Calmodulin-like gene CML43-V in haynaldia villosa and application thereof

By cloning the calmodulin gene CML43-V from Triticeae villosa and silencing it using VIGS technology to construct an overexpression vector, the problem of insufficient resistance of wheat to low temperature stress was solved, and the frost resistance of wheat varieties under low temperature conditions was enhanced.

CN120683122APending Publication Date: 2025-09-23NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510833294.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-20
Publication Date
2025-09-23

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively improve wheat's resistance to low temperature stress, especially under low temperature stress, wheat is easily damaged, affecting yield and quality.

Method used

The calmodulin gene CML43-V from Triticum vulgare was cloned and utilized. After silencing the gene through virus-induced gene silencing (VIGS), an overexpression vector was constructed and introduced into non-freeze-resistant wheat varieties to enhance their low-temperature resistance.

Benefits of technology

It significantly improves the resistance of wheat varieties to low temperatures and enhances their survival ability and yield under low temperature conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120683122A_ABST
    Figure CN120683122A_ABST
Patent Text Reader

Abstract

The invention discloses a calmodulin-like gene CML43-V in haynaldia villosa and an application of the calmodulin-like gene CML43-V. The cDNA (complementary deoxyribonucleic acid) sequence of CML43-V is SEQ ID NO.1, and the amino acid sequence coded by the CML43-V is SEQ ID NO.2. The gene is from a durum wheat-haynaldia villosa double diploid STH36-3. The expression of the CML43-V in the anti-freezing double-diploid material STH36-3 is enhanced under low-temperature induction, and the expression level of the CML43-V is far higher than that of the CML43-V in a non-anti-freezing double-diploid material STH78-5. The method comprises the following steps: constructing a transgenic overexpression vector of a CML43-V gene, and transforming the overexpression vector into a non-antifreeze receptor material Fielder by utilizing an agrobacterium tumefaciens-mediated transformation technology, so as to obtain a T1-generation positive transgenic plant with enhanced resistance to low temperature. Therefore, the CML43-V is expected to be used for genetic engineering breeding, and the low-temperature resistance of wheat is expected to be improved when the CML43-V is introduced into a non-freezing-resistant wheat variety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and discloses a calmodulin-like gene CML43-V in Triticum villosa and application thereof. Background Art

[0002] Wheat (Triticum aestivum L.) is the world's most widely cultivated crop and a vital food source for human survival. Approximately 35% to 40% of the global population relies on wheat as their staple food. During its growth, wheat is susceptible to adverse environmental stresses such as low temperatures, high temperatures, and drought. Frequent late spring cold spells caused by low temperatures pose a serious threat to wheat production. Therefore, these cold spells have become a major agrometeorological disaster limiting stable, high, and high-quality wheat yields. The discovery and utilization of frost-tolerance genes is of great practical significance for ensuring stable and high wheat yields.

[0003] Wheat frost damage refers to the damage caused by long-term severe low temperatures below 0°C or drastic temperature changes during the period from winter dormancy to early spring germination (Yi Ying, Guo Zhifu, Zhang Yulong, et al. Current status and prospects of research on winter wheat frost resistance [J]. Hubei Agricultural Sciences, 2013, 052(12): 2729-2732, 2756). When wheat encounters frost damage, complex physiological and biochemical changes will occur in its body (mainly involving cell membrane systems, osmotic regulatory substances, antioxidant systems, photosynthetic characteristics, and endogenous hormones) to respond to the sudden change in external temperature and reduce the damage caused by low temperature to itself. 2+ As a second messenger, it plays an important role in the plant's response to low temperature (Jian Lingcheng, Wang Hong. Calcium (Ca 2+ ) in plant cold resistance [J]. Chinese Journal of Cell Biology, 2002, 24(3):166-171). Under normal growth conditions, Ca in plant cells 2+ The concentration is at a low level, but when plants are subjected to adverse stress, the Ca 2+ The level will surge in a short period of time, thereby generating and amplifying calcium signals (DoddAN, Kudla J, Sanders D. The language of calcium signaling. Annual Review of Plant Biology. 2010, 61: 593-620). 2+ During signal transduction, Ca 2+ Able to interact with its downstream calcium sensors (calmodulin, calmodulin-like, calcineurin B-like protein, Ca 2+Calmodulin binds to and activates calcium-dependent protein kinases. These activated protein kinases can further regulate the expression of downstream stress response-related genes, thereby regulating various physiological and metabolic responses in plants (Reddy AS, Ali GS, Celesnik H, Day IS. Coping with stresses: roles of calcium- and calcium / calmodulin-regulated gene expression. Plant Cell. 2011, 23(6):2010-32).

