Salinia sp. CTD02-R1 and application thereof in synthesis of silver / silver chloride nanoparticles
By screening and utilizing the CTD02-R1 strain of Halophora salinarum and optimizing light, pH value and silver ion concentration, efficient biosynthesis of silver/silver chloride nanoparticles was achieved, solving the problem of silver nanoparticle synthesis in extreme environments and demonstrating its application potential in the field of nanotechnology.
Patent Information
- Application Number
- CN202510847880.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-24
- Publication Date
- 2025-09-23
AI Technical Summary
Existing technologies lack efficient microbial pathways for synthesizing silver nanoparticles, especially in extreme environments, where it is difficult to utilize marine microbial resources for the biosynthesis of silver nanoparticles.
The CTD02-R1 strain of Halomonas sp. from the western Pacific Ocean-Mariana Sea was screened and utilized. This strain is capable of synthesizing silver/silver chloride nanoparticles under different conditions. The synthesis process is optimized by controlling light, pH value and silver ion concentration to achieve efficient catalytic performance.
The synthesized silver/silver chloride nanoparticles are uniformly dispersed and have efficient catalytic properties, which can significantly accelerate the degradation of rhodamine B, demonstrating its application potential in the field of nanotechnology.
Smart Images

Figure CN120682986A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a salt-field bacterium CTD02-R1 and an application thereof in synthesizing silver / silver chloride nanoparticles. Background Art
[0002] The polymetallic nodule area of the Western Pacific Ocean and Mariana Sea is rich in various metal elements. Its bottom waters are oxygenated by the influence of Antarctic bottom water, and strong bottom currents frequently interrupt sedimentation. These factors together promote the formation of iron-manganese oxides and the enrichment of key metal elements. Long-term exposure to extreme conditions such as low temperature, high salinity, high oxygen levels, and possible exposure to special radiation conditions has led to the evolution of unique physiological and biochemical characteristics in local marine bacteria. These bacteria can adapt to the harsh living environment by mitigating oxidative damage and the toxicity of reactive oxygen species through processes such as biomineralization. Microorganisms play a key role in the formation of polymetallic nodules. Their metabolic and secretory activities not only alter the redox conditions of the surrounding environment, promoting metal accumulation, but also directly participate in the biomineralization process.
[0003] Microorganisms in nodule-bearing areas exposed to polymetallic environments over a long period of time often possess metal resistance or the ability to metabolize metals. These microorganisms have evolved robust multimetal resistance mechanisms, enabling them to reduce and mineralize metal ions, such as silver, through their own physiological and biochemical processes. This trait not only aids the microorganisms' survival in metal-stressed environments but also facilitates the biosynthesis of silver nanoparticles. Therefore, screening for silver-reducing strains from the polymetallic nodule region of the Western Pacific Ocean and the Mariana Sea is of great significance. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to provide a salt pan bacterium CTD02-R1 and its application in synthesizing silver / silver chloride nanoparticles.
[0005] The present invention is achieved through the following technical solutions:
[0006] A strain of Salt Field Bacteria CTD02-R1, which was deposited in the China Type Culture Collection of Wuhan University, China on June 9, 2025, with the deposit number CCTCC NO: M20251318.
[0007] The present invention also provides the use of the strain CTD02-R1 in biosynthesis of silver / silver chloride nanoparticles.
[0008] Silver / silver chloride nanoparticles (Ag / AgClNPs) are synthesized by the CTD02-R1 strain of the genus Halomonas halogenans.
