Isoeugenol monooxygenase mutant and application thereof in preparation of vanillin

By performing site-directed mutagenesis on isoeugenol monooxygenase, a highly selective and active isoeugenol monooxygenase mutant was designed, which solved the problem of low selectivity of the existing enzyme for cis-isoeugenol and achieved the effect of efficient catalytic production of vanillin.

CN120683065APending Publication Date: 2025-09-23SHANGHAI HEMEI BIOTECHNOLOGY CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510837750.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-23
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

Existing isoeugenol monooxygenases have low selectivity for cis-isoeugenol, which limits their widespread use in industrial applications.

Method used

By performing site-directed mutagenesis on the amino acids around the active site of isoeugenol monooxygenase and using alanine scanning and consensus alignment methods, highly selective and active isoeugenol monooxygenase mutants were designed, including I59L, L470I and I59L/L470I mutants.

Benefits of technology

The mutant I59L/L470I significantly improved the selectivity and specific activity for cis-isoeugenol, and can efficiently catalyze isoeugenol to produce vanillin in a wide temperature and pH range, with a conversion rate of 100%, meeting the needs of industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120683065A_ABST
    Figure CN120683065A_ABST
Patent Text Reader

Abstract

The invention relates to an isoeugenol monooxygenase mutant and an application of the isoeugenol monooxygenase mutant in preparation of vanillin. In particular to an isoeugenol monooxygenase mutant, nucleic acid for coding the isoeugenol monooxygenase mutant, a recombinant expression vector containing the nucleic acid, a recombinant expression transformant containing the recombinant expression vector, an isoeugenol monooxygenase mutant catalyst and preparation of the isoeugenol monooxygenase mutant catalyst. The invention also discloses an application of the isoeugenol monooxygenase mutant or the isoeugenol monooxygenase mutant catalyst in preparation of vanillin by taking isoeugenol as a substrate. The specific activity of the mutant I59L / L470I is 1.32 times that of a parent, and the selectivity of the mutant I59L / L470I is 1.40 times that of the parent. The mutant enzyme can catalyze propenyl on a benzene ring of a substrate isoeugenol so as to generate vanillin, the isoeugenol can be used as the substrate, and the isoeugenol can be completely converted to synthesize vanillin under the conditions that the reaction temperature is 25 DEG C, the pH value is 10.0, the cell quantity is 20g / L and the conversion time is 8 hours. And the conversion rate can reach 100% under the condition that the substrate concentration is 100mM, so that the method has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to an isoeugenol monooxygenase mutant and its use in the preparation of vanillin. Specifically, the present invention relates to an isoeugenol monooxygenase mutant, a nucleic acid encoding the isoeugenol monooxygenase mutant, a recombinant expression vector containing the nucleic acid, a recombinant expression transformant containing the recombinant expression vector, an isoeugenol monooxygenase mutant catalyst and its preparation, and the use of the isoeugenol monooxygenase mutant or the isoeugenol monooxygenase mutant catalyst in the preparation of vanillin using isoeugenol as a substrate. Background Art

[0002] Isoeugenol Monooxygenase (IEM) is abbreviated as IEM. 2+ It can directly participate in the catalytic process as an electrophile, and can catalyze the oxidation and cleavage of isoeugenol to produce vanillin in the absence of coenzymes or cofactors. Vanillin (4-hydroxy-3-methoxybenzaldehyde), also known as vanillin, is widely used in the food, chemical and pharmaceutical fields due to its unique aroma and properties: in the food industry, it is used as a flavoring agent for ice cream, cakes, etc.; in the chemical industry, it is used to detect resorcinol and tannic acid; in the pharmaceutical field, it is an important synthetic intermediate for dopamine, anti-epileptic drugs, etc. For example, it can be used to prepare dopamine, anti-epileptic drugs, etc. (Huang Xishun, Huang Lijuan, Wei Jianke. Observation on the efficacy of vanillin in the treatment of epilepsy [J]. Journal of Practical Neurological Diseases, 2005, 8(4):78.).

