATGATCAAATTGTGGAAATTATAGTTGCAAAGCATGTAAATTCTCC T AATTTGCATCATCAAGAAAGGTGTTGGCCCATTCAACTAAGACCTCAGTA
[0035] SEQ ID NO. 5:
[0036] TCTTGATAACCTATTCTGCAGGAATGTATTGTACTCCTTCATTAATGTCA G ACCCAAATTTCCAAAATACCCTAACTCATGGAGAAGTCGGGGAGTTAATT
[0037] SEQ ID NO. 6:
[0038] TCTTGATAACCTATTCTGCAGGAATGTATTGTACTCCTTCATTAATGTCA C ACCCAAATTTCCAAAATACCCTAACTCATGGAGAAGTCGGGGAGTTAATT
[0039] SEQ ID NO. 7:
[0040] GACCCAACGATCGGGTCGAGTATGGGGTGTTACAATTTAGTGGTATCAGA A TTTCAATTTAGCTGATTATCTAGATGTATGAAGTTTTAAGACAAACCCTT
[0041] SEQ ID NO. 8:
[0042] GACCCAACGATCGGGTCGAGTATGGGGTGTTACAATTTAGTGGTATCAGA GTTTCAATTTAGCTGATTATCTAGATGTATGAAGTTTTAAGACAAACCCTT
[0043] SEQ ID NO. 9:
[0044] ACCCATGTATCCTTATCATCAATGGGCTTTAGAGCACTCTCCATAATGGC A TCCACATTCATGTTGTTTGAAGTCTGAGAATGACTTGACGATTGAGCAGA
[0045] SEQ ID NO. 10:
[0046] ACCCATGTATCCTTATCATCAATGGGCTTTAGAGCACTCTCCATAATGGC G TCCACATTCATGTTGTTTGAAGTCTGAGAATGACTTGACGATTGAGCAGA
[0047] SEQ ID NO. 11:
[0048] ATTGCTGCATGCGGGTACAAGCATGCTCTAGGAATGGACCGTGGGGTCAA G AACCCAAACTTACCTTTTAACTTACACCTCACCTGAATAAATTTGTCTCT
[0049] SEQ ID NO. 12:
[0050] ATTGCTGCATGCGGGTACAAGCATGCTCTAGGAATGGACCGTGGGGTCAA A AACCCAAACTTACCTTTTAACTTACACCTCACCTGAATAAATTTGTCTCT
[0051] SEQ ID NO. 13:
[0052] TATGCCCTTGACGATCATTAAAATGGGCCAACCCAACCGAGGCTTCCCCT A AAGTTACCTTTAACTGGTATAATCACTGGAAAATACGTATAAAGGGTTGC
[0053] SEQ ID NO. 14:
[0054] TATGCCCTTGACGATCATTAAAATGGGCCAACCCAACCGAGGCTTCCCCT G AAGTTACCTTTAACTGGTATAATCACTGGAAAATACGTATAAAGGGTTGC
[0055] SEQ ID NO. 15:
[0056] TAAAGTTACCTTTAACTGGTATAATCACTGGAAAATACGTATAAAGGGTT G CTCACCTTATGCTACAATCGATGAAATAGGCAACTAGGGTCCACCAAGAA
[0057] SEQ ID NO. 16:
[0058] TAAAGTTACCTTTAACTGGTATAATCACTGGAAAATACGTATAAAGGGTT A CTCACCTTATGCTACAATCGATGAAATAGGCAACTAGGGTCCACCAAGAA
[0059] SEQ ID NO. 17:
[0060] ATTCATTTTCGATTCAACACAAAATTCATTTTTGGTTTCAACGAACTAGC G AAGGGATCAATTAGACATATACAATTAGAGCTTAAATGATTTATAGTTAA
[0061] SEQ ID NO. 18:
[0062] ATTCATTTTCGATTCAACACAAAATTCATTTTTGGTTTCAACGAACTAGC A AAGGGATCAATTAGACATATACAATTAGAGCTTAAATGATTTATAGTTAA
[0063] SEQ ID NO. 19:
[0064] ACAAAAACTAGGAAGGGTTCTAGTTTAACCATAAAAACTAAGGGGTGGTT GTATCTTAGCATTGTAAAAAATATGGGGATTGTAAATGTTATACCTTATCC
[0065] SEQ ID NO. 20:
[0066] ACAAAAACTAGGAAGGGTTCTAGTTTAACCATAAAAACTAAGGGGTGGTT C TATCTTAGCATTGTAAAAAATATGGGGATTGTAAATGTTATACCTTATCC
[0067] SEQ ID NO. 21:
[0068] TCAGAAACATACACAGAACCAATATAAGTGTCTTAGGACCACACGCCCGT G TACTCTGGCCGTGTTGTAGAGGCACACGCCCATGTGAAGAGAGGCATACA
[0069] SEQ ID NO. 22:
[0070] TCAGAAACATACACAGAACCAATATAAGTGTCTTAGGACCACACGCCCGT A TACTCTGGCCGTGTTGTAGAGGCACACGCCCATGTGAAGAGAGGCATACA
[0071] SEQ ID NO. 23:
[0072] TTGCTAGTCATATATGAAAATCTTATTCATATCTAAAACTTGATACAATA T GGTAATGAAATCTGATAATTAATGCAAATGAACATGGAGACACTTGAGAT
[0073] SEQ ID NO. 24:
[0074] TTGCTAGTCATATATGAAAATCTTATTCATATCTAAAACTTGATACAATA A GGTAATGAAATCTGATAATTAATGCAAATGAACATGGAGACACTTGAGAT Example 1
[0075] 1. Cotton test material and cottonseed trait investigation
[0076] The natural population of cotton germplasm used was provided by the Medium-term Germplasm Bank of the Cotton Institute of the Chinese Academy of Agricultural Sciences, including 373 landrace cotton cultivar germplasms.
[0077] The 373 germplasms were planted in Alar, Xinjiang (AL18) and Anyang, Henan (AY18) in 2018, and Alar, Xinjiang (AL19), Anyang, Henan (AY19) and Dunhuang, Gansu (DH19) in 2019, respectively, according to the randomized block design, with two replicates for each material. Field management work including irrigation, pesticide spraying and trimming of cotton fruit branches was carried out according to the conventional management standards of the cotton growth period in each ecological point.