[0009] The beneficial effects of the present invention compared with the prior art are as follows:
[0010] The strains of the present invention not only provide a new approach and unique microbial resource for the bioproduction of nanomaterials, but also further deepen our understanding of the development and utilization of microbial resources in special environments. By screening and utilizing these multi-metal-resistant strains, silver nanoparticles can be efficiently synthesized, providing a new biosynthetic strategy for the field of nanotechnology. The strains of the present invention are capable of synthesizing silver / silver chloride nanoparticles with uniform and well-dispersed particles and high catalytic performance. BRIEF DESCRIPTION OF THE DRAWINGS
[0011] Figure 1 Phylogenetic tree of silver ion-reducing strains based on 16S rRNA gene sequences;
[0012] Figure 2 UV-vis spectra of the mixture of strain supernatant and silver nitrate after incubation for 24 h under light and dark conditions;
[0013] Figure 3 Effects of different pH conditions on the synthesis of silver nanomaterials (A) and the relationship between the absorbance of silver nanomaterials at 410 nm and pH (B);
[0014] Figure 4 Different Ag + Effect of concentration on the synthesis of silver nanomaterials (A) and the absorbance of silver nanomaterials at 410nm and Ag + Fitting curve of concentration (B);
[0015] Figure 5 UV-vis spectra of Rhodamine B (RhB) decolorized by silver nanomaterials (A) and fitting curve of the absorbance of Rhodamine B at 554 nm versus time (B);
[0016] Figure 6 UV-vis spectrum of Rhodamine B decolorization without the addition of silver nanomaterials (A) and the fitting curve of the absorbance of Rhodamine B at 554 nm versus time (B);
[0017] Figure 7 Pseudo-first-order linear curve of degradation of Rhodamine B dye catalyzed by silver nanomaterials
[0018] Figure 8 Curve of Rhodamine B decolorization rate changing with time;
[0019] Figure 9 Transmission electron microscopy images of silver / silver chloride nanoparticles;
[0020] Figure 10 X-ray energy spectrum of silver / silver chloride nanoparticles;
[0021] Figure 11 X-ray diffraction pattern of silver / silver chloride nanoparticles. DETAILED DESCRIPTION
[0022] The technical solution of the present invention is further explained below through embodiments in combination with the accompanying drawings, but the protection scope of the present invention is not limited in any form by the embodiments.
[0023] Using seawater and sediment samples from the Mariana Sea in the western Pacific Ocean, different microbial species were isolated, cultured, and purified. From these, strains capable of reducing silver ions and forming nanoparticles were screened. The effects of light, pH, and silver ion concentration on the synthesized nanoparticles were investigated, and the catalytic activity of the resulting nanoparticles was evaluated. This study aims to provide a reference for the research, development, and utilization of the rich marine microbial resources.
[0024] The culture medium formula used is as follows:
[0025] MA medium: 5 g tryptone, 1 g yeast powder, 1 L ultrapure water (add 15 g / L agar for solid medium);
[0026] YP medium: 10 g tryptone, 5 g yeast powder, 1 L ultrapure water.
[0027] Example 1 Screening for strains that synthesize silver / silver chloride nanoparticles
[0028] 1. Sample source
[0029] The seawater samples and soil sample sediments were collected from June to July 2024 and originated from the Western Pacific-Mariana Sea.
[0030] 2. Screening method
[0031] (1) Strain enrichment, culture, isolation and purification
[0032] Microorganisms from seawater samples were cultured in situ. Fresh seawater was diluted in a series of dilutions, and appropriate dilutions were spread onto MA solid culture medium and incubated in a 20°C incubator. Sediment samples were cultured by adding approximately 1g of sediment and soil sample to MA liquid culture medium, shaking well, and incubating in a shaker at 20°C and 150 rpm for 7 days. Based on the turbidity of the culture medium, the culture medium was diluted in a series of dilutions with sterile water. The appropriate dilutions were spread evenly onto MA solid culture medium and incubated in a 20°C incubator. Single colonies were selected based on their morphological characteristics and further isolated and purified to obtain pure strains.
[0033] (2) Screening of strains producing nanosilver
[0034] The pure strain obtained by culture was inoculated into YP medium and cultured in a constant temperature shaker at 20℃ and 150r / min for 1-2 days. The bacterial solution was centrifuged in a centrifuge at 4℃ and 12000rpm for 20min to remove the precipitate. The supernatant was filtered with a 0.22μm filter membrane. AgNO3 solution was added to the cell-free supernatant to make Ag + The final concentration was 2 mmol / L. The reaction solution was incubated in a constant-temperature incubator at 1200 Lux and 20°C for 48 hours. The UV-visible spectrum of the reaction solution was scanned on a UV-visible spectrophotometer over a wavelength range of 300–700 nm. The presence of a surface plasmon resonance absorption peak at 410 nm was used to assess silver ion reduction and silver nanoparticle formation. A YP culture medium treated in the same manner was used as a negative control.
[0035] A total of 70 strains were obtained from seawater and sediment samples collected from the western Pacific Ocean through enrichment culture and isolation techniques. These strains were cultured in YP medium until OD 600 The supernatant of each strain was then mixed with a 2 mmol / L AgNO3 solution and incubated under light. Preliminary screening of the strains for their ability to synthesize silver nanoparticles using UV-vis spectroscopy revealed that 20 strains exhibited synthesis activity, with CTD02-R1 being a representative example of strains with high silver nanoparticle production activity.
[0036] Experiments have preliminarily demonstrated that strain CTD02-R1 has the ability to reduce silver ions and synthesize silver nanoparticles under light. Strain CTD02-R1 was isolated from a seawater sample at a depth of 1000 meters at station DY86-I-MCCTD02. Strain CTD02-R1 belongs to the genus Salinicola sp. Information on the strain and its taxonomic status can be found at Figure 1 The strain was deposited in the China Type Culture Collection of Wuhan University, China on June 9, 2025. The deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit number is CCTCC NO: M20251318.