[0004] Research on the mechanism by which calcium receptors regulate plant responses to low temperatures has made some progress. In plants, some calcium receptors can positively regulate the process of plant response to low temperatures, while some calcium receptors negatively regulate the process of plant response to low temperatures. For example, in Arabidopsis, AtCaM4 interacts with a novel CaM-binding protein PATL1 and negatively regulates its low temperature tolerance (Chu M, Li J, Zhang J, Shen S, Li C, Gao Y, Zhang S. AtCaM4 interacts with aSec14-like protein, PATL1, to regulate freezing tolerance in Arabidopsis in aCBF-independent manner. Journal of Experimental Botany. 2018, 12, 69(21): 5241-5253). In tomato, overexpression of the SlCML37 gene can significantly improve the tolerance of the fruit of the transgenic plants to cold stress (Tang M, Xu C, Cao H, Shi Y, Chen J, Chai Y, Li Z. Tomato calmodulin-like protein SlCML37 is a calcium (Ca 2+)sensor that interacts with proteasome maturationfactor SlUMP1 and plays a role in tomato fruit chilling stress tolerance.Journal of Plant Physiology.2021,258-259:153373). The expression of the MsCML10 gene in alfalfa is induced by low temperature, and the cold tolerance of transgenic alfalfa and Medicago truncatula overexpressing the MsCML10 gene is improved (Yu S,Wu J,SunY,Zhu H,Sun Q,Zhao P,Huang R,Guo ZA calmodulin-like protein (CML10) interacts with cytosolic enzymes GSTU8 and FBA6 to regulate cold tolerance.Plant Physiology.2022,28,190(2):1321-1333). CaM6 negatively regulates cold tolerance of tomato by attenuating the expression of ICE1-dependent COR genes in tomato (Lin R, Song J, Tang M, Wang L, Yu J, Zhou Y. CALMODULIN6 negatively regulates cold tolerance by attenuating ICE1-dependent stress responses in tomato. Plant Physiology. 2023, 26, 193(3): 2105-2121).

[0005] There are two main methods for studying plant gene function: gain-of-function and loss-of-function. Currently, most commonly used plant gene function research methods rely on stable genetic transformation systems, such as overexpression transgenic technology and RNAi transgenic silencing technology, but these experiments have long cycles and are complex to operate (Hao Mengyuan, Hang Qi, Shi Gongyao. Application and Prospect of VIGS Gene Silencing Technology in Crop Gene Function Research [J]. China Agricultural Science and Technology Herald, 2022, 24(1):1-13). Compared with traditional gene function analysis methods, VIGS can quickly silence and functionally identify target genes, and has the characteristics of short experimental cycles and simple operations (Li Zhiqiang, Cao Yanting, Guo Xiaolong, et al. Application of VIGS, a gene function research tool, in plants [J]. Genomics and Applied Biology, 2018, 37(02):915-923). Virus-induced gene silencing (VIGS) involves constructing a target gene fragment onto a VIGS vector to generate a recombinant viral vector. After inoculation into plants, the virus infects and migrates, stimulating the plant's immune response mechanism and silencing the target gene. Among various viral vectors, Barley Stripe Mosaic Virus (BSMV) has been identified as the preferred vector for silencing genes in barley and wheat (Holzberg S, Brosio P, Gross C, Pogue GP. Barley stripemosaic virus-induced gene silencing in a monocot plant. Plant Journal. 2002, 30(3):315-27).

[0006] Initially, the laboratory used the introduced durum wheat variety "Zhongyin 1286" (2n=4x=28, AABB) as the female parent and a different source of Triticum villosa line (2n=2x=14, VV) as the male parent to generate F1 hybrids. The F1 plants were treated with colchicine at the tillering stage to induce chromosome doubling, resulting in the creation of durum wheat-Triticum villosa amphidiploids (2n=6x=42, AABBVV). To date, over 200 durum wheat-Triticum villosa amphidiploids with different Triticum villosa backgrounds have been synthesized, all with numbers beginning with "STH." Years of field and laboratory phenotyping have consistently shown that durum wheat is not frost-tolerant. Significant differences in freezing tolerance were observed among amphidiploids from different Triticum villosa lines. Amphidiploid numbered STH36-3 was frost-tolerant, while amphidiploid numbered STH78-5 was not. These two amphidiploids, despite having similar backgrounds, exhibited significant differences in freezing tolerance. Transcriptome sequencing was used to generate gene expression data for the freeze-tolerant amphidiploid STH36-3 and the non-freezing-tolerant amphidiploid STH78-5. By comparing gene expression levels between the extremely resistant amphidiploids, researchers identified a gene, CML43-V, that is upregulated in both plants upon low-temperature induction. This gene may play a role in plant responses to low-temperature stress. The CML43-V gene was cloned from the amphidiploid STH36-3 and its function investigated using BSMV-VIGS silencing. The researchers found that CML43-V positively regulates freezing tolerance in amphidiploids. Silencing CML43-V in the amphidiploid STH36-3 significantly reduced freezing tolerance. Furthermore, a transgenic overexpression vector for the CML43-V gene was constructed and transformed into the non-freezing-tolerant recipient plant, Fielder, using Agrobacterium-mediated transformation. The resulting T1 generation of positive transgenic plants exhibited enhanced cold tolerance. CML43-V is expected to be used in genetic engineering breeding. Introducing it into non-freeze-resistant wheat varieties will improve wheat's resistance to low temperatures. Summary of the Invention

[0007] The purpose of the present invention is to address the above-mentioned defects of the prior art and provide an expression vector and application of the Triticum villosa calmodulin gene CML43-V.