[0078] After the cotton seeds were harvested and de-carded, the length and width of the seeds were measured. Ten full seeds were selected for each material. The seed length (SL) was measured by measuring the length from the tip of the cotton seed to the base of the seed with an electronic vernier caliper. The seed top width (STW) was the diameter of the cotton seed at one quarter; the seed middle width (SMW) was the longest diameter at the middle position of the cotton seed; and the seed bottom width (SBW) was the diameter of the cotton seed at three quarters. In this way, the length and width of the cotton seeds of all samples in the natural population were measured.
[0079] 2. Whole-genome re-sequencing and SNP detection
[0080] Total genomic DNA was extracted from young leaves of each germplasm using the CTAB method. Subsequently, the samples were sent to a biological company for sequencing, and a 150-bp double-end sequencing library was constructed according to the instructions. Illumina HiSeq sequencing platform was used. After filtering low-quality double-end reads, clean data was obtained, with an average genome coverage depth of 14.6x.
[0081] The high-quality reads were aligned to the reference genome of Gossypium hirsutum TM-1 (CRI TM-1.v1.0; Yang et al., Nature Communications, 2019) using the BWA software. Based on the BAM file generated during the alignment process, SNP detection was performed at the population level using the GATK software. Finally, 1873184 high-quality SNPs (deletion rate ≤ 20% and minimum allele frequency (MAF) ≥ 0.05) were retained for subsequent analysis. The ANNOVAR software package was used to obtain the annotation information of the SNPs.
[0082] 3. Genome-wide association analysis of cottonseed length and width in upland cotton
[0083] Genome-wide association analysis was performed based on the length and width phenotypic data of cottonseed from 373 upland cotton accessions and genotypic data of 1,873,184 high-quality SNPs (MAF>0.05, deletion rate≤0.2), using -log10( P The Bonferronni correction threshold was approximately 7.5; loci with a value greater than 7.5 were considered significant. Significantly associated SNPs were screened across the entire genome. Results showed that 12 SNPs significantly associated with both cottonseed length and cottonseed width were identified within the A07:88738166-88763821 region on chromosome A07 (Table 2). The Manhattan diagram obtained from genome-wide association analysis is shown below. Figure 1 As shown.
[0084] Table 2. SNP markers significantly associated with the length and width of upland cotton seeds.
[0085]
[0086] Note: Hap1 base refers to materials carrying this type of base at the SNP site, which are classified as Hap1, and Hap2 base is classified as such; Hap1 quantity refers to the number of materials carrying the Hap1 base at the SNP site, and Hap2 quantity is classified as such; Hap1 phenotype refers to the cottonseeds of materials carrying the Hap1 base at the SNP site being longer and wider, and Hap2 phenotype refers to the cottonseeds of materials carrying the Hap2 base at the SNP site being shorter and narrower.
