Fusion editing system for RNA targeted single base site ac4C modification and application thereof
By constructing a dCas13b-NAT10 fusion protein system, easy operation and specific editing of RNA-specific site ac4C modification were achieved, solving the problems of cumbersome operation and information change in existing technologies, and providing a low-cost RNA-targeted acetylation tool for studying the physiological processes of target genes.
Patent Information
- Application Number
- CN202510777820.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-11
- Publication Date
- 2025-09-23
AI Technical Summary
Existing technologies make it difficult to achieve easy and specific editing of ac4C modifications at specific single-base sites on RNA, and broad-spectrum acetylation methods may change genetic information, are cumbersome to operate, and cannot be written.
A dCas13b-NAT10 fusion protein system was constructed. By designing sgRNA, RNA was targeted to specific sites for ac4C modification. The dCas13b-NAT10 fusion vector was used to perform acetylation modification on the target RNA. The system construction is simple and easy, and is suitable for RNA-directed ac4C editing.
It achieves ac4C modification of RNA at specific sites without changing genetic information, providing an easy-to-operate, low-cost RNA targeted acetylation system for studying the effects of single-base site ac4C modification on the physiological processes of target genes.
Smart Images

Figure CN120683104A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of RNA epigenetic modification, and in particular to a fusion editing system for RNA-targeted single-base site ac4C modification and applications thereof. Background Art
[0002] Epigenetic modification refers to a genetic pattern in which associated traits change without altering the gene sequence. RNA epigenetic modification, as a crucial component of epigenetic regulation at the post-transcriptional level, determines the fate of RNA. These RNA epigenetic modifications alter the molecular structural stability, biological activity, and mode of action of RNA, further influencing various biological processes and cellular phenotypes. Typically, RNA modifications are regulated by readers, writers, and erasers, and these regulatory proteins play an irreplaceable role in the corresponding epigenetic modification process.
[0003] First discovered by Arango D et al. in 2018 (Arango, D., D. Sturgill, N. Alhusaini, AA Dillman, TJ Sweet, G. Hanson, M. Hosogane, WR Sinclair, KKNanan, MD Mandler, SD Fox, TT Zengeya, T. Andresson, JL Meier, J.Coller and S. Oberdoerffer (2018). "Acetylation of Cytidine in mRNA PromotesTranslation Efficiency." Cell175(7): 1872-1886. Among the many types of RNA epigenetic modifications, ac4C is the only known acetylation modification present on eukaryotic mRNA; and the acetyltransferase 10 (NAT10) has been identified as the acetyltransferase. The key role of the single base ac4C has been detected in a variety of viral and host genes, regulating physiological processes such as gene mRNA stability, transcription, translation, and localization. In 2022, Hao, HJ et al. (Hao, HJ, WC Liu, YJ Miao, L. Ma, BC Yu, LS Liu, CJ Yang,K. Zhang, Z. Chen, JW Yang, ZH Zheng, B. Zhang, F. Deng, P. Gong, JHYuan, ZL Hu and WX Guan (2022). "N4-acetylcytidine regulates thereplication and pathogenicity of enterovirus 71." Nucleic Acids Research 50(16): 9339-9354.) identified two ac4C sites in enterovirus 71 (EV71 XF strain), located at positions 331 and 350 on the 5'-UTR of the viral genome, respectively. Mutating the two sites individually or simultaneously reduced the viral replication and translation efficiency and exhibited lower pathogenicity.In addition, ac4C was also detected in host genes. In 2024, Dang et al. (Dang, Y., J. Li and Y. Li (2023). "N-acetyltransferase10 regulates alphavirus replication via N4-acetylcytidine (ac4C) modificationof the lymphocyte antigen six family member E (LY6E) mRNA." Journal of Virology.) demonstrated through website prediction and related experiments that there is a conserved ac4C modification motif in the mature 3'-UTR region of lymphocyte antigen 6 E (LY6E), which can be modified by ac4C and regulated by NAT10. This site is located at 3420 to 3434 nt of LY6E. Mutation of the cytidine motif at this site can inhibit gene expression.
[0004] The study of ac4C regulators has only discovered one writer, NAT10, while the recognizers and erasers remain to be identified. The ac4C modification of RNA is a chemical modification that acetylates the fourth nitrogen atom of cytosine under the action of the writer NAT10. It is highly conserved in both prokaryotes and eukaryotes. It was first discovered in the promoter region of the hTERT (human telomerase reverse transcriptase) gene (Lv, JJ, HJ Liu, QA Wang, ZW Tang, L. Houand B. Zhang (2003). "Molecular cloning of a novel human gene encoding histone acetyltransferase-like protein involved in transcriptional activation of hTERT." Biochemical and Biophysical Research Communications 311(2): 506-513.), and has the function of acetylating histones and non-histone proteins.
[0005] NAT10 is widely present in organisms. It is a nuclear protein composed of 1025 amino acids with a molecular weight of 116kD. NAT10 is an important member of the GNAT family of acetyltransferases. It mainly includes a helicase domain, an N-acetyltransferase (GNAT) domain, and an RNA binding domain (Gurard-Levin and Almouzni 2014). It has acetyltransferase activity and RNA binding activity. Among them, the GNAT domain is essential for NAT10 to recognize and bind to acetyl-CoA. In 2019, Sleiman and Dragon found (Sleiman, S. and F. Dragon (2019). "Recent Advances onthe Structure and Function of RNA Acetyltransferase Kre33 / NAT10." Cells 8(9).) that the N segment and C segment of NAT10 contain nuclear localization signal (NLS) sequences and nucleolar localization signal (NoLS) sequences, respectively. This is related to the localization and function of NAT10 in cells.