[0008] The purpose of the present invention can be achieved through the following technical solutions:

[0009] The Triticum villosa calmodulin gene CML43-V is from the durum wheat-Triticum villosa amphidiploid STH36-3, and its nucleotide sequence is SEQ ID NO.1.

[0010] The protein CML43-V encoded by the Triticum villosa calmodulin gene CML43-V has an amino acid sequence of SEQ ID NO.2.

[0011] The recombinant expression vector pLGY-OE3:CML43-V contains the calmodulin-like gene CML43-V.

[0012] The recombinant expression vector of the calmodulin-like gene CML43-V is preferably obtained by using pLGY-OE3 as a starting vector and inserting the CML43-V gene between the BamHI and StuⅠ restriction sites of pLGY-OE3.

[0013] The application of the Triticum villosa calmodulin gene CML43-V in breeding frost-resistant wheat varieties.

[0014] The invention relates to an application of the overexpression vector of the Triticum villosa calmodulin gene CML43-V in breeding frost-resistant wheat varieties.

[0015] Beneficial effects

[0016] The present invention cloned a calmodulin-like gene, CML43-V, and the protein it encodes, CML43-V, from the durum wheat (Triticum villosa) amphidiploid STH36-3. Inhibiting CML43-V gene expression using virus-mediated gene silencing (VIGS) significantly reduced the amphidiploid STH36-3's resistance to low temperatures. Therefore, silencing CML43-V in STH36-3 renders the material sensitive to low temperatures, suggesting that CML43-V plays a positive regulatory role in the low-temperature response. CML43-V can be used in genetic engineering breeding to construct an overexpression vector, pLGY-OE3:CML43-V, which can be introduced into non-freeze-resistant wheat varieties to improve their low-temperature resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Agarose gel electrophoresis results of the cloned calmodulin-like gene CML43-V in the durum wheat-Triticum villosa amphidiploid STH36-3.

[0018] Figure 2 RT-qPCR was used to analyze the expression of CML43-V in the cryoresistant amphidiploids STH29-2 and STH37-1. 0 hour: relative expression level of CML43-V in uninduced samples; 0.5, 6, and 24 hours: relative expression level of CML43-V in low-temperature-induced samples.

[0019] Figure 3 Amplification of the CML43-V insert for VIGS vector construction.

[0020] Figure 4 Schematic diagram of the reverse insertion of the CML43-V gene into the BSMV:γ vector.

[0021] Figure 5VIGS technology was used to silence the CML43-V gene in amphidiploid STH36-3 to study the function of CML43-V.

[0022] A. Mottled phenotype of plant leaves 14 days after inoculation with BSMV virus; B. Low temperature experimental phenotype of CK plants; C. Low temperature experimental phenotype of control BSMV:γ plants; D. Low temperature experimental phenotype of BSMV:CML43-V plants; E. Detection of the silencing efficiency of the CML43-V gene in leaves of plants inoculated with BSMV:CML43-V; F. Conductivity measurement results of leaves of CK, BSMV:γ and BSMV:CML43-V inoculated plants before and after low temperature treatment; G. Statistics of plant survival rates after low temperature treatment of CK, BSMV:γ and BSMV:CML43-V inoculated plants. Figure 6 Schematic diagram of the construction of the CML43-V overexpression vector pLGY-OE3:CML43-V.

[0023] Figure 7 PCR identification of CML43-V transgenic plants,

[0024] A. Electrophoretogram of the identification results of primer pair CML43-V-F1-R1; B. Electrophoretogram of the identification results of primer pair CML43-V-F2-R2.

[0025] Figure 8 Identification of low temperature resistance of CML43-V transgenic plants,

[0026] A. Low temperature experimental phenotypes of CK and CML43-V positive and negative transgenic plants; B. Conductivity measurement results of leaves of CK and CML43-V positive and negative transgenic plants before and after low temperature treatment; C. Plant survival rate statistics of CK and CML43-V positive and negative transgenic plants after low temperature treatment. DETAILED DESCRIPTION

[0027] Example 1 Cloning of the Calmodulin-like Gene CML43-V in Amphidiploid STH36-3 Induced by Low Temperature