[0003] Currently, most vanillin on the market is chemically synthesized. Studies have found that high doses of chemically synthesized vanillin can cause adverse reactions such as headaches, vomiting, and breathing difficulties, which are very harmful to the human body. Therefore, in recent years, consumers have increasingly called for natural flavors, leading to a significant increase in the demand for natural vanillin.Natural vanillin is mainly found in vanilla beans and can be extracted by supercritical CO2 extraction technology (Fu Shiliang, Zhou Jiang, Huang Maofang, et al. Process research and component analysis of supercritical CO2 extraction of vanilla [J]. Food and Machinery, 2002 (2): 12-14.), accelerated solvent extraction (Bitwell, Chibuye, et al. "A review of modern and conventional extraction techniques and their applications for extracting phytochemicals from plants." Scientific African 19 (2023): e01585.), supercritical fluid extraction (Moreira RC, de Melo RPF, Martínez J, Marostica Junior MR, Pastore GM, Zorn H et al (2023) Supercritical CO2 as a Valuable Tool for Aroma Technology. Journal of Agricultural and Food Chemistry. 71: 9201–9212.), and ultrasound-assisted extraction (Ratphitagsanti W, Chantrapornchai W, Promjan I, et al. al.Vanillin extraction from Thai vanilla pods using ohmicheating followed by ultrasound-or microwave-assisted extraction[J].Agriculture and Natural Resources,2024,58(2):165–174-165–174.) and enzyme-assisted extraction (Pardío,Violeta T.,et al."Effect of endogenous and exogenous enzymatic treatment of green vanilla beans on extraction of vanillin and main aromatic compounds."Journal of Food Science and Technology 55(2018):2059-2067.). However, plant extraction methods are limited by raw material supply and processing costs and cannot be applied to the market.Vanillin produced by plant extraction is still mainly used in high-end food, fine perfume and other lucrative markets.

[0004] With the rapid development of biocatalysis technology, it can carry out efficient and rapid reactions in a shorter time, and has the advantages of being green, environmentally friendly, highly selective and specific, making this method more suitable for commercial production.

[0005] Isoeugenol is the best precursor for synthesizing vanillin, and IEM is the only key enzyme for the biotransformation of isoeugenol. The vanillin synthesized by this method is closest to natural vanillin in aroma, and therefore has attracted widespread attention.

[0006] Chinese patent CN113151201B discloses an isoeugenol monooxygenase mutant and its application. The isoeugenol monooxygenase gene from Pseudomonas nitroreducens Jin1 was subjected to site-directed mutagenesis, resulting in a mutation in the encoded amino acid sequence from lysine K to arginine R at position 83, from lysine K to arginine R at position 95, and from leucine to phenylalanine F at position 273. This isoeugenol monooxygenase mutant can catalyze the oxidation of the propenyl group on the benzene ring of the substrate isoeugenol over a wide temperature range under the action of oxygen to produce vanillin.

[0007] However, in the prior art, isoeugenol monooxygenase has certain defects. Its selectivity for cis-isoeugenol is low, and chemically synthesized isoeugenol contains about 10% cis-isoeugenol, which limits its industrial application. Summary of the Invention

[0008] Based on the current situation that isoeugenol monooxygenase has low selectivity for cis-isoeugenol and its activity needs to be improved, the present invention provides an isoeugenol monooxygenase mutant and its application in the preparation of vanillin.

[0009] Specifically, the present invention relates to an isoeugenol monooxygenase mutant, a nucleic acid encoding the isoeugenol monooxygenase mutant, a recombinant expression vector containing the nucleic acid, a recombinant expression transformant containing the recombinant expression vector, an isoeugenol monooxygenase mutant catalyst and its preparation, and use of the isoeugenol monooxygenase mutant or the isoeugenol monooxygenase mutant catalyst in the preparation of vanillin using isoeugenol as a substrate.

[0010] The present invention adopts alanine scanning and consensus alignment around the active site as a rational design method, and with the help of bioinformatics software, obtains an isoeugenol monooxygenase mutant with high selectivity for the cis configuration and high activity.

[0011] The purpose of the present invention can be achieved by the following technical solutions:

[0012] Technical solution 1 of the present invention: provides an isoeugenol monooxygenase mutant.