[0006] The CRISPR-Cas13 system belongs to the Type VI family and includes multiple subtypes, including Cas13a, b, c, and d. Cas13 proteins are single proteins composed of multiple domains, capable of recognizing crRNA, cleaving RNA, and even cleaving pre-crRNA. The CRISPR-Cas13 system is an ideal tool for various RNA-level regulatory applications. Currently, the CRISPR-Cas13 system has been applied for RNA editing, interference, detection, tracking, and imaging. The defense mechanism of the CRISPR-Cas13 system can be broadly divided into three phases: the first is the adaptation phase, during which the system recognizes the spacer sequence of the exogenous nucleic acid and integrates the exogenous nucleic acid sequence into the CRISPR system; the second is the expression phase, which also marks the maturation of the crRNA, during which the pre-crRNA is processed by relevant nucleases and proteins to form the mature crRNA; and the third is the interference phase, during which complementary base pairing of the crRNA directs the Cas13-crRNA complex to the target site and cleaves it.
[0007] In 2022, Kordys, Sen et al. (Kordys, M., R. Sen and Z. Warkocki (2022). "Applications of the versatile CRISPR-Cas13 RNA targeting system." Wiley Interdisciplinary Reviews-Rna 13(3).) reported that the mature crRNA is 66 nt long, including a 36-nt DR hairpin region and a 30-nt spacer region. The DR hairpin region is a direct repeat sequence that is conserved in size, sequence, and structure; the open loop region has a polyU extension whose main function is to contact the backbone of the Cas13 residue to recognize the anchor. The spacer region plays a specific targeting function by introducing an RNA sequence complementary to the target sequence. Only when the crRNA-Cas13 complex recognizes the target RNA and forms a ternary complex, will Cas13 be activated and cut the substrate RNA. The crRNA-Cas13 complex may also be induced to produce incidental degradation of nonspecific substrates in the reaction environment (performed by the R-X4-6-H motif in the HEPN domain), thus having certain off-target effects.
[0008] In 2015, Shmakov, Abudayyeh et al. (Shmakov, S., OO Abudayyeh, KSMakarova, YI Wolf, JS Gootenberg, E. Semenova, L. Minakhin, J. Joung, S. Konermann, K. Severinov, F. Zhang and EV Koonin (2015). "Discovery and Functional Characterization of Diverse Class 2 CRISPR-Cas Systems." Molecular Cell 60(3): 385-397.) found that the Cas13 enzyme has a nucleotide binding domain and an RNA cleavage domain; the nucleotide binding domain is mainly involved in the recognition of the crRNA hairpin structure. The cleavage domain can form an RNA binding channel to accommodate the crRNA-target RNA duplex. It is mainly composed of two HEPN domains and is involved in the regulation and cleavage of the target RNA. This structure can mediate precise RNA cleavage. In 2017, Cox, Gootenberg et al. (Cox, DBT, JSGootenberg, OO Abudayyeh, B. Franklin, MJ Kellner, J. Joung and F.Zhang (2017). "RNA editing with CRISPR-Cas13." Science 358(6366): 1019-1027.) reported that the application of the CRISPR-Cas13 system in RNA base modification requires the modification of Cas13 to disable its RNA cleavage function. The dCas13 protein was obtained by mutating the R-XXXX-H genomic sequence of the HEPN domain of the Cas13 protein. This dCas13 protein retains its RNA binding activity but loses its RNA cleavage activity.
[0009] Current approaches to manipulate ac4C on RNA primarily involve overexpression or knockdown of the acetyltransferase NAT10, resulting in broad-spectrum ac4C changes across transcripts. This is then combined with transcriptome-wide acRIP-seq to determine global changes in ac4C levels within target transcripts. However, broad-spectrum acetylation across transcripts makes it difficult to investigate the role of specific RNA acetylation, such as at single base sites.
[0010] Studies of single-base sites are typically limited to mutating the cytidine residue at that site to remove the ac4C residue. Changes in the corresponding markers of the target gene are then used to analyze the effect of acetylation at that site. However, this approach has many drawbacks: first, it alters the genetic information and cannot eliminate the influence of the base change; second, the operation is cumbersome and inconvenient; and third, it can only remove, not insert.
[0011] Therefore, developing an easy-to-operate and highly specific RNA targeted acetylation system is of great significance for studying the effects of ac4C modification on the physiological processes of target genes at specific sites. Summary of the Invention
[0012] This invention provides a fusion editing system for RNA-targeted single-base ac4C modification and its applications. By constructing a dCas13b-NAT10 fusion protein and designing a sgRNA, this system enables site-specific ac4C editing of RNA. Guided by the sgRNA, dCas13b-NAT10 is recruited to the target RNA site and acetylates it (ac4C). This system is simple to construct, inexpensive, and suitable for RNA-directed ac4C editing. It is implemented using the following techniques.