[0028] Durum wheat-Haynaldiavillosa amphiploids STH36-3 and STH78-5 were created in our laboratory (Liu Y, Liu J, Huang Z, Fan K, Guo X, Xing L, Cao A. Phenotypic characterization and gene mapping of hybrid necrosis in Triticum durum-Haynaldiavillosa amphiploids. Theor Appl Genet. 2024 Jul 15; 137(8): 185. doi: 10.1007 / s00122-024-04691-0. PMID: 39009774; PMCID: PMC11249415). Material creation process: Crosses were conducted using Zhongyin 1286 as the female parent and Triticum villosa lines CI061 and CI103 as the male parents. F1 hybrids were harvested and treated with colchicine at the tillering stage to induce chromosome doubling. Seeds were harvested after maturity, yielding the amphidiploids STH36-3 and STH78-5. The two amphidiploids had similar genetic backgrounds but differed significantly in their freezing tolerance, suggesting that the genes responsible for this difference originated from Triticum villosa. To identify genes within the Triticum villosa V genome that confer freezing tolerance in the amphidiploid STH36-3, transcriptome sequencing was used to generate digital gene expression profiles in the freezing-tolerant amphidiploid STH36-3 and the non-freezing-tolerant amphidiploid STH78-5. This profile was then used to identify differentially expressed genes in the extremely resistant material. In this study, we focused on the genes in the V genome of Elymus villosa whose expression was induced by low temperature. Therefore, when performing transcriptome data analysis, we only focused on the differentially expressed genes from the V genome.The specific process is as follows: seeds of the frost-resistant amphidiploid STH36-3 and the non-frost-resistant amphidiploid STH78-5 were sown in culture dishes for germination, and transplanted into pots after whitening. When the materials grew to the four-leaf stage, they were placed in a low-temperature incubator for low-temperature treatment at -4°C. Samples were taken before inoculation and 0.5, 6, and 24 hours after inoculation, and RNA was extracted (using Invitrogen's Trizol reagent) to generate eight sequencing samples: STH36-3_0h (sample of STH36-3 induced for 0 hours), STH36-3_30min (sample of STH36-3 induced for 30 minutes), and STH36-3_0h (sample of STH36-3 induced for 0 hours). The samples were induced by STH36-3 for 6 minutes), STH36-3_6h (samples induced by STH36-3 for 6 hours), STH36-3_24h (samples induced by STH36-3 for 24 hours), STH78-5_0h (samples induced by STH78-5 for 0 hours), STH78-5_30min (samples induced by STH78-5 for 30 minutes), STH78-5_6h (samples induced by STH78-5 for 6 hours), and STH78-5_24h (samples induced by STH78-5 for 24 hours) and sent to Beijing Liuhe BGI Genomics Co., Ltd. for transcriptome sequencing. The transcriptional profiles of STH36-3_0h were compared with those of STH36-3_30min, STH36-3_6h, and STH36-3_24h, respectively. The transcriptional profiles of STH78-5_0h were compared with those of STH78-5_30min, STH78-5_6h, and STH78-5_24h, respectively. At the same time, the transcriptional profiles of the two materials during the same time period were compared. The ratio of the number of sequencing reads greater than 2 was used as the criterion to screen genes whose expression was upregulated by low temperature in amphidiploid STH36-3. One of the differentially expressed genes was GWHTBJXA023610, a calmodulin-like gene. This gene was differentially expressed when STH36-3_0h was compared with STH36-3_30min, STH36-3_6h, and STH36-3_24h, indicating that the gene was induced by low temperature in the freeze-resistant amphidiploid STH36-3. It was also differentially expressed when STH78-5_0h was compared with STH78-5_30min, STH78-5_6h, and STH78-5_24h, indicating that the gene was differentially expressed. The expression of this gene was induced by low temperature in the non-freeze-resistant amphidiploid STH78-5. It was shown as a differentially expressed gene when STH36-3_30min was compared with STH78-5_30min, STH36-3_6h was compared with STH78-5_6h, and STH36-3_24h was compared with STH78-5_24h. Moreover, the expression level of this gene in the freeze-resistant amphidiploid STH36-3 was higher than that in the non-freeze-resistant amphidiploid STH78-5, indicating that there was a difference in the expression of this gene between the freeze-resistant amphidiploid STH36-3 and the non-freeze-resistant amphidiploid STH78-5.Based on the analysis of digital gene expression profiles, it was preliminarily determined that GWHTBJXA023610 was closely related to the low temperature resistance of amphidiploids.

[0029] RT-PCR was performed using RNA extracted from leaves of the cryoresistant amphidiploid STH36-3 strain after cold induction for 0, 0.5, 6, and 24 hours, mixed with reverse-transcribed cDNA as a template. Primers P1 (ATGGCCGGCGGCGGCGCA) and P2 (TCAATGCTGCTGCTGCTGCT) were designed based on the digital gene expression profile for the gene GWHTBJXA023610. The specific amplification process was as follows: 2 μl of cDNA template (100 ng / μl), 2 μl of P1 primer (10 μM), 2 μl of P2 primer (10 μM), 25 μl of Phanta Max buffer (2×), 1 μl of dNTPMix (10 mM), 1 μl of Phanta Max Super-Fidelity DNA polymerase (1 U / μl) (Vazyme, China), and water was added to 50 μl. PCR reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ for 15 s, 58℃ for 15 s, 72℃ for 30 s, 35 cycles; 72℃ extension for 5 min. PCR products were tested for specificity and size of the amplified bands by 1% agarose gel electrophoresis (see Appendix). Figure 1 ) and recovered the specific amplified band (using a standard agarose gel DNA recovery kit, TIANGEN). The amplified specific band was recovered and cloned into a Topo vector (Adlai, China), transformed into DH5α competent cells, and single clones containing the target fragment were selected for sequencing. Analysis of the sequencing results revealed a 510 bp clone sequence. Using the ORF Finder on the NCBI website, it was predicted to contain a 510 bp ORF (SEQ ID NO. 1) encoding 169 amino acids (SEQ ID NO. 2). Because this gene originates from the V genome of Triticum vulgare and shares the highest homology with the HvCML43 gene from barley, this gene was named CML43-V.