[0013] The present invention is based on the principle of alanine scanning around the substrate molecule, and the amino acids around the substrate are all mutated to alanine Ala. Molecular docking is performed using YASARA software to find a total of 12 amino acids around the substrate molecule, and site-directed mutagenesis is performed on them respectively. Based on the principle that conservative amino acids are more stable than non-conservative amino acids in homologous sequences, BLAST is performed on the amino acid sequence of IEM in NCBI, the top 100 sequences in the results are selected, and Expresso is used to perform multiple sequence alignment in the multiple sequence alignment tool TCOFFEE. According to the position that is conservative in the multiple sequence alignment but different from the target protein sequence, it is used as the mutation site. After being site-directedly mutated into the corresponding conserved amino acids, a mutant enzyme with improved enzyme activity and a mutant enzyme with improved selectivity for cis-isoeugenol are obtained. After the above two amino acid combinations are mutated, the present invention obtains a two-site mutant with improved selectivity for cis-isoeugenol and improved specific activity, which solves the problem that the existing IEM has poor selectivity for cis-isoeugenol and cannot meet the problem of industrial production.

[0014] Specifically, the isoeugenol monooxygenase mutant provided by the present invention is selected from one of the following:

[0015] (1) mutating the amino acid position 59 of the amino acid sequence shown in SEQ ID No. 1 from isoleucine I to leucine L;

[0016] (2) mutating position 470 of the amino acid sequence shown in SEQ ID No. 1 from leucine L to isoleucine I;

[0017] (3) The amino acid sequence shown in SEQ ID No. 1 at position 59 was mutated from isoleucine I to leucine L, and the amino acid sequence at position 470 was mutated from leucine L to isoleucine I.

[0018] The amino acid sequence of the parent isoeugenol monooxygenase IEM is shown in SEQ ID No. 1. It is an isoeugenol monooxygenase derived from Pseudomonas nitroreducens Jin1.

[0019] The isoeugenol monooxygenase mutants are represented by the naming method of "original amino acid abbreviation + mutation position + replacement amino acid abbreviation", that is, the mutants obtained in the present invention include I59L (or IEM I59L )、L470I(or expressed as IEM L470I )、I59L / L470I(or expressed as IEMI59L / L470I ).

[0020] The amino acid sequence of mutant I59L is shown in SEQ ID No. 3, the amino acid sequence of mutant L470I is shown in SEQ ID No. 5, and the amino acid sequence of mutant I59L / L470I is shown in SEQ ID No. 7.

[0021] In the present invention, the isoeugenol monooxygenase mutant with improved specific activity and thermal stability is obtained by subjecting the parent isoeugenol monooxygenase IEM to site-directed mutagenesis, wherein the 59th position of IEM is mutated from isoleucine I to leucine L, and the 470th position of another mutant is mutated from leucine L to isoleucine I through seamless cloning technology.

[0022] The specific activity of the parent (isoeugenol monooxygenase IEM from Pseudomonas nitroreducens Jin1) was 5.95±0.07 U / mg. Compared with the isoeugenol monooxygenase IEM, the specific activities of the isoeugenol monooxygenase mutants I59L, L470I and I59L / L470I were 7.35±0.06 U / mg, 5.3±0.07 U / mg and 7.87±0.05 U / mg, respectively. Among them, the mutant I59L / L470I showed the best specific activity, which was increased by 32.3% compared with the parent.

[0023] Compared to the isoeugenol monooxygenase IEM, the conversion efficiencies of the parent IEM and mutants I59L, L470I, and I59L / L470I for cis-isoeugenol (containing 50% cis-isomer) were 53%, 47%, 69%, and 74%, respectively. The I59L / L470I mutant increased the conversion of substrates containing 50% cis-isomer by 39.6% compared to the WT IEM.

[0024] Technical solution 2 of the present invention: provides an isolated nucleic acid, which encodes the isoeugenol monooxygenase mutant as described in technical solution 1.

[0025] The nucleic acid encodes and expresses the isoeugenol monooxygenase mutant as described in Technical Solution 1, and its source is cloning the gene sequence of the isoeugenol monooxygenase mutant as described in Technical Solution 1 through genetic engineering technology; or obtaining the nucleic acid encoding the isoeugenol monooxygenase mutant as described in Technical Solution 1 through artificial full sequence synthesis.

[0026] The nucleic acid of the present invention is preferably a nucleic acid molecule having a point mutation. The preparation method of the nucleic acid molecule having a point mutation is a conventional preparation method in the art, which comprises: using the isoeugenol monooxygenase gene (shown in SEQ ID No. 2) as a template, using a mutation primer containing the mutation point, and amplifying by PCR to obtain a nucleic acid molecule having a point mutation.