[0013] In a first aspect of the present invention, a fusion editing system is provided, which is used for ac4C modification of RNA targeting specific sites; the fusion editing system comprises a fusion vector and sgRNA; the fusion vector comprises a gene fragment expressing a dCas13b protein and a gene fragment expressing a NAT10 protein, the sgRNA is used to target and identify the target site for ac4C modification on the target RNA, and the dCas13b protein has a targeting recognition function and has no cleavage activity; the gene fragment expressing the dCas13b protein and the gene fragment expressing the NAT10 protein of the fusion vector are connected by a nuclear export sequence fragment (i.e., an NES fragment) and a gene fragment expressing a flexible connecting peptide.
[0014] Furthermore, the flexible connecting peptide is (SGGS)2-XTEN-(SGGS)2 Linker; the nucleotide sequence of the gene fragment expressing the (SGGS)2-XTEN-(SGGS)2 Linker is shown in SEQ ID NO.1.
[0015] This paper selected enterovirus 71 (EV71) and the endogenous transcript LY6E as verification objects, identified three ac4C modification sites in the 5'-UTR and 3'-UTR of the two genes, respectively, and designed corresponding sgRNAs for these different ac4C modification sites, which together with the dCas13b-NAT10 fusion vector constituted a fusion editing system.
[0016] The second aspect of the present invention provides a dCas13b protein derived from Prevotella P5-125.
[0017] A third aspect of the present invention provides a product comprising any one of the following:
[0018] (1) An expression cassette comprising a gene fragment expressing a dCas13b protein, a nuclear export sequence fragment, a flexible connecting peptide, and a gene fragment expressing a NAT10 protein;
[0019] (2) a fusion vector comprising the expression cassette;
[0020] (3) An engineered cell containing the expression cassette or the fusion vector;
[0021] (4) A kit comprising any one of the above fusion editing systems.
[0022] Furthermore, in the expression cassette, the gene fragment expressing the dCas13b protein and the gene fragment expressing the NAT10 protein are connected by a nuclear export sequence fragment and a gene fragment expressing a flexible connecting peptide.
[0023] Furthermore, the flexible connecting peptide is (SGGS)2-XTEN-(SGGS)2 Linker; the nucleotide sequence of the (SGGS)2-XTEN-(SGGS)2 Linker is shown in SEQ ID NO.1.
[0024] A fourth aspect of the present invention provides a method for preparing a fusion editing system, comprising the following steps:
[0025] The gene fragment expressing the dCas13b protein, the nuclear export signal NES sequence and the gene fragment expressing the NAT10 protein are sequentially connected behind the EF-1α promoter of the original vector I containing the EF-1α promoter, and the gene fragment expressing the flexible connecting peptide is inserted between the nuclear export signal NES sequence and the gene fragment expressing the NAT10 protein to obtain the fusion vector;
[0026] An sgRNA is designed for the target site of ac4C modification on the target RNA; a direct repeat sequence corresponding to dCas13b is inserted after the U6 promoter in the original vector II containing the U6 promoter, and an oligonucleotide chain corresponding to the sgRNA is inserted between the U6 promoter and the direct repeat sequence to obtain a recombinant vector; the recombinant vector is transformed into competent cells, and the sgRNA is obtained by culture and screening.
[0027] In a fifth aspect, the present invention provides an application of any of the above-described fusion editing systems for performing ac4C modification of a target site on a target RNA for purposes other than disease diagnosis and treatment.
[0028] In a sixth aspect, the present invention provides a method for ac4C modification of a target site on a target RNA not for the purpose of disease diagnosis or treatment, comprising selecting cells (including but not limited to virus-infected cells), a target RNA in the cell (including cellular or viral RNA), and a target site on the target RNA for ac4C modification;
[0029] The fusion editing system of claim 1 or 2 is transfected into cells containing the target RNA and the target site, and ac4C modification is performed on the cytosine of the target site.
[0030] Compared with the prior art, the present invention is beneficial in that:
[0031] 1. The dCas13b-NAT10 editing system provided by the present invention is suitable for the targeted ac4C editing of viral genomes and host endogenous genomes. It can be achieved by simply designing sgRNA according to the target site. It is easy to operate, highly specific, and low cost.
[0032] 2. The dCas13b-NAT10 editing system provided by the present invention can target ac4C modification at specific sites without broad spectrum and without changing genetic information, providing a new tool for studying the impact of ac4C modification at a single base on the physiological process of the target gene. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 Schematic diagram of the working principle of the dCas13b-NAT10 fusion editing system.
[0034] Figure 2 Acetylation is the process of cytidine nucleotides being acetylated.
[0035] Figure 3 The left image shows the amplification of the NAT10 fragment, the middle image shows the amplification of the dCas13b vector, and the right image shows the PCR results of the bacterial solution using the dCas13b-NAT10 recombinant.
[0036] Figure 4 and Figure 5 The ac4C site on the 5'-UTR of EV71 and the 3'-UTR of LY6E and the design of the corresponding guide RNA are shown, respectively.
[0037] Figure 6 Schematic diagram of the structure of dCas13b-NAT10 fusion protein.
[0038] Figure 7 The expression of dCas13b-NAT10 fusion protein.