[0030] Example 2 Expression Analysis of CML43-V in Freeze-Resistant Amphidiploids STH29-2 and STH37-1

[0031] To investigate whether CML43-V is also upregulated by low temperature in other cold-tolerant amphidiploids (male parents derived from different Triticum villosa lines), we examined the expression of the CML43-V gene in the amphidiploids STH29-2 and STH37-1. Amphidiploids STH29-2 and STH37-1 were developed in our laboratory and identified as cold-tolerant by low-temperature phenotype. The F1 hybrids were harvested using Zhongyin 1286 as the female parent and Triticum villosa lines CI054 and CI062 as the male parents. The F1 plants were treated with colchicine at the tillering stage to induce chromosome doubling. The seeds from the mature F1 plants were harvested as the amphidiploids STH29-2 and STH37-1. Real-time quantitative PCR (qPCR) analysis was performed using reverse-transcribed cDNA from RNA obtained from four-leaf-stage amphidiploids after low-temperature induction for 0, 0.5, 6, and 24 hours. Primers P3 (CGGCGCAGCAGCAGCAGC) and P4 (CGTCGGGGACTGGCCCAG) were used as templates. The PCR protocol was as follows: PCR reactions were performed on a LightCycler 480II instrument (Roche, Switzerland), and fluorescence was detected. A 20-μL PCR reaction system contained 10 μL of 2× SYBR Green PCR Master Mix, 0.5 μM primers P3 and P4, and 2 μL of reverse-transcribed cDNA template. Amplification parameters were: 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 1 minute. Melting curves were determined after the reaction. Gene expression levels were analyzed using the LightCycler 480 system software. The results showed that in the cold-resistant amphidiploids STH29-2 and STH37-1, CML43-V expression was up-regulated by low temperature (Appendix Figure 2 ), further indicating that CML43-V is upregulated in cryoresistant materials by low temperature, and inferring that CML43-V plays a positive regulatory role in the response of amphidiploids to low temperature.

[0032] Example 3 Amplification of the CML43-V Insert for Construction of the BSMV:CML43-V Vector

[0033] Following the principles of VIGS gene silencing experimental target design (Panwar V, Kanyuka K. Virus-Induced Gene Silencing in Wheat and Related Monocot Species. Methods in Molecular Biology. 2022, 2408: 95-107), primer P5 ( CATTTTTTTTTTTT TTTAGCTAGC GAGTTCCTCGCGCTCATGTCC) and P6( GATGATTCTTCTTCCGTTGCTAGC The terminal sequence of the linearized vector (the underlined sequence at the 5' end of the primer) was introduced into the 5' end of P5 and P6, resulting in 24 bp of sequence at the 5' and 3' ends of the PCR product, each identical to the ends of the linearized vector. The specific amplification was performed as follows: PCR was performed using primers P5 and P6 and a Topo vector containing the CML43-V gene as a template to amplify a 164 bp fragment of CML43. The PCR procedure was as follows: 2 μl of plasmid template (100 ng / μl), 2 μl of each P5 and P6 primer (10 μM), 25 μl of PhantaMax buffer (2×), 1 μl of dNTPMix (10 mM), 1 μl of PhantaMax Super-Fidelity DNA polymerase (1 U / μl) (Vazyme, China), and water was added to 50 μl. PCR reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ for 15 s, 58℃ for 15 s, 72℃ for 30 s, 35 cycles; 72℃ extension for 5 min. PCR products were tested for specificity and size of the amplified bands by 1% agarose gel electrophoresis (see Appendix). Figure 3 ), and the specific amplified bands were recovered using a common agarose gel DNA recovery kit (TIANGEN, China).

[0034] Example 4 Construction of BSMV:CML43-V vector

[0035] The BSMV:PDS vector was fully digested with the restriction endonuclease NheI, resulting in an approximately 200-bp insert (PDS gene sequence) and a vector fragment larger than 2 kb. Using homologous recombination, the recovered CML43-V amplified fragment was ligated into the NheI-digested BSMV:PDS vector using the ClonExpress II One-Step Cloning Kit (Vazyme, China). The ligation product was transformed into competent Escherichia coli DH5α, plated with ampicillin-resistant plates, and single colonies were selected and shaken. Recombinants were initially identified using colony PCR, and candidate recombinants were confirmed by sequencing. The specific steps are as follows: first, PCR amplification was performed using P5 and P6 as left and right primers, followed by agarose gel electrophoresis to preliminarily screen recombinants; the candidate recombinants were sent to Beijing Qingke Biotechnology Co., Ltd. for reverse sequencing, and the sequencing primer was the universal primer M13R (sequence composition: 5'-CAGGAAACAGCTATGACC-3'). The sequencing results were compared with the inserted sequence using BioEdit software. The comparison results showed that the CML43-V gene was reversely inserted between the NheⅠ restriction sites of the BSMV:γ vector, indicating that the BSMV:CML43-V vector was successfully constructed and could be used for the next step of in vitro transcription and induced gene silencing (see Appendix). Figure 4 ).