[0027] The primers containing the mutation point are prepared by conventional methods in the art, preferably by artificial synthesis. The resulting PCR primers are then used to perform a PCR amplification procedure to obtain a nucleic acid molecule encoding the isoeugenol monooxygenase mutant. The PCR amplification is a conventional technique in the art.

[0028] Furthermore, the nucleotide sequence of the nucleic acid encoding mutant I59L is shown in SEQ ID No. 4. The nucleotide sequence of the nucleic acid encoding mutant L470I is shown in SEQ ID No. 6. The nucleotide sequence of the nucleic acid encoding mutant I59L / L470I is shown in SEQ ID No. 8.

[0029] Technical solution three of the present invention: provides a recombinant expression vector comprising a nucleic acid encoding the isoeugenol monooxygenase mutant.

[0030] The recombinant expression vector is obtained by cloning the isoeugenol monooxygenase mutant nucleic acid into various expression vectors using conventional methods in the art. The expression vectors include various conventional vectors in the art, such as commercially available plasmids, phages, or viral vectors, preferably plasmid pET21a.

[0031] Technical solution 4 of the present invention: provides a recombinant expression transformant comprising the isoeugenol monooxygenase mutant nucleic acid or the recombinant expression vector.

[0032] The recombinant expression transformed bacteria can be obtained by transforming the above-mentioned recombinant expression vector into a host cell. The host cell is a conventional host cell in the art, as long as the recombinant expression vector can stably replicate itself and the gene of the isoeugenol monooxygenase mutant of the present invention carried by it can be effectively expressed. The host cell is preferably Escherichia coli, more preferably Escherichia coli E.coli BL21 (DE3). The recombinant expression vector is transformed into Escherichia coli E.coli BL21 (DE3) to obtain the preferred recombinant expression transformed bacteria of the present invention. The transformation method described therein is a conventional method in the art, such as heat shock method, electroporation method, etc., more preferably heat shock method.

[0033] Technical solution 5 of the present invention: provides a method for preparing an isoeugenol monooxygenase mutant.

[0034] The method for preparing the isoeugenol monooxygenase mutant of the present invention preferably comprises culturing the recombinantly expressing transformant described above and isolating the recombinantly expressed isoeugenol monooxygenase mutant. The culture medium used for culturing the recombinantly expressing transformant can be any culture medium known in the art that enables the transformant to grow and produce the isoeugenol monooxygenase mutant of the present invention. The culture method and conditions can be appropriately selected based on factors such as the host cell type and culture method, as long as the transformant can grow and produce the isoeugenol monooxygenase mutant.

[0035] In one embodiment of the present invention, preferably, the seed liquid of the recombinant expression transformant is inoculated into a fermentation medium, and the fermentation time is 12 hours at 25°C and 200 rpm; the fermentation medium composition is: Na2HPO4 7g / L, KH2PO4 3g / L, yeast extract 10g / L, NaCl 0.5g / L, glucose 14g / L, pH 7.0; the IPTG induction concentration is 0.1mM.

[0036] Technical solution six of the present invention: provides an isoeugenol monooxygenase mutant catalyst, which is any one of the following forms:

[0037] (1) culturing the recombinant expression transformed bacteria and isolating cells containing the isoeugenol monooxygenase mutant;

[0038] (2) disrupting cells containing the isoeugenol monooxygenase mutant to obtain a cell disrupted liquid containing the isoeugenol monooxygenase mutant, i.e., a crude enzyme liquid;

[0039] (3) Purifying the cell disrupted liquid containing the isoeugenol monooxygenase mutant to obtain a pure enzyme liquid.

[0040] Technical Solution 7 adopted by the present invention: providing the use of the above-mentioned isoeugenol monooxygenase mutant or isoeugenol monooxygenase mutant catalyst in the preparation of vanillin using isoeugenol as a substrate.

[0041] In one embodiment of the present invention, vanillin was prepared using isoeugenol as a substrate. At a substrate concentration of 100 mM (cosolvent being 10% DMSO), a reaction temperature of 25° C., a pH of 10.0, a cell mass of 20 g / L, and after 8 hours of conversion, the conversion rates of vanillin of the isoeugenol monooxygenase mutants I59L, L470I, and I59L / L470I were 97.22%, 84.17%, and 100%, respectively, while the conversion rate of the parent isoeugenol monooxygenase IEM under the same conditions was 92.25%.