[0039] Figure 8 The results of subcellular localization analysis of dCas13b-NAT10 fusion protein. Figure 9 The left figure shows the anti-ac4C dot blot results of EV71 5'-UTR guided by different sgRNAs, and the right figure shows the dual luciferase assay detection of EV71 5'-UTR.
[0040] Figure 10 The left figure shows the effect of targeted ac4C modification of EV71 by the dCas13b-NAT10 editing system on viral replication and translation; the right figure shows the effect of targeted ac4C modification on EV71 RNA replication by RT-qPCR, and the right figure shows the effect of targeted ac4C modification on EV71 protein expression.
[0041] Figure 11 The left figure shows the anti-ac4C dot blot results of LY6E 3'-UTR guided by different sgRNAs, and the right figure shows the dual luciferase assay detection of LY6E 3'-UTR.
[0042] Figure 12 The left figure shows the effect of dCas13b-NAT10 editing system targeting LY6E ac4C modification on LY6E replication and translation; the right figure shows the effect of targeted ac4C modification on LY6E RNA replication detected by RT-qPCR, and the right figure shows the effect of targeted ac4C modification on LY6E protein expression. DETAILED DESCRIPTION
[0043] The technical solutions of the present invention are described clearly and completely below. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. All other embodiments obtained by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.
[0044] In the following specific implementation cases of the present invention, enterovirus 71 (EV71) and endogenous transcript LY6E (lymphocyte antigen 6 E, lymphocyte antigen 6 family member E) are selected as verification objects.
[0045] Based on the previous basic research of Hao ("N4-acetylcytidine regulates the replication andpathogenicity of enterovirus 71." Nucleic Acids Research 50(16): 9339-9354.) and Dang (" N-acetyltransferase 10 regulates alphavirus replication via N4-acetylcytidine (ac4C) modication of the lymphocyte antigen six family memberE (LY6E) mRNA". Journal of Virology.2024), three ac4C modification sites were identified in the 5'-UTR and 3'-UTR of the two genes, and corresponding sgRNAs were designed for the three ac4C modification sites, which together with dCas13b-NAT10 constituted a fusion editing system targeting single-base site ac4C modification in RNA.
[0046] The working principle of the dCas13b-NAT10 fusion editing system provided by the present invention is as follows: Figure 1 As shown; the process of acetylation on cytidine is as follows Figure 2 shown.
[0047] Example 1: Construction of fusion expression vector dCas13b-NAT10
[0048] The fusion expression vector dCas13b-NAT10 was constructed using the original vector pC0046-PspCas13b-NES-3×HA (Cox, DBT, JS Gootenberg, OO Abudayyeh, B. Franklin, MJKellner, J. Joung and F. Zhang (2017). "RNA editing with CRISPR-Cas13." Science 358(6366): 1019-1027.). The vector contains an EF-1α promoter for controlling the expression of catalytically inactive PspCas13b (hereinafter referred to as dCas13b); followed by a gene fragment for expressing the dCas13b protein. The dCas13b system comes from the catalytically inactive type VI-B Cas13 enzyme of Prevotella sp. P5-125, which still has target recognition function but does not have RNA cleavage function. The specific sequence is shown in SEQ ID NO.2; followed by a nuclear export signal NES sequence, which enables the fusion protein dCas13b-NAT10 to be localized in the cytoplasm and function; it also contains the coding sequence of the screening gene Ampicillin to facilitate subsequent strain screening.
[0049] (1) Based on the above vector gene sequence (as shown in SEQ ID NO.2), upstream and downstream primers were designed respectively, and amplified to obtain a linearized vector, such as Figure 3 shown.
[0050] The upstream and downstream primer sequences are:
[0051] F: 5'-cctccgctagatcctccggacagtgtcagtctttcaagtggaggcagttg-3', as shown in SEQ ID NO.3.
[0052] R: 5'-tgaaactgaagcggaagaaaggtagttcctacccatacgatgttccagat-3', as shown in SEQ ID NO.4.
[0053] (2) Based on the gene sequence of acetyltransferase NAT10 (shown in SEQ ID NO.5), upstream and downstream primers were designed respectively. Human cDNA was amplified by PCR to obtain the NAT10 gene fragment. The results of agarose gel electrophoresis were shown in Figure 3 .
[0054] The upstream and downstream primer sequences are:
[0055] F: 5'-cagcgggggcagcagcggggggtcaatgcatcggaaaaaggtggacaac-3', as shown in SEQ ID NO.6.
[0056] R: 5'-cgtatgggtaggaactacctttcttccgcttcagtttcatatcttttttg-3', as shown in SEQ ID NO.7.
[0057] The PCR amplification system is shown in Table 1. The PCR program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 3 min, with 30 cycles of denaturation, annealing, and extension; post-extension at 72°C for 5 min; and PCR products were stored at 4°C.
[0058] Table 1 PCR amplification system
[0059]
[0060] (3) The PCR products obtained in steps (1) and (2) were digested with restriction endonuclease Dpn I at 37°C for 1 h. The reaction system is shown in Table 2. The Dpn I enzyme was then inactivated at 85°C for 10 min. The gel was then recovered using a gel recovery kit (purchased from TIANGEN) for later use.