[0037] The strain is Gram-negative, the colonies are light yellow in color, regular in shape, smooth in surface, neat in edge, slightly convex and shiny.
[0038] The 16S rRNA sequence of strain CTD02-R1 is as follows:
[0039] CGGGGGGCAGTCTAACACATGCAGTCGAGCGGCAGCACGGGG
[0040] AGCTTGCTCCCTGGTGGCGAGCGGCGGACGGGTGAGTAATGCA
[0041] TAGGAATCTGCCCGGTAGTGGGGGATAACGTGGGGAAACCCAC
[0042] GCTAATACCGCATACGTCCTACGGGAGAAAGCAGGGGATCTTCG
[0043] GACCTTGCGCTATCGGATGAGCCTATGTCGGATTAGCTAGTTGGT
[0044] AAGGTAACGGCTTACCAAGGCGACGATCCGTAGCTGGTCTGAG
[0045] AGGATGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCC
[0046] TACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGC
[0047] CTGATCCAGCCATGCCGCGTGTGTGAAGAAGGCTTTCGGGTTGT
[0048] AAAGCACTTTCAGCGAGGAAGAAAGCCTCTGGGTTAATAACTTC
[0049] AGAGGAAGGACATCACTCGCAGAAGAAGCACCGGCTAACTCC
[0050] GTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCG
[0051] GAATTACTGGGCGTAAAGCGCGCGTAGGTGGCTTGGCACGCCG
[0052] GTTGTGAAAGCCCCGGGCTCAACCTGGGAACGGCATCCGGAAC
[0053] GGCCAGGCTAGAGTGCAGGAGGAGGAAGGTAGAATTCCCGGTGT
[0054] AGCGGTGAAATGCGTAGAGATCGGGAGGAATACCAGTGGCGAA
[0055] GGCGGCCTTCTGGCCTGACACTGACACTGAGGTGCGAAAGCGT
[0056] GGGTAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAA
[0057] ACGATGTCGACTAGCCGTTGGGACCTTTAAGGACTTAGTGGCGC
[0058] AGTTAACGCGATAAGTCGACCGCCTGGGGAGTACGGCCGCAAG
[0059] GTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGG
[0060] AGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACC
[0061] CTTGACATCCAGAGAAGTTGGCAGAGATGCCTTCGTGCCTTCG
[0062] GGAACTCTGAGACAGGTGCTGCATGGCTGTCGTCAGCTCGTGT
[0063] TGTGAAATGTTGGGTTAAGTCCCGTAACGAGCGCAACCCTTGTC
[0064] CTTATTTGCCAGCGAGTAATGTCGGGAACTCTAAGGAGACTGCC
[0065] GGTGACAAACCGGAGGAAGGTGGGGACGACGTCAAGTCATCA
[0066] TGGCCCTTACGGGTAGGGCTACACACGTGCTACAATGGCCGGTA
[0067] CAAAGGGTTGCGAGACCGCGAGGTGGAGCGAATCCCAGAAAG
[0068] CCGGCCTCAGTCCGGATCGGAGTCTGCAACTCGACTCCGTGAA
[0069] GTCGGAATCGCTAGTAATCGTGAATCAGAATGTCACGGTGAATA
[0070] CGTTCCCGGGCCTTGTACACACCGCCCGTCACACCATGGGAGT
[0071] GGACTGCACCAGAAGTGGTTAGCTTAACCTTCGGGAGAGCGAT
[0072] CACCACGGTGGTACCG.
[0073] The growth temperature experiment of strain CTD02-R1 was set at 5℃, 15℃, 20℃, 25℃, and 35℃, and cultured in a constant temperature shaker at 150rpm. The results showed that strain CTD02-R1 grew slowly at 5℃ and 35℃, and the optimal growth temperature was 25℃.
[0074] 3. Synthesis conditions of silver nanoparticles
[0075] (1) Light
[0076] The culture supernatant of a strain identified in the preliminary screening for silver nanoparticle synthesis was mixed with an AgNO₃ solution and incubated in a constant-temperature incubator at 1200 Lux and 25°C for 24 hours. A light-exposed group (A) and a foil-sealed dark group (B) were designated. Identically treated YP culture medium served as a light-exposed control (A) and a dark-exposed control (B). The absorption spectrum of the reaction solution was measured using UV-visible spectrophotometry within the 300-700 nm wavelength range.