[0042] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0043] The present invention uses alanine scanning around the active pocket and consensus theory as its guiding principles to perform site-directed mutagenesis on the isoeugenol monooxygenase gene, obtaining an IEM mutant with improved selectivity and specific activity for cis-isoeugenol. The mutant I59L / L470I has a specific activity 1.32 times that of the parent and a selectivity 1.40 times that of the parent. This mutant enzyme can catalyze the conversion of the propenyl group on the benzene ring of the substrate isoeugenol to produce vanillin. It can use isoeugenol as a substrate and can completely convert isoeugenol into vanillin at a reaction temperature of 25°C, a pH of 10.0, a cell mass of 20g / L, and a conversion time of 8h. The conversion rate can reach 100% at a substrate concentration of 100mM, indicating broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Comparison of specific activities of the mutants constructed for the present invention and the original IEM.

[0045] Figure 2 Comparison of the conversion rates of isoeugenol to vanillin containing 50% cis configuration catalyzed by the mutant constructed for the present invention and the original IEM.

[0046] Figure 3 Comparison of the conversion rates of isoeugenol to vanillin containing 10% cis configuration catalyzed by the mutant constructed for the present invention and the original IEM. DETAILED DESCRIPTION

[0047] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0048] The culture medium formulas involved in the following examples are as follows:

[0049] LB liquid medium: tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH 7.0.

[0050] LB solid medium: Add 15 g / L agar to the basic formula of LB liquid medium.

[0051] Fermentation medium: Na2HPO4 7 g / L, KH2PO4 3 g / L, yeast extract 10 g / L, NaCl 0.5 g / L, glucose 14 g / L, pH 7.0.

[0052] Method for determining the enzymatic activity of isoeugenol monooxygenase or its mutants:

[0053] The activity assay reaction system (1 mL) was as follows: 0.5 mg of whole cells were mixed with 0.1 M Tris-HCl (pH 8.0) buffer, and then preheated with 200 mM substrate isoeugenol at 30°C for 3 min. 50 μL of substrate was then added to the reaction system to a final concentration of 10 mM. The mixture was reacted at 30°C, 1000 rpm on a thermomixer for 10 min, and 1 mL of liquid methanol was added for quenching. After mixing on a vortex mixer, the mixture was centrifuged at 12,000 rpm for 2 min. The supernatant was aspirated with a sterile syringe and analyzed by HPLC.

[0054] Analytical method (HPLC method): The chromatographic column is a reverse-phase column C18 (Diamonsil plus, 4.6 mm*250 mm*5 μm); the mobile phase (gradient elution) is: methanol: water (pH 2.5) = 70:30 for 1-12 min, the detection wavelength is 280 nm; the column temperature is set at 25°C; the injection volume is 10 μL.

[0055] Enzyme activity definition: The amount of enzyme required to produce 1 μmol of product vanillin per unit time at 30°C and pH 8.0 is defined as one unit U.

[0056] Determination of cis-isoeugenol selectivity: 1 g / L isoeugenol monooxygenase or its mutant cells were taken, and 10 mM (50% cis-isoeugenol, solvent: DMSO) of substrate isoeugenol was added, and the reaction was carried out at 25°C for 8 h, and the conversion rate was observed.

[0057] Whole-cell catalysis of isoeugenol to vanillin: 20 g / L isoeugenol monooxygenase or its mutant cells were taken and reacted with 100 mM substrate isoeugenol (cis-isoeugenol accounted for 10%, solvent: DMSO) at pH 10.0, reaction temperature of 25, reaction time of 8 h to observe the changes in vanillin conversion rate.

[0058] The conversion rate of product vanillin is calculated as follows:

[0059] Conversion rate α = A / (B+A) × 100%

[0060] Where A represents the concentration of vanillin and B represents the concentration of isoeugenol.

[0061] A=1.74×10 -4 x0-5.52×10 -2 , is the external standard method standard curve of vanillin,

[0062] B=2.88×10 -4 x1-7.15×10 -4 , is the external standard method standard curve of isoeugenol,

[0063] Wherein, x0 is the integrated peak area of ​​vanillin by external standard method, and x1 is the integrated peak area of ​​isoeugenol by external standard method.

[0064] The present invention is further described below with reference to specific embodiments.