[0061] Table 2 Dpn I enzyme digestion system
[0062]
[0063] (4) Since the molecular weight of both dCas13b and NAT10 proteins is greater than 100 kD, in order to ensure the harmonious existence of the dCas13b-NAT10 fusion protein in the spatial structure, a flexible linker peptide ((SGGS)2-XTEN-(SGGS)2Linker, as shown in SEQ ID NO.1) was inserted between the two, and the oligonucleotide chain was chemically synthesized as follows.
[0064] Sense strand: tccggaggatctagcggaggctcctctggctctgagacacctggcacaagcgagagcgcaacacctgaaagcagcgggggcagcagcggggggtca, as shown in SEQ ID NO.8.
[0065] Antisense strand: complementary to the sense strand mentioned above.
[0066] The sense strand and the antisense strand were annealed with primers, and the annealing system is shown in Table 3 below; the annealing program is: 95℃ 5 min; 90℃ 5 min; 85℃ 5 min; 80℃ 5 min; 75℃ 5 min; 72℃ 10 min; 70℃ 5 min; 65℃ 5 min; 60℃ 5 min; 55℃ 5 min; 50℃ 5 min; 45℃ 5 min; 40℃ 5 min; 35℃ 5 min; 30℃ 5 min; 25℃ 5 min; 20℃ 5 min.
[0067] Table 3 Annealing system
[0068]
[0069] (5) Connect the NAT10 gene fragments, the dCas13b linearized vector, and the flexible linker peptide annealing product by homologous recombination. The homologous recombination reaction system is shown in Table 4 below. The prepared homologous recombination system is reacted at 50°C for 15-20 minutes and immediately placed on ice.
[0070] Table 4 Homologous recombination reaction system
[0071]
[0072] (6) The above homologous recombination products were transformed into Escherichia coli DH5α competent cells, coated on Amp-resistant plates and cultured inverted overnight.
[0073] (7) Pick a single colony for culture and perform PCR on the bacterial solution using the upstream and downstream primers of NAT10 in step 2. The test results are shown in Figure 3 , screen and identify positive clones, sequence, incubate and extract plasmids for later use.
[0074] Example 2: Construction of guide RNA
[0075] The guide RNA vector selected by the applicant is pKK126, which contains a U6 promoter to control the expression of sgRNA. The direct repeat sequence (DR sequence) corresponding to dCas13b was inserted after the promoter to help the guide RNA bind to Cas13b, thereby generating the intermediate vector pKK126-U6-DR. After digestion with Age I, the intermediate vector was broken at the junction of the U6 promoter and DR to form a linear intermediate vector. The ac4C site on the EV71 5'-UTR and LY6E 3'-UTR and the corresponding guide RNA were designed as shown below. Figure 4 and 5 shown.
[0076] (1) Design the corresponding sgRNA based on the ac4C site of EV71 and LY6E mentioned above, and chemically synthesize the oligonucleotide chain in the following format:
[0077] Sense strand: 5′-CCGGT-(22N)-A-3′;
[0078] Antisense strand: Complementary to the sense strand, with CCGGT added to the 5' end and A added to the 3' end of each strand to create AgeI-reactive ends. (Note: 22N represents the 22-base sequence of the sgRNA).
[0079] The nucleotide sequence of the guide RNA designed for the ac4C site on the EV71 5'-UTR is:
[0080] sgRNA-331: gcgtaaggggtgcccgctggca, as shown in SEQ ID NO.9.
[0081] sgRNA-339: ggtgcccgctggcaccgccacc, as shown in SEQ ID NO.10.
[0082] sgRNA-350: ggcaccgccaccgacgcaaccg, as shown in SEQ ID NO.11.
[0083] The nucleotide sequence of the guide RNA designed for the ac4C site on the LY6E 3'-UTR is:
[0084] sgRNA-1: gacggagacggggttcaccccg, as shown in SEQ ID NO.12.
[0085] sgRNA-2: gacggggttcaccccggtcgac, as shown in SEQ ID NO.13.
[0086] sgRNA-3: gttcaccccggtcgacgggagt, as shown in SEQ ID NO.14.
[0087] (2) The sense and antisense strands anneal to form fragments with AgeI sticky ends and blunt ends.
[0088] (3) Ligate the above fragments into a linear intermediate vector (cut with AgeI).
[0089] (4) Transform E. coli DH5α competent cells.
[0090] (5) Screen positive clones and sequence them for identification.
[0091] Example 3: Expression and subcellular localization analysis of dCas13b-NAT10 fusion protein
[0092] To verify the expression and localization of the dCas13b-NAT10 fusion protein in cells, the constructed dCas13b-NAT10 vector was transfected into HEK293T cells. After 48 hours, the cells were harvested and protein was extracted for Western blot and immunofluorescence (IF) detection. The specific process is as follows.
[0093] (1) One day in advance, seed HEK293T cells into a six-well plate or glass-bottomed dish.
[0094] (2) When the cells grow to a confluence of approximately 70%, transfection is performed. Dilute the fusion expression vector dCas13b-NAT10 and PEI transfection reagent in Opti-MEM medium, and change the medium 4-6 hours after transfection. The transfection system is shown in Table 5.
[0095] Table 5 Transfection system
[0096]
[0097] Dilute 2 μg DNA in 100 μL Opti-MEM and 6 μL PEI transfection reagent in 100 μL Opti-MEM. Mix well and let stand for 5 minutes. Gently mix the two tubes and let stand for another 20 minutes before adding them to the corresponding well plate or culture dish.
