Application of long-chain non-coding RNA XLOC047761 or OsCDC5 gene in regulating and controlling taste of rice

Abstract

The invention discloses an application of a long-chain non-coding RNA (Ribonucleic Acid) XLOC047761 or OsCDC5 gene in regulating and controlling the mouth feel of rice. According to the invention, the influence of the XLOC047761 and the shearing factor OsCDC5 gene interacting with the XLOC047761 on the taste of rice is researched, and two rice mutants are obtained by knocking out the OsCDC5 or knocking down the XLOC047761. Results show that the phenotype that endosperm becomes white is observed in the two mutants, the amylopectin content is increased, the crude protein content is reduced, but the growth, development and fruiting of rice are not influenced. The result shows that the XLOC047761 or the OsCDC5 can regulate and control the amylose content of the rice. Therefore, the amylose content can be properly reduced by regulating the expression of XLOC047761 or OsCDC5, the taste of the rice is improved, and the growth, development and fruiting of the rice are not influenced. The invention provides a simple and effective method for optimizing the taste of rice and cultivating high-quality rice.

Description

Technical Field

[0001] The present invention belongs to the technical field of rice breeding, and more specifically relates to the application of long non-coding RNA XLOC_047761 or OsCDC5 gene in regulating rice taste. Background Art

[0002] Rice is one of the world's major staple crops, and its texture, firmness, and nutritional content have long been a topic of significant interest. The starch in rice is divided into two main types: amylose and amylopectin. The composition of these two components significantly influences the rice's flavor: rice with a higher amylose content is firmer, less elastic, and has a poorer texture; rice with a lower amylose content has a better texture. Therefore, studying the formation of rice starch and regulating the changes in the amylose and amylopectin content in rice is crucial for improving rice quality and cultivating rice varieties with superior taste.

[0003] A series of genes involved in rice starch synthesis have been reported, including ADPG pyrophosphorylase (AGPP), starch synthase (SS), and starch branching enzyme (SBE). The waxy gene Wx is crucial for amylose synthesis. It encodes granule-bound starch synthase (GBSS), which controls the synthesis of amylose in the rice endosperm. GBSS is a type of SS. Cereal GBSSs are divided into GBSSI and GBSSII. GBSSI controls the synthesis of amylose in storage tissues (such as the seed endosperm), while GBSSII is present in green tissues (including the seed coat). Wx encodes GBSSI. Downregulating GBSSI expression reduces amylose content, resulting in low-wax or waxy rice and improving cooking and eating quality.

[0004] Currently, the cultivation of glutinous rice is primarily based on the Wx gene. Many studies have used technologies such as CRISPR / Cas9 to perform targeted mutations on the Wx gene in wheat, corn, and rice to reduce Wx expression and cultivate low-amylose rice. However, this approach significantly reduces Wx expression. Wx plays an important role in multiple plant organs. For example, plant epidermal wax plays an important role in responding to environmental changes, protecting against ultraviolet radiation, and protecting against pests and diseases. Therefore, these techniques not only make rice sticky but also significantly negatively affect the plant's growth, development, and stress resistance. Therefore, there is a need to provide methods for improving the taste of rice without affecting its growth, development, and fruit set. Summary of the Invention

[0005] The present invention aims to overcome the aforementioned drawbacks and deficiencies in the prior art by providing the use of the long noncoding RNA XLOC_047761 or OsCDC5 gene for regulating rice texture. XLOC_047761 and OsCDC5 can regulate the amylose content of rice. By regulating the expression of XLOC_047761 or OsCDC5, the amylose content can be moderately reduced, improving rice texture without affecting rice growth, development, or grain set. This provides a simple and effective method for optimizing rice texture and cultivating high-quality rice.

[0006] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0007] The present invention studies the long noncoding RNA (lncRNA) XLOC_047761 (XLOC_047761 is located at Chr6:1763622-1766888[+] (MSU7.0) on the chromosome and is highly expressed during the developmental period after pollination) and the splicing factor OsCDC5 gene that interacts with it (the sequence of the OsCDC5 gene is disclosed as follows: Rice Genome Database (http: / / rice.plantbiology.msu.edu / index.shtmL), the gene number of OsCDC5 is: LOC_Os04g28090, and the nucleotide sequence is shown in SEQ ID No. 1). No.2) on the taste of rice. Specifically, the present invention obtained two rice mutants by knocking out OsCDC5 or knocking down XLOC_047761. The results showed that the endosperm whitening phenotype was observed in these two mutants, the amylopectin content increased, and the crude protein content decreased, but it did not affect the growth, development and fruiting of rice. This shows that XLOC_047761 or OsCDC5 can regulate the amylose content of rice. By regulating the expression of XLOC_047761 or OsCDC5, the amylopectin content of rice can be increased, the crude protein content can be reduced, and the taste of rice can be improved without affecting the growth, development and fruiting of rice. This provides a simple and effective method for optimizing the taste of rice and cultivating high-quality rice.