[0065] Example 1: Cloning of the isoeugenol monooxygenase gene and construction of recombinant engineering bacteria

[0066] An isoeugenol monooxygenase IEM gene (the nucleotide sequence of which is shown in SEQ ID NO.2) was obtained from Pseudomonas nitroreducens Jin1, and the amino acid sequence of this isoeugenol monooxygenase IEM is shown in SEQ ID NO.1.

[0067] The upstream primer (shown in SEQ ID NO.9) was amplified by isoeugenol monooxygenase IEM 5'-CGC CATATG ATGGCGAGACTCAACCGCAAC-3' (the underlined bases are the recognition site of the restriction endonuclease Nde I) and the isoeugenol monooxygenase IEM amplification downstream primer (shown in SEQ ID NO.10) 5'-CCG CTCGAG The target gene was amplified using TTAAGGTCTGGGTACCCAGCA-3' (the underlined bases are the restriction endonuclease Xho I recognition site). PCR amplification used PrimeSTAR Max high-fidelity polymerase from Takara Biotechnology (Beijing) Co., Ltd. (Takara, China). The PCR reaction system was as follows: (primer concentration was 10 μmol / L):

[0068]

[0069] The PCR amplification program was as follows: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for 60 s, 30 cycles; extension at 72°C for 7 min; and storage at 4°C.

[0070] After the reaction, the PCR product was examined by 1% agarose gel electrophoresis, yielding a 1.5 kb band, consistent with the expected target protein length. Following the kit protocol, the target fragment was recovered and purified using gel electrophoresis. The recovered fragment and the pET21a plasmid were double-digested with restriction endonucleases Nde I and Xho I. Ligation Mix was then used for ligation. The ligation product was transformed into competent E. coli BL21(DE3) cells and plated on LB plates containing ampicillin (100 μg / mL). Plasmids from positive clones were isolated and sequenced. The results confirmed the correct sequence of the inserted IEM gene, and the recombinant strain was named E. coli BL21(DE3) / pET21a-IEM.

[0071] Example 2: Construction of isoeugenol monooxygenase mutants based on seamless cloning

[0072] The recombinant plasmid pET21a-IEM was used as a template to amplify the plasmid containing the mutant gene by PCR in vitro.

[0073] The primers used for site-directed mutagenesis are (the mutation sites are underlined):

[0074] I59L primer-F(SEQ ID NO.11):

[0075] 5'-CCCGCAAAAATTCCACACCTTC CTG GATGGAGATGGAATG-3'

[0076] I59L primer-R(SEQ ID NO.12):

[0077] 5'-GAAGGTGTGGAATTTTTGCGGGGTAAC-3'

[0078] L470I primer-F (SEQ ID NO.13):

[0079] 5'-CCGGTTAAGGGCCGCT ATT CATGGCTGCTG-3'

[0080] L470I primer-R (SEQ ID NO.14):

[0081] 5'-GCGGCCCTTAACCGGAATGGCAG-3'

[0082] Shared primer-F (SEQ ID NO.15):

[0083] 5'-CTTTTTACGGTTTCCTGGCCTTTTGC-3'

[0084] Shared primer-R (SEQ ID NO.16):

[0085] 5'-GCCAGGAACCGTAAAAAGGCCG-3'

[0086] The PCR reaction system is as follows: (primer concentration is 10 μmol / L)

[0087]

[0088] The PCR amplification program was as follows: pre-denaturation at 95°C for 10 min; denaturation at 98°C for 10 s, annealing at 56°C for 15 s, extension at 60°C for 75 s, 24 cycles; extension at 72°C for 5 min; and storage at 4°C.

[0089] Take 10 μL of the product obtained by PCR and verify its correctness by nucleic acid electrophoresis, and then use a universal DNA purification and recovery kit to recover the reaction solution. Use seamless cloning enzyme to link the DNA sequences at both ends, and then transform the enzyme-digested products into Escherichia coli BL21 (DE3) competent cells. Spread LB resistant solid plates (containing 100 μg / mL Amp), culture at 37°C for 12-14 hours, pick 1-3 transformants and transfer them to LB liquid culture medium (containing 100 μg / mL Amp) and culture for 12 hours. After the liquid becomes turbid, take the bacterial liquid and send it for sequencing. Through the screening of dominant strains, a strain E.Coli BL21 (DE3) / pET21a-IEM with improved thermal stability compared to the original bacteria was obtained. I59L (IEM I59L The amino acid sequence is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.4), E. coli BL21 (DE3) / pET21a-IEM L470I (IEM L470I The amino acid sequence is shown in SEQ ID NO.5, and the nucleotide sequence is shown in SEQ ID NO.6). In the second round, pET21a-IEM I59L The plasmid was used as a template, L470I-F and L470I-R were used as primers, and after whole plasmid PCR, transformation, and plating, the dominant strain E. coli BL21(DE3) / pET21a-IEM with further improved cis-isoeugenol activity was obtained. I59L / L470I (IEM I59L / L470I The amino acid sequence is shown in SEQ ID NO.7, and the nucleotide sequence is shown in SEQ ID NO.8).