[0098] (3) 48 h after transfection, discard the culture supernatant and slowly wash the cells three times with PBS.
[0099] (4) The cells in the well plate were lysed with RIPA lysis buffer, 5×SDS loading was added for sample preparation, and the expression of dCas13b-NAT10 protein was detected by western blot.
[0100] The cells in the glass-bottomed dish were fixed with 4% paraformaldehyde, permeabilized with 0.2% TritonX-100, blocked, incubated with primary and secondary antibodies, and nuclear staining. Finally, the localization of proteins in the cells was observed using a laser confocal microscope.
[0101] Test results such as Figure 6 and 7 As shown. Figure 6 From the dCas13b-NAT10 fusion protein structure, we can see that the dCas13b protein, nuclear export sequence, flexible linker peptide and NAT10 protein are connected in sequence. Figure 7The western blot results show that the molecular weight of the endogenous NAT10 protein is 116 kD, and the molecular weight of the dCas13b-NAT10 fusion protein is 254 kD, which is consistent with the expected results. This indicates that the dCas13b-NAT10 fusion protein is successfully expressed in the cells.
[0102] To confirm that the fusion protein dCas13b-NAT10 can be expressed in the cytoplasm and function to achieve the effect of targeted modification on mRNA, we used NAT10 antibody to perform immunofluorescence experiments to detect the localization of dCas13b-NAT10 in cells. Figure 8 It shows that endogenous NAT10 is almost entirely distributed in the cell nucleus, while dCas13b-NAT10 can be exported out of the nucleus under the action of NES, and can also be detected in large quantities in the cytoplasm.
[0103] Figure 6-8 The results showed that dCas13b-NAT10 could be expressed normally in the cytoplasm.
[0104] Example 4: Verification of the effectiveness of the dCas13b-NAT10 fusion editing system in promoting EV71 and LY6E expression through targeted editing
[0105] 1. RIP experiment using MS2 system
[0106] To verify the effectiveness of the dCas13b-NAT10 editing system (fusion expression vector dCas13b-NAT10 and guide RNA) in viral and host genes, this example used an MS2 system for RIP experiments (referenced from Phillips, S., A. Baek, S. Kim, SL Chen and L. Wu (2022). "Protocol for the generation of HIV-1 genomic RNA with altered levels of N6-methyladenosine." Star Protocols 3(3)).
[0107] The experimental vectors included a recombinant pCDH-MS2 vector containing the EV71 5'-UTR or LY6E 3'-UTR regulatory sequences, a Lenti-MS2-Flag plasmid, a fusion expression vector dCas13b-NAT10, and the corresponding guide RNA. The regulatory RNA was isolated using a Flag antibody and magnetic beads, and then denatured for Dot blotting. The specific process is as follows:
[0108] (1) One day in advance, HEK293T cells were seeded in a 10 cm cell culture dish;
[0109] (2) When the cells grow to a confluence of 70%, transfection is performed. The transfection system is shown in Table 6 below.
[0110] Table 6 Transfection system
[0111]
[0112] The pNAT10 plasmid replaced the fusion expression vector dCas13b-NAT10 as a positive control, and an empty guide RNA was used as a negative control. Each of the four plasmids was diluted in 500 μL of Opti-MEM, and the PEI reagent was diluted in 500 μL of Opti-MEM. Mix well and let stand for 5 minutes. Gently mix the two and let stand for another 20 minutes. Add the plasmids to the culture dish and incubate for 4-6 hours before changing the medium. 48 hours after transfection, discard the supernatant and gently wash the cells three times with PBS.
[0113] (3) The cells were lysed with RIPA lysis buffer containing PMSF and incubated with Flag antibody and Protein G magnetic beads to obtain a protein-antibody-magnetic bead complex. The target RNA was then lysed and extracted from the complex with TRIzol and the concentration was measured.
[0114] (4) Take 500 ng RNA and dilute it to 100 μL with 1 mM EDTA. Then add 60 μL 20×SSC buffer and 40 μL 37% formaldehyde to prepare a mixture and denature it at 65℃ for 30 min. The denatured RNA was spotted on PVDF membrane and nylon membrane and the mixture was heated at 254 nm with 125 mJ / cm 2 UV crosslinking was performed to fix the RNA to the membrane.
[0115] (5) Detect the acetylation (ac4C) modification level in the target RNA using ac4C antibody. The nylon membrane was stained with methylene blue as a loading control.
[0116] 2. Verify fluorescence levels using the dual luciferase reporter system
[0117] To further confirm the effectiveness and accuracy of the dCas13b-NAT10 editing system for targeted ac4C editing, this example used a dual-luciferase reporter system for fluorescence level verification. The regulatory sequence was constructed into a dual-luciferase reporter vector and transfected into HEK293T cells along with the fusion expression vector dCas13b-NAT10 and the corresponding guide RNA.
[0118] The required vectors are: a dual-luciferase reporter vector pmirGLO containing a regulatory sequence, a fusion expression vector dCas13b-NAT10, and the corresponding guide RNA plasmid.
[0119] The specific process is as follows:
[0120] (1) One day in advance, HEK293T cells were seeded in a 24-well plate.