[0087] 4. Analysis of Chained Unbalanced Blocks (LD blocks)
[0088] Using Tassel 5.0, linkage disequilibrium analysis was performed on the candidate interval (A07:88738166-88763821) containing the SNP sites. The analysis revealed that the SNPs within this interval formed a strongly linked disequilibrium block (LDblock), with an LD coefficient (R07). 2 Higher (>0.8) Figure 2 (A) Molecular phylogenetic analysis and haplotype analysis were performed on the SNPs within the interval. Based on the typing results, the experimental material was divided into two haplotypes, Hap1 and Hap2. Figure 2 (B in the middle).
[0089] In AL18 environment, the average length of cottonseed of the material carrying Hap1 was 9.921 mm, the average middle width of cottonseed was 5.201 mm, the average length of cottonseed of the material carrying Hap2 was 9.406 mm, the average middle width of cottonseed was 5.043 mm; in DH19 environment, the average length of cottonseed of the material carrying Hap1 was 9.060 mm, the average middle width of cottonseed was 4.958 mm, the average length of cottonseed of the material carrying Hap2 was 8.680 mm, the average middle width of cottonseed was 4.841 mm. By comparing the length and width of cottonseed between different haplotypes through significance test (two-tailed T test), it was found that the length and width of cottonseed of Hap1 were extremely significantly greater than those of Hap2 (P<0.001, Figure 2 C in the formula (I). Example 2
[0090] Application of SNP marker significantly associated with length and width of cottonseed in segregating population
[0091] The F 2:3 The length and width of cottonseed of the offspring were identified.
[0092] When the base of the SNP molecular marker is one of SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11, SEQ ID NO. 13, SEQ ID NO. 15, SEQ ID NO. 17, SEQ ID NO. 19, SEQ ID NO. 21 or / and SEQ ID NO. 23 at the 51st position, the cottonseed of the offspring strain is longer and wider; when the base of the SNP molecular marker is one of SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10, SEQ ID NO. 12, SEQ ID NO. 14, SEQ ID NO. 16, SEQ ID NO. 18, SEQ ID NO. 20, SEQ ID NO. 22 or / and SEQ ID NO. 24 at the 51st position, the cottonseed of the offspring strain is shorter and narrower.
[0093] The above shows that the SNP molecular marker can identify the length and width of cottonseed of Gossypium hirsutum in early generations of segregating population, and can be applied to marker-assisted selection.
[0094] The above described embodiments are only to illustrate the preferred modes of the present application, and are not intended to limit the scope of the present application. Any modification and improvement made by those skilled in the art to the technical solutions of the present application without departing from the design spirit of the present application shall fall within the protection scope of the present application.
Claims
1. The application of primer pairs for amplifying SNP molecular marker combinations in the preparation of products for identifying the length and width traits of upland cotton seeds, characterized in that, The SNP molecular marker combination consists of 12 SNP sites, which are shown in the table below: The physical location of the SNP site was determined based on chromosome A07 of the Gossypium hirsutum AD1 'TM-1' genome CRI_v1 reference genome of upland cotton. When the base of the SNP site is Hap1, the upland cotton seed is longer and wider, and when the base of the SNP site is Hap2, the upland cotton seed is shorter and narrower.
2. The application according to claim 1, characterized in that, The products include upland cotton genome detection kits or upland cotton whole genome SNP chips.
3. A method for identifying the length and width of upland cotton seeds, characterized in that, The method includes the following steps: (1) Genomic DNA was extracted from the leaves of upland cotton. (2) Using genomic DNA as a template, amplify the DNA fragment containing the SNP site described in claim 1 by PCR technology to obtain the PCR product; (3) The PCR products were detected using a fluorescence detection platform, and the length and width of upland cotton seeds were determined based on the polymorphism of the SNP molecular markers reflected by the obtained fluorescence signals. (4) When the base at the SNP site is Hap1, the upland cotton seed is longer and wider; when the base at the SNP site is Hap2, the upland cotton seed is shorter and narrower. The SNP sites are shown in the table below: 。
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker simultaneously associated with oil content and protein content of cottonseed kernel of upland cotton and application of SNP molecular marker
CN118621056A
Low-density liquid-phase chip for gossypium hirsutum l. based on targeted capture sequencing and use thereof
US20250215514A1