[0090] Example 3: Induced expression of parental and mutant strains

[0091] Plate activation: Use an inoculation loop to dip the bacterial solution in the glycerol tube, streak four lines on an LB resistance solid plate (containing 100 μg / mL Amp), and culture upside down in a constant temperature incubator at 37°C for 12 hours.

[0092] Seed culture: Pick a single colony from the solid plate and inoculate it into LB liquid medium (containing 100 μg / mL Amp) with a volume of 50 mL / 250 mL. Incubate on a shaker at 37°C and 200 rpm for 12 h.

[0093] Shake flask fermentation: The seed liquid cultured for 12 hours was inoculated into the fermentation medium (containing 100 μg / mL Amp) at a 1% inoculum volume of 50 mL / 250 mL, and cultured at 37 ° C, 200 rpm until the bacterial concentration OD 600 =0.6-0.8, and after the liquid was cooled to room temperature, IPTG was added to a final concentration of 0.1 mM for induction, and the expression was induced at 25°C for 12 h.

[0094] Bacteria collection: All fermented bacteria were collected by centrifugation at 10,000 rpm for 10 min, and the cells were washed twice with 0.8% saline before collection.

[0095] Example 4: Comparison of activity of different mutants and parent enzyme

[0096] The collected bacteria were diluted and the enzyme activity was determined according to the above method. Figure 1 As shown, the specific activity of the parent IEM was 5.95±0.07 U / mg, and the specific activities of the mutants I59L, L470I and I59L / L470I were 7.35±0.06 U / mg, 5.3±0.07 U / mg, and 7.87±0.05 U / mg, respectively, which were 1.24-, 0.89-, and 1.32-fold higher than those of the parent.

[0097] Example 5: Comparison of selectivity of different mutants and parent enzyme

[0098] The selectivity comparison between different mutants and the parent enzyme was mainly conducted by measuring the conversion rate of isoeugenol catalyzed by different mutants and the parent enzyme. Figure 2 As shown, the conversion rate of the parent to isoeugenol (containing 50% cis configuration) was 53%, while the conversion rates of mutants I59L, L470I, and I59L / L470I to isoeugenol (containing 50% cis configuration) were 47%, 69%, and 74%, respectively, which were 0.89-fold, 1.31-fold, and 1.40-fold higher than those of the parent, respectively.

[0099] It can be seen that the two-site mutant I59L / L470I showed the best conversion rate, indicating that the combined mutation can further improve the enzyme's selectivity for cis-isoeugenol.

[0100] Example 6: Comparison of vanillin synthesis conversion rates between mutants and parent strains

[0101] In a 50 mL shake flask, 20 g / L of cells (mutant and parent strains, respectively) were added, along with 4.5 mL of 100 mM Gly-NaOH buffer (pH 10.0) and 0.5 mL of the substrate, 1 M isoeugenol (cosolvent: DMSO). The reaction was incubated at 220 rpm for 8 hours. An equal volume of liquid methanol was added to quench the reaction, followed by centrifugation and analysis by HPLC. The I59L / L470I mutant achieved a 100% conversion rate, while the conversion rates of mutants I59L and L470I were 97.22% and 84.17%, respectively. Under the same conditions, the conversion rate of the parent strain was 92.25%.

[0102] The above description of the embodiments is intended to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above-described embodiments. Improvements and modifications made by those skilled in the art based on the disclosure of the present invention, without departing from the scope of the present invention, should be within the scope of protection of the present invention.