[0121] (2) When the cells grow to a confluence of 70%, transfection is performed. The transfection system is shown in Table 7.
[0122] Table 7 Transfection system
[0123]
[0124] Dilute the three plasmids in 25 μL of Opti-MEM and the PEI reagent in 25 μL of Opti-MEM. Mix well, let stand for 5 minutes, then gently mix the two. Let stand for another 20 minutes before adding them to the corresponding wells. Incubate for 4-6 hours before changing the medium. 24 hours after transfection, discard the supernatant and gently wash the cells three times with PBS.
[0125] (3) Perform the assay according to the instructions of the dual luciferase assay kit (purchased from Promega). Lyse the cells with 1×PLB lysis buffer, take 10 μL of the lysis supernatant and add an equal volume of Luciferase Assay Reagent II in the dark and gently blow evenly. Use a luciferase detector to detect the firefly luciferase value, then add 10 μL of 1×Stop&Glo Reagent and mix well. Detect on the instrument to obtain the Renilla luciferase value, and use the Renilla luciferase value as the internal reference normalization value.
[0126] Dot blot and dual luciferase assays were used to detect the ac4C insertion of the EV71 5'-UTR by the dCas13b-NAT10 editing system. Figure 9 As shown in the figure, guide RNAs designed for sites 331, 339, and 350 of the EV71 5'-UTR all guided dCas13b-NAT10 to insert ac4C into the regulatory region to varying degrees, compared to the empty guide RNA. Stronger ac4C levels were detected at site 350, followed by site 331. Dual-luciferase assays showed a 2.8-fold increase in luciferase activity in the sgRNA-350 group compared to the empty guide RNA control group.
[0127] Effects of EV71 ac4C modification targeted by the dCas13b-NAT10 editing system on viral replication and translation Figure 10shown.
[0128] Figure 9 and 10 The results showed that compared with the empty sgRNA, all three guide RNAs could increase the expression level of EV71 to varying degrees. Among them, sgRNA-350 targeting site 350 had the most significant effect.
[0129] RT-qPCR detection of viral mRNA and protein levels after dCas13-NAT10 was guided by an empty sgRNA or three targeted sgRNAs showed that ac4C modification promoted the translation of downstream viral genes and increased the expression of firefly luciferase. Normalization with Renilla luciferase allowed analysis of ac4C modification on regulatory RNA sequences. This confirmed that dCas13b-NAT10 could target the insertion of ac4C modifications. Among them, sgRNA-350 significantly promoted the replication and translation efficiency of viral genes, with the highest detected ac4C level and an approximately 2.6-fold increase in protein levels, the most significant effect; followed by sgRNA-331, and finally sgRNA-339. This result is consistent with the aforementioned insertion of ac4C: the higher the ac4C level, the stronger the effect on promoting target gene expression.
[0130] Dot blot and dual luciferase assays were used to detect the ac4C insertion of the LY6E 3'-UTR by the dCas13b-NAT10 editing system. Figure 11 As shown in the figure, the guide RNAs designed for sites 3420, 3426, and 3432 of the LY6E 3'-UTR all guided dCas13b-NAT10 to insert ac4C to varying degrees within the regulatory region, compared to the empty guide RNA. The sgRNA-2-targeted site detected the strongest ac4C levels, followed by site 3432. Dual-luciferase assays showed that the luciferase level in the sgRNA-2 group increased by approximately 1.8 times compared to the empty guide RNA control group.
[0131] Effects of dCas13b-NAT10 editing system targeting LY6E ac4C modification on LY6E replication and translation Figure 12 shown.
[0132] Figure 11 and 12 The results showed that compared with the empty sgRNA, the three guide RNAs had no effect on the replication of LY6E, but could increase the protein level of LY6E to varying degrees, among which the sgRNA-2 targeting site 3426 had the most obvious increase effect.
[0133] RT-qPCR assays for LY6E RNA and protein levels following dCas13-NAT10 directed by either an empty sgRNA or three targeting sgRNAs revealed that the dCas13b-NAT10 fusion editing system had no significant effect on LY6E replication. However, sgRNA-2 targeting site 3426 significantly promoted LY6E translation, with high ac4C levels detected, followed by sgRNA-3 targeting site 3432. This result is consistent with the aforementioned ac4C insertion patterns: higher ac4C levels are associated with a stronger effect on target gene protein translation.
[0134] 3. dCas13b-NAT10-directed ac4C modification promotes the expression of EV71 and LY6E
[0135] To further examine changes in target gene expression following targeted ac4C modification using the dCas13b-NAT10 fusion expression vector, this example transfected the dCas13b-NAT10 fusion expression vector with the corresponding guide RNA into RD cells or HEK293T cells, and infected the RD cells with EV71. After 48 hours, cells were harvested for qPCR and Western blot analysis to determine RNA and protein expression levels of EV71 and LY6E. Using EV71 gene detection as an example, the detection process is as follows.
[0136] (1) RD cells were seeded into a six-well plate one day in advance.
[0137] (2) When the cells grow to a confluence of 70%, transfection is performed. The transfection system is shown in Table 8 below.
[0138] Table 8 Transfection system
[0139]
[0140] Dilute 2 μg DNA and P3000 in 100 μL Opti-MEM. At the same time, dilute 4 μL Lip3000 transfection reagent in 100 μL Opti-MEM. Mix well and let stand for 5 minutes. Gently mix the two tubes and let stand for another 20 minutes. Add them to the corresponding wells and culture for 4-6 hours before changing the medium.