[0036] Example 5 Inducing CML43-V Silencing in Freeze-Resistant Amphidiploid STH36-3 Using VIGS Technology

[0037] In this study, the BSMV-VIGS technique was used to inoculate viruses containing target gene fragments into the freeze-resistant amphidiploid STH36-3, and then the freeze resistance of the silenced plants was identified to clarify whether the target gene was involved in the process of the amphidiploid STH36-3 responding to low temperature stress.

[0038] In vitro transcription process: Use Tiangen Plasmid Extraction Kit to extract BSMV:α, BSMV:β, BSMV:γ, BSMV:PDS, and BSMV:CML43-V vector plasmids according to the instructions. Use SpeⅠ to digest BSMV:β, and the other four plasmids are digested with MluⅠ. After sufficient digestion, linearized vectors are obtained. Linearized vectors are used to extract BSMV:α, BSMV:β, BSMV:γ, BSMV:PDS, and BSMV:CML43-V vector plasmids according to the instructions. Purification with Plasmid Mini Kit I (Omega Bio-Tek, USA). TMThe linearized vector was transcribed in vitro using the Large Scale RNA Production Systems kit and the Ribo m7G Cap Analog kit (Promega, USA). After in vitro transcription, equal volumes of the α-chain, β-chain, and γ-chain transcripts were mixed and diluted with three volumes of DEPC water. 2× GKP Buffer (50 mM glycine, 30 mM K₂HPO₄, pH 9.2, 1% bentonite, 1% celite) was then added and the mixture was stored at −80°C until use.

[0039] Inoculation of virus on leaves: Before inoculation, select plants with consistent growth status and in the two-leaf stage, and water the corresponding plants thoroughly. Wear powder-free latex gloves during inoculation, dip your thumb and index finger in the virus mixture, rub gently, take 10μl of the virus mixture on the tip of your index finger, and use two fingers to rub the virus into the second leaf of the plant with moderate force until all the liquid disappears. At this time, you can feel the resistance of your fingers rubbing the leaves significantly increased, and a slight "red" sound is emitted. After all the inoculations are completed, spray the plants with a small amount of DEPC water with a spray bottle, cover the plants with a plastic bag, and then place them in a dark growth room at about 25°C. After 24 hours, remove the plastic bag and transfer the plants to normal culture conditions for growth. The growth temperature is controlled at 25±2°C.

[0040] Target gene silencing efficiency testing: 14 days after virus inoculation, leaves of plants inoculated with the empty vector control BSMV:γ and the gene-carrying virus BSMV:CML43-V were sampled and RNA was extracted. Leaf RNA was extracted using Invitrogen's Trizol. Gloves and masks were worn throughout the experiment to avoid RNase contamination. The pipette tips and centrifuge tubes required for the experiment were treated with DEPC water. The extracted RNA was measured using a NanoDrop 2000 (Thermo Fisher, USA) and the concentration was adjusted to 1 μg / μl. Reverse transcription was performed using the HiScript IIQ RT SuperMix for qPCR (+gDNAwiper) kit (Vazyme, China). Real-time fluorescence quantitative PCR was performed using the reverse-transcribed cDNA as a template and primers P3 and P4 to detect the silencing efficiency of CML43-V.

[0041] Example 6 Detection of changes in low temperature resistance after silencing the CML43-V gene in the antifreeze material STH36-3

[0042] After virus inoculation, when the plants grew to the four-leaf, one-heart stage, they were placed in a low-temperature incubator and kept at -4°C for 12 hours before testing their frost tolerance. Three indoor frost tolerance test criteria were used in this study: 1. Plant status: Non-frost-resistant plants had dark green, water-soaked leaves, limp stems, and the entire plant fell to the ground; frost-resistant plants showed little damage from phenotypic observations, with upright stems and no water-soaked leaves (Li Fei, Jin Liping. Evaluation of frost tolerance of wild potato materials [J]. Chinese Potato, 2007, 3: 139-141; Zhang L, Zhang N, Wang S, Tian H, Liu L, Pei D, Yu X, Zhao L, Chen FA TaSnRK1α modulates TaPAP6L-mediated wheat cold tolerance through regulating endogenous jasmonic acid. Advanced science. 2023, 10(31): e2303478); 2. Relative conductivity: relative conductivity = C1 / C2 × 100%. After low temperature treatment, the relative conductivity of frost-resistant materials is generally significantly lower than that of non-freeze-resistant materials (Zhao Ruiling, Zhao Yong, Xu Ke, et al. Study on identification of wheat cold resistance by indoor freezing method [J]. Journal of Plant Genetic Resources, 2019, 20(2): 284-296); 3. Frozen survival rate: frozen survival rate = number of frozen surviving plants / total number of plants. After low temperature treatment, the frozen survival rate of frost-resistant materials is generally significantly higher than that of non-freeze-resistant materials (Zhao Ruiling. Identification of wheat seedling cold resistance methods and genome-wide association analysis of related traits [D]. Hebei Agricultural University, 2018). This study used these three indicators to comprehensively evaluate the changes in frost resistance of virus-inoculated materials after low temperature treatment.