[0103] The sequence information involved in the present invention is as follows:

[0104] SEQ ID No. 1: Amino acid sequence of isoeugenol monooxygenase IEM

[0105]

[0106]

[0107] SEQ ID No. 2: Nucleotide sequence of the gene encoding isoeugenol monooxygenase IEM

[0108]

[0109] SEQ ID No. 3: Amino acid sequence of mutant I59L

[0110]

[0111] SEQ ID No. 4: Nucleotide sequence of nucleic acid encoding mutant I59L

[0112]

[0113]

[0114] SEQ ID No. 5: Amino acid sequence of mutant L470I

[0115]

[0116]

[0117] SEQ ID No. 6: Nucleotide sequence of nucleic acid encoding mutant L470I

[0118]

[0119] SEQ ID No.7: Amino acid sequence of mutant I59L / L470I

[0120]

[0121] SEQ ID No. 8: Nucleotide sequence of nucleic acid encoding mutant I59L / L470I

[0122]

[0123]

[0124] SEQ ID NO.9: Isoeugenol monooxygenase IEM amplification upstream primer CGCCATATGATGGCGAGACTCAACCGCAAC

[0125] SEQ ID NO.10: Isoeugenol monooxygenase IEM amplification downstream primer CCGCTCGAGTTAAGGTCTGGGTACCCAGCA

[0126] SEQ ID NO.11: I59L primer-F5'-CCCGCAAAAATTCCACACCTTC CTG GATGGAGATGGAATG-3'SEQ ID NO.12: I59L primer-R5'-GAAGGTGTGGAATTTTTGCGGGGTAAC-3'

[0127] SEQ ID NO.13: L470I primer-F5'-CCGGTTAAGGGCCGCT ATT CATGGCTGCTG-3'

[0128] SEQ ID NO.14: L470I primer-R5'-GCGGCCCTTAACCGGAATGGCAG-3'

[0129] SEQ ID NO.15: Shared primer-F5'-CTTTTTACGGTTTCCTGGCCTTTTGC-3'

[0130] SEQ ID NO.16: Common primer - R 5'-GCCAGGAACCGTAAAAAGGCCG-3'

Claims

1. An isoeugenol monooxygenase mutant, characterized in that Select one of the following: (1) mutating the amino acid position 59 of the amino acid sequence shown in SEQ ID No. 1 from isoleucine I to leucine L; (2) mutating position 470 of the amino acid sequence shown in SEQ ID No. 1 from leucine L to isoleucine I; (3) The amino acid sequence shown in SEQ ID No. 1 at position 59 was mutated from isoleucine I to leucine L, and the amino acid sequence at position 470 was mutated from leucine L to isoleucine I.

2. An isolated nucleic acid, characterized in that Encoding the isoeugenol monooxygenase mutant according to claim 1.

3. A recombinant expression vector, characterized in that: Comprising the nucleic acid of claim 2.

4. A recombinant expression vector according to claim 3, characterized in that, The expression vector is plasmid pET21a.

5. A recombinant expression transformant comprising the nucleic acid of claim 2 or the recombinant expression vector of claim 3.

6. The recombinant expression transformant according to claim 5, characterized in that The recombinant expression transformed bacteria are prepared by transforming the recombinant expression vector according to claim 3 or 4 into a host cell, and the host cell is Escherichia coli.

7. A method for preparing the isoeugenol monooxygenase mutant according to claim 1, characterized in that: Cultivate the recombinant expression transformant according to claim 5, and isolate and obtain the recombinantly expressed isoeugenol monooxygenase mutant according to claim 1.

8. An isoeugenol monooxygenase mutant catalyst, characterized in that Is any of the following: (1) culturing the recombinant expression transformed bacteria according to claim 5, and isolating cells containing the isoeugenol monooxygenase mutant according to claim 1; (2) disrupting cells containing the isoeugenol monooxygenase mutant to obtain a cell disrupted liquid containing the isoeugenol monooxygenase mutant, i.e., a crude enzyme liquid; (3) Purifying the cell disrupted liquid containing the isoeugenol monooxygenase mutant to obtain a pure enzyme liquid.

9. Use of the isoeugenol monooxygenase mutant according to claim 1 or the isoeugenol monooxygenase mutant catalyst according to claim 7 in the preparation of vanillin using isoeugenol as a substrate.

10. The use according to claim 9, characterized in that Isoeugenol was used as substrate, DMSO was used as cosolvent, the reaction temperature was 25°C, and the pH was 10.0.

Citation Information

Patent Citations

  • Highly thermally stable and highly active isoeugenol monooxygenase mutants and their applications

    CN113151201B