[0141] (3) 24 h after transfection, cells were infected with EV71. After 4 h of adsorption, fresh culture medium was replaced and culture was continued. 48 h after infection, the supernatant of the culture medium was discarded and the cells were slowly washed three times with PBS.
[0142] (4) The cells in the well plate were lysed with RIPA lysis buffer, and 5×SDS loading was added to prepare samples. The EV71 protein and nucleic acid levels were detected by Western blot and qPCR.
[0143] HEK293 cells were transfected with dCas13b-NAT10 and the corresponding guide RNA for LY6E using PEI in the same manner as described above. Cells were collected 48 h after transfection. Western blot and qPCR experiments were used to detect changes in LY6 protein levels and replication levels.
[0144] The results are as follows Figure 10 As shown in the figure, it can be seen that after the dCas13b-NAT10 fusion editing system targeted ac4C modification, the RNA level and protein level of EV71 increased to varying degrees, and the most significant promoting effect was achieved by sgRNA-350. Figure 12 As shown, the protein translation level of LY6E also increased accordingly, among which sgRNA-2 targeting site 3426 had the most significant effect. This shows that the dCas13b-NAT10 editing system of the present invention can be guided to the target site according to sgRNA and specifically write ac4C modification, thereby affecting the relevant physiological processes of the target gene, and can be achieved in both exogenous viral genomes and endogenous genomes.
[0145] In summary, compared with the empty guide RNA, the guide RNAs involved in different target sites all have certain targeting functions, and the ac4C levels are correspondingly improved. This shows that the RNAs after the action of different guide RNAs have different degrees of ac4C modification. The dCas13b-NAT1 fusion editing system provided by the present invention can be used for ac4C editing of viral or endogenous gene-specific target sites.
[0146] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details of the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.
Claims
1. A fusion editing system, characterized in that: The fusion editing system is used for ac4C modification of target RNA targeting specific sites; the fusion editing system includes a fusion vector and sgRNA; the fusion vector includes a gene fragment expressing dCas13b protein and a gene fragment expressing NAT10 protein, the sgRNA is used to target and identify the target site for ac4C modification on the target RNA, and the dCas13b protein has a targeting recognition function and has no cutting activity; the gene fragment expressing dCas13b protein and the gene fragment expressing NAT10 protein of the fusion vector are connected by a nuclear export sequence fragment and a gene fragment expressing a flexible connecting peptide.
2. The fusion editing system according to claim 1, characterized in that: The flexible connecting peptide is (SGGS)2-XTEN-(SGGS)2 Linker; the nucleotide sequence of the gene fragment expressing the (SGGS)2-XTEN-(SGGS)2 Linker is shown in SEQ ID NO.
1.
3. A dCas13b protein, characterized in that Derived from Prevotella P5-125.
4. A product, characterized in that Include any of the following: (1) An expression cassette comprising a gene fragment expressing a dCas13b protein, a nuclear export sequence fragment, a flexible connecting peptide, and a gene fragment expressing a NAT10 protein; (2) a fusion vector comprising the expression cassette; (3) An engineered cell containing the expression cassette or the fusion vector; (4) A kit comprising the fusion editing system according to claim 1 or 2.
5. The product according to claim 4, characterized in that In the expression cassette, the gene fragment expressing the dCas13b protein and the gene fragment expressing the NAT10 protein are connected by a nuclear export sequence fragment and a gene fragment expressing a flexible connecting peptide.
6. The product according to claim 5, characterized in that In the expression cassette, the flexible connecting peptide is (SGGS)2-XTEN-(SGGS)2 Linker; the nucleotide sequence of the (SGGS)2-XTEN-(SGGS)2 Linker is shown in SEQ ID NO.
1.
7. A method for preparing the fusion editing system according to claim 1 or 2, characterized in that: The following steps are involved: The gene fragment expressing the dCas13b protein, the nuclear export signal NES sequence and the gene fragment expressing the NAT10 protein are sequentially connected behind the EF-1α promoter of the original vector I containing the EF-1α promoter, and the gene fragment expressing the flexible connecting peptide is inserted between the nuclear export signal NES sequence and the gene fragment expressing the NAT10 protein to obtain the fusion vector; An sgRNA is designed for the target site of ac4C modification on the target RNA; a direct repeat sequence corresponding to dCas13b is inserted after the U6 promoter in the original vector II containing the U6 promoter, and an oligonucleotide chain corresponding to the sgRNA is inserted between the U6 promoter and the direct repeat sequence to obtain a recombinant vector; the recombinant vector is transformed into competent cells, and the sgRNA is obtained by culture and screening.
8. The application of the fusion editing system according to claim 1 or 2, characterized in that: Used for ac4C modification of target sites on target RNA for purposes other than disease diagnosis and treatment.
9. A method for modifying a target site on a target RNA by ac4C without the purpose of disease diagnosis or treatment, characterized in that: Selecting a cell, a target RNA in the cell, and a target site for ac4C modification on the target RNA; The fusion editing system of claim 1 or 2 is transfected into cells containing the target RNA and the target site, and ac4C modification is performed on the cytosine of the target site.