[0043] Fourteen days after virus application, most of the silenced plants developed a mottled phenotype. Leaves from plants exhibiting this mottled phenotype were analyzed for CML43-V expression. Results showed a significant decrease in relative CML43-V expression in CML43-V-silenced plants compared to control plants (inoculated with BSMV:γ), indicating successful silencing of the CML43-V gene. Plants in the uninoculated (CK) and BSMV:γ control groups, as well as experimental plants inoculated with BSMV:CML43-V, were placed in a -4°C incubator for 12 hours. Their cold-treatment phenotypes were collected and analyzed. Results showed that in both control groups, the plants remained upright after cold treatment, and the vast majority of leaves did not develop a dark green or water-soaked appearance. However, in the experimental group, most leaves became limp, and some developed a dark green or water-soaked appearance. This suggests that silencing the CML43-V gene may have altered the plants' freezing tolerance. The relative electrical conductivity of plant leaves was measured before and after low-temperature treatment using a FE32-Standard conductivity meter (METTLERTOLEDO, USA). The results showed that before low-temperature treatment, the relative electrical conductivity of leaves in CK, BSMV:γ, and BSMV:CML43-V plants was 27.84%, 32.13%, and 31.08%, respectively. There was no significant difference in the relative electrical conductivity between the control and experimental groups. However, after low-temperature treatment, the relative electrical conductivity of leaves in CK, BSMV:γ, and BSMV:CML43-V plants was 52.72%, 59.41%, and 74.29%, respectively. The relative electrical conductivity of leaves in plants with CML43-V gene silencing was significantly higher than that in the control group, further indicating that silencing the CML43-V gene reduced the plants' freezing tolerance. After low-temperature treatment, the plants were thawed at 4°C for 20 hours and then recovered at 22°C for 2 weeks. The freezing survival rate of the plants was then calculated. The statistical results showed that after recovery, the freezing survival rate of CK plants was 100%, the freezing survival rate of BSMV:γ plants was 100%, and the freezing survival rate of BSMV:CML43-V plants was 27.50%. After silencing the CML43-V gene, the freezing survival rate of the plants was significantly lower than that of the control group. In summary, the CML43-V gene is involved in the low temperature response process of the amphidiploid STH36-3 and can positively regulate the freezing resistance of the amphidiploid STH36-3 (see Appendix). Figure 5 ).

[0044] Example 7 Construction of CML43-V transgenic expression vector

[0045] Using the artificially synthesized plasmid containing the full-length CML43-V gene as a template, primer P7 ( CTTCTGCAGCCCTAGGCCT ATGGCCGGCGGCGGCGCAGC) and P8( AAGCTCTGAGCTCGGATCC TCAATGCTGCTGCTGCTGCT) was amplified by PCR. The terminal sequences of the linearized vector (underlined sequences at the 5' ends of primers) were introduced into the 5' ends of P7 and P8. Through PCR amplification, the 5' and 3' ends of the CML43-V gene were enriched with 19 bp of sequences identical to those at both ends of the linearized vector, respectively. The PCR protocol consisted of 2 μl of plasmid template (100 ng / μl), 2 μl of P7 primer (10 μM), 2 μl of P8 primer, 25 μl of PhantaMax buffer (2×), 1 μl of dNTPMix (10 mM), and 1 μl of PhantaMax Super-Fidelity DNA polymerase (1 U / μl) (Vazyme, China), to a volume of 50 μl with water. PCR reaction conditions included initial denaturation at 95°C for 3 min, 35 cycles of 95°C for 15 s, 58°C for 15 s, and 72°C for 30 s, and extension at 72°C for 5 min. The PCR products were subjected to 1% agarose gel electrophoresis to detect the specificity and size of the amplified bands. At the same time, the pLGY-OE3 vector was fully double-digested with restriction endonucleases StuⅠ and BamHⅠ. The specific amplified bands and linearized vectors were recovered using a common agarose gel DNA recovery kit (TIANGEN, China). According to the principle of homologous recombination, the ClonExpress II One Step Cloning Kit (Vazyme, China) was used to recombinate the CML43-V gene into the pLGY-OE3 vector. Sequencing verification showed that the recombinant vector pLGY-OE3:CML43-V was successfully constructed (see Appendix). Figure 6 ).