[0077] Depend on Figure 2 As can be seen, the synthesis reaction solution of strain CTD02-R1 (A) exhibits a characteristic absorption peak at a wavelength of 410 nm, indicating that this strain has the ability to synthesize silver nanoparticles. Compared with the light control (A), the appearance of this characteristic absorption peak further confirms that CTD02-R1 can effectively synthesize silver nanoparticles under light conditions. However, when the light is removed, the reaction solution of CTD02-R1 still exhibits a characteristic absorption peak at 410 nm compared with the dark control (B). Although its silver ion reduction ability and nanosilver synthesis ability are reduced, this phenomenon indicates that CTD02-R1 still has the potential to synthesize silver nanoparticles in the dark. Therefore, it can be preliminarily inferred that strain CTD02-R1 not only exhibits a strong ability to synthesize silver nanomaterials under light conditions, but also shows some potential in the dark, although its efficiency is reduced.
[0078] (2) pH value
[0079] The culture supernatant was mixed with 2 mmol / L AgNO₃. The pH of the reaction solution was then adjusted to 3.0, 5.0, 7.0, 9.0, and 11.0 using dilute nitric acid and sodium hydroxide. After incubation for 24 hours in a light-controlled shaking incubator at 25°C and 150 rpm, the optimal pH for the production of silver nanomaterials was determined based on UV-visible spectroscopic results.
[0080] Depend on Figure 3 As shown in (A), after controlling a single variable, it was found that under the acidic condition of pH = 3.0, the reaction solution did not have a characteristic absorption peak around 410nm, the reaction solution did not undergo a significant color change, and flocculent precipitates appeared. It was preliminarily judged that the acidic conditions were not suitable for the synthesis of nanosilver materials. As the pH increased, the color of the reaction solution gradually deepened, no insoluble precipitate appeared, and characteristic absorption peaks began to appear. Figure 3 As can be seen in (B), when pH = 11.0, the characteristic absorption peak intensity of the reaction solution at a wavelength of 410nm is lower than that of the reaction solutions at pH = 7.0 and pH = 9.0, and the absorption peak intensity at pH = 9.0 is higher than that at pH = 7.0. This suggests that pH = 9.0 may be the optimal condition for synthesizing nanosilver materials, while overly alkaline conditions (such as pH = 11.0) are not conducive to the formation of nanosilver and may inhibit the synthesis of nanosilver.
[0081] (3) Silver ion concentration
[0082] AgNO₃ solution was added to the culture supernatant to achieve final silver ion concentrations of 1 mmol / L, 2 mmol / L, 4 mmol / L, 6 mmol / L, 8 mmol / L, and 10 mmol / L, respectively. After 24 hours of incubation in a light-controlled shaking incubator at 25°C and 150 rpm, the synthesis of silver nanoparticles was characterized using a UV spectrophotometer.
[0083] Depend on Figure 4 (B) shows that as the concentration of AgNO3 increases, the characteristic absorption peak of the reaction solution at a wavelength of 410nm continues to increase. Figure 4 (A), 1mmol / LAg + The reaction solution with the concentration of 10mmol / LAg has the lowest absorption peak and the lightest color. + The reaction solution with the highest concentration has the darkest color and the highest absorption peak. This indicates that the concentration of silver ions has a significant effect on the amount of synthesized silver nanoparticles. The higher the silver ion concentration, the more silver nanoparticles are synthesized. This may be due to the fact that +The increase in concentration increases the number of collisions between the reducing factor and the silver ions in the reaction system. At the same time, there are enough reducing substances and capping substances in the reaction system to generate nanosilver. + As the concentration increased, the characteristic absorption peak of silver nanoparticles at 410nm did not undergo a significant blue or red shift, indicating that the nanoparticle size did not change significantly and the reaction system was stable. The stable reaction system of Salinicola sp. CTD02-R1 provides a controllable platform for the synthesis of silver nanomaterials, enabling direct control of the synthesis rate by adjusting the silver ion concentration, thus facilitating large-scale production.
[0084] 4. Evaluation of catalytic activity of nanosilver materials
[0085] Mix 20 mL of a 100 mg / L rhodamine B (RhB) solution with 20 mL of a 50 mmol / L sodium bicarbonate (NaBH4) solution and dilute to 100 mL with ultrapure water. The mixture was divided equally into two groups, A and B. Group A was treated with silver nanoparticles to a final concentration of 0.025 mg / L, while Group B remained untreated. Both groups were reacted in a dark water bath at 40°C. The RhB absorbance peak at 554 nm was monitored using a UV-visible spectrophotometer within the range of 450–600 nm.