[0046] Example 8 Transformation of the common wheat variety Fielder with CML43-V and PCR identification of transgenic plants

[0047] Using the wheat variety "Fielder" as the recipient and the overexpression vector pLGY-OE3:CML43-V constructed in Example 7, immature embryos of Fielder were transformed by Agrobacterium infection, resulting in 30 T0-generation transgenic wheat plants. Nine T0-derived T1-generation transgenic wheat plants were selected for molecular and cold resistance characterization.

[0048] Two pairs of specific primers, CML43-V-F1 (TGTCGATGCTCACCCTGTTG) and CML43-V-R1 (ATCATCCCGTCCACCTCCTC) and CML43-V-F2 (AGCCCTGCCTTCATACGCT) and CML43-V-R2 (TGGATCATCCCGTCCACCT), were designed between the pLGY-OE3 vector and the CML43-V gene to amplify partial vector and target gene sequences. These two primer pairs were used for PCR molecular identification of T1 transgenic plants. The results showed that the target band could be amplified from the pLGY-OE3:CML43-V recombinant plasmid, while no target band appeared in the receptor Fielder and water controls. The identification results of primers CML43-V-F1-R1 and CML43-V-F2-R2 were consistent. The T1 generation plants numbered T1-1-2, T1-1-4, T1-9-1, T1-9-2, T1-9-6, and T1-9-7 were selected as positive transgenic plants (see attached). Figure 7 ).

[0049] Example 9 Identification of low temperature resistance of CML43-V transgenic plants

[0050] The CK plants (wild-type Fielder variety) and CML43-V transgenic plants that had undergone PCR molecular identification were cultured to the four-leaf and one-heart stage, and then the materials were placed in a low-temperature incubator and treated at -4°C for 12 hours before the plants' frost resistance was identified. The CK plants and transgenic plants were placed in a -4℃ low-temperature incubator and taken out after 12 hours of low-temperature treatment. Their low-temperature treatment phenotypes were collected. The results showed that after low-temperature treatment, most of the leaves of the control group CK plants and CML43-V negative transgenic plants T1-21-1, T1-21-2, and T1-21-3 became limp and some of the leaves were dark green and water-soaked. However, after low-temperature treatment, the CML43-V positive transgenic plants T1-1-2, T1-1-4, T1-9-1, T1-9-2, T1-9-6, and T1-9-7 in the experimental group remained upright as a whole, and most of the leaves did not appear dark green or water-soaked. Therefore, it can be preliminarily judged that the frost resistance of the plants has changed after overexpression of the CML43-V gene (see Appendix). Figure 8 A). The relative conductivity of the plant leaves before and after low temperature treatment was measured using a conductivity meter. The results showed that before low temperature treatment, there was no significant difference in the relative conductivity of the leaves of the control group and the experimental group; however, after low temperature treatment, the relative conductivity of the leaves of the CML43-V positive transgenic plants was significantly lower than that of the control group. This result further indicates that after overexpression of the CML43-V gene, the plant's frost resistance level is increased (see Appendix). Figure 8B). After the low-temperature treatment, the materials were thawed at 4°C for 20 hours and cultured at 22°C for 2 weeks. The freezing survival rate of the plants was counted and calculated. The statistical results showed that after the growth was restored, the freezing survival rate of the CK plants was 6%, the freezing survival rates of the CML43-V positive transgenic plants T1-1-2, T1-1-4, T1-9-1, T1-9-2, T1-9-6, and T1-9-7 were 6%, 100%, 94%, 93%, 100%, 90%, and 84%, respectively. The freezing survival rates of the negative transgenic plants T1-21-1, T1-21-2, and T1-21-3 were 0%, 0%, and 13%, respectively. The freezing survival rate of the CML43-V positive transgenic plants was significantly higher than that of the control group (see Appendix). Figure 8 C). In conclusion, overexpression of the CML43-V gene in the non-freeze-resistant wheat variety Fielder can improve the freezing tolerance of the wheat variety Fielder.

Claims

1. A Triticum villosa calmodulin gene CML43-V, from the durum wheat-Triticum villosa amphidiploid STH36-3, characterized in that Its nucleotide sequence is SEQ ID NO.

1.

2. The protein encoded by the gene CML43-V according to claim 1, whose amino acid sequence is SEQ ID NO.

2.

3. The recombinant expression vector pLGY-OE3:CML43-V of calmodulin-like gene CML43-V.

4. The recombinant overexpression vector according to claim 3, characterized in that The calmodulin-like gene CML43-V expression vector pLGY-OE3: CML43-V is obtained by using pLGY-OE3 as a starting vector and inserting the CML43-V gene of claim 1 between the StuⅠ and BamHI restriction sites of pLGY-OE3.

5. Use of the calmodulin-like gene CML43-V according to claim 1 in breeding frost-resistant wheat varieties.

6. Use of the overexpression vector pLGY-OE3:CML43-V of the calmodulin-like gene CML43-V according to claim 3 or 4 in breeding frost-resistant wheat varieties.