[0086] RhB dye has an absorption peak at 554nm, and the solution is bright rose red. Figure 5 (A1) and (A2) show that after adding Ag / AgClNPs, the absorbance of RhB solution dropped significantly within 6 minutes, and the color changed from rose red to colorless, indicating that the degradation was basically completed. Figure 6 In the control groups (B1) and (B2), the absorbance at 554 nm slowly decreased and stopped after 30 minutes. The color of the solution became lighter but still remained light pink. Figure 7 The pseudo-first-order kinetic curve showed that the kinetic rate constant of Ag / AgClNPs-catalyzed RhB degradation was 8.22×10-1min -1 , much higher than the control group's 0.59×10-1min -1 . Figure 8 The results showed that the decolorization rate of RhB catalyzed by Ag / AgClNPs reached 99.87% in 8 minutes, while the control group was 32.85% in 8 minutes and 80.99% in 30 minutes, which once again proved that Ag / AgCl nanoparticles have high catalytic activity.
[0087] Example 2
[0088] 1. Transmission electron microscopy (TEM)
[0089] TEM technology was used to characterize the particle size, morphology and monodispersity of the nanomaterials in the reaction solution in detail. The synthesized nanomaterial solution was dripped onto a copper mesh (200 mesh) covered with a carbon film, and then the excess liquid was gently absorbed with filter paper, and the copper mesh was placed in a dryer for drying. Depending on the concentration of the reaction solution, this process can be repeated 1 to 3 times. The morphology of the nanoparticles was observed using a transmission electron microscope (TEM) at an accelerating voltage of 100KV. Figure 9 It can be clearly seen in the images that the silver nanomaterials exhibit regular round or nearly round particles with good monodispersity and no obvious aggregation. This indicates that the natural capping agent in the solution played an effective capping role during the synthesis of the nanoparticles, thereby ensuring the stability and dispersibility of the nanoparticles.
[0090] 2. Energy Dispersive Spectroscopy (EDS)
[0091] X-ray energy spectrum was used to identify the elements of nanosilver materials. The reaction solution was placed in a 1:5 volume acetone solution and centrifuged at 12000r / min for 15 minutes to obtain preliminarily purified nanoparticles. The centrifugation operation was then repeated using deionized water to remove impurities on the surface of the nanoparticles and silver ions in the solution. The nanoparticles obtained by centrifugation were frozen in a -80°C refrigerator and then placed in a vacuum freeze dryer to obtain a sample with higher purity through freeze drying. Figure 10 As shown in the figure, X-ray energy spectrum analysis results show a characteristic optical absorption peak of Ag at around 3keV, and the presence of Cl in the nanoparticles, with the two elements accounting for 5.31% and 4.43% of the total nanoparticle mass, respectively. The strong C and O signals may originate from proteins or other organic matter attached to the nanoparticles.
[0092] 3. X-ray diffraction and diffraction patterns (XRD)
[0093] The crystal phase composition and crystal structure of silver nanoparticles can be further confirmed by X-ray diffraction and its spectrum analysis. JCPDS (Joint Committee on Powder Diffraction Standards) provides diffraction data of various substances for X-ray diffraction analysis, which are also called JCPDS cards. Figure 11As shown, the XRD pattern shows characteristic absorption peaks at 2θ = 32.243°, 46.233°, 54.828°, 57.478°, 67.471°, 74.471° and 76.734°, which correspond to the (200), (220), (311), (222), (400), (331) and (420) crystal planes of silver chloride (AgCl), respectively, which are basically consistent with the data of AgCl solid (31-1238) in the JCPDS file. In addition, characteristic absorption peaks were also observed at 2θ = 38.116°, 44.277°, 64.426°, and 77.472°, which match the characteristics of face-centered cubic silver (04-0783) in the JCPDS card and correspond to the (111), (200), (220), and (311) crystal planes, respectively, indicating the presence of elemental silver with a face-centered cubic structure in the nanoparticles.
[0094] In summary, the nanoparticles synthesized by strain CTD02-R1 are actually nanosized silver and silver chloride, namely biogenic silver / silver chloride nanoparticles (Ag / AgCl NPs).
Claims
1. A strain of salt field bacteria CTD02-R1, characterized in that: The strain was deposited in the China Center for Type Culture Collection on June 9, 2025, and its deposit number is CCTCC NO:M20251318.
2. The use of the salt field bacteria CTD02-R1 according to claim 1, characterized in that The application is to synthesize silver / silver chloride nanoparticles using the salt field bacteria CTD02-R1.
3. A silver / silver chloride nanoparticle, characterized in that: The silver / silver chloride nanoparticles are synthesized by the salt field bacteria CTD02-R1 described in claim 1.