[0008] More specifically, the present invention constructed two mutant strains by knocking out OsCDC5 in rice using CRISPR-Cas9 technology or knocking down XLOC_047761 expression using RNAi. Detailed phenotypic analysis of these mutants revealed that the growth of the rice mutants with OsCDC5 knocked out using CRISPR-Cas9 technology and XLOC_047761 expression knocked down using RNAi technology was indistinguishable from the wild type, with grain shape and 1000-grain weight similar to those of the wild type. This indicates that there was no effect on plant type, panicle shape, grain shape, or 1000-grain weight, and that it did not affect plant growth, development, or fruiting. Further observation of the grains after shelling revealed that whitening of the endosperm was observed in the rice mutants with OsCDC5 knocked out using CRISPR-Cas9 technology and XLOC_047761 expression knocked down using RNAi technology, suggesting that the starch content ratio in the rice grains may have changed. Through electron microscopic observation of grain sections and determination of starch content, the present invention found that RNAi knockdown of XLOC_047761 increased amylopectin content and decreased crude protein content in mutants. Electron microscopic observation of sections revealed that while wild-type starch granules are regular polyhedral structures, those in mutants are spherical or ellipsoidal, suggesting a change in the shape of seed starch granules from regular polygons to irregular shapes. This suggests that reducing XLOC_047761 or OsCDC5 expression does not affect rice growth and seed set, but does induce mutants to exhibit a phenotype characterized by reduced amylose content, increased amylopectin content, reduced crude protein content, partial whitening of the endosperm, spherical or ellipsoidal starch granules, and waxy seeds. XLOC_047761 or OsCDC5 affects the starch composition and waxiness of rice.

[0009] Therefore, the present invention provides the use of long non-coding RNA XLOC_047761 or OsCDC5 gene in regulating the taste of rice. The nucleotide sequence of the XLOC_047761 is shown in SEQ ID No. 1, and the nucleotide sequence of the OsCDC5 gene is shown in SEQ ID No. 2.

[0010] Furthermore, the control of rice taste is achieved by controlling the ratio of amylose content to amylopectin content in the rice.

[0011] Furthermore, the application is to increase the expression of the long-chain non-coding RNA XLOC_047761 or OsCDC5 gene in rice, increase the proportion of amylose content in rice, increase the hardness of rice, and reduce the viscosity of rice; or knock down / knock out the long-chain non-coding RNA XLOC_047761 or OsCDC5 gene in rice, reduce the proportion of amylose content in rice, reduce the hardness of rice, increase the viscosity of rice, increase the elasticity, and improve the taste.

[0012] Preferably, the increasing the expression of the long non-coding RNA XLOC_047761 or OsCDC5 gene in rice is to construct a constitutive expression vector and transform it into rice; the knocking down / knockout of the long non-coding RNA XLOC_047761 or OsCDC5 gene in rice is to use CRISPR-Cas9 technology or RNAi technology.

[0013] The present invention also provides the use of long non-coding RNA XLOC_047761, OsCDC5 gene or biological materials with knockdown / knockout of long non-coding RNA XLOC_047761 and OsCDC5 gene in cultivating any of the following transgenic rice: (1) transgenic rice with a low amylose content ratio; (2) transgenic rice with low hardness; (3) transgenic rice with high viscosity; the nucleotide sequence of the XLOC_047761 is shown as SEQ ID No. 1, and the nucleotide sequence of the OsCDC5 gene is shown as SEQ ID No. 2.

[0014] Furthermore, the application is to construct transgenic rice with low amylose content ratio, low hardness or high viscosity by knocking down / knocking out long non-coding RNA XLOC_047761 or OsCDC5 gene in rice.

[0015] Furthermore, the biological material includes a recombinant vector having the function of knocking down / knocking out the long non-coding RNA XLOC_047761 or OsCDC5 gene, or a recombinant microorganism having the function of knocking down / knocking out the long non-coding RNA XLOC_047761 or OsCDC5 gene.

[0016] Preferably, the application is to construct transgenic rice with low amylose content ratio, low hardness or high viscosity by knocking down long non-coding RNA XLOC_047761 in rice or knocking out OsCDC5 gene in rice.

[0017] Further preferably, the knockdown of long non-coding RNA XLOC_047761 in rice is achieved by using RNAi technology, and the knockout of OsCDC5 gene in rice is achieved by using CRISPR-Cas9 technology.

[0018] As an optional specific embodiment, the method of inhibiting the expression of XLOC_047761 by RNAi to construct a mutant strain comprises the following steps:

[0019] S1. Construction of XLOC_047761 interference expression plasmid;

[0020] S2.XLOC_047761 interference expression plasmid was used to transform rice callus;

[0021] S3. Screening and differentiation of positive callus of transgenic rice.

[0022] The method for constructing the XLOC_047761 interference expression plasmid in step S1 is as follows:

[0023] S11. Using rice total RNA as a template, a portion of the LAC gene was cloned using primers shown in SEQ ID No. 3 and SEQ ID No. 4, and restriction sites for HimdIII and BamhI were added to both ends of the amplified product;

[0024] S12. The amplified product and the RNA interference vector were double-digested with HimdIII and BamhI, respectively, and then the two double-digested products were ligated with T4 ligase to construct an intermediate plasmid;

[0025] S13. The cloned fragment was amplified again from the intermediate plasmid described in step S12 using the primers shown in SEQ ID No. 5 and SEQ ID No. 6 (with MLu I and Pst I restriction sites added at both ends). After double digestion with Pst I and MLu I, it was cloned into the intermediate plasmid described in step S12 digested with the same enzymes to obtain the OsLAC13 RNA interference expression plasmid.

[0026] The RNA interference vector in step S12 is a modified RNA interference vector from pCAMBIA1305.2, pUC18-Pubi, and pZEro-T, which was donated by Professor Liu Yaoguang of South China Agricultural University.

[0027] As another alternative embodiment, a method for knocking out the OsCDC5 gene in rice using CRISPR-Cas9 technology to construct a rice mutant comprises the following steps:

[0028] S1. Construction of OsCDC5 knockout plasmid;

[0029] S2.OsCDC5 knockout plasmid transformed into rice callus;

[0030] S3. Screening and differentiation of positive callus of transgenic rice.

[0031] The method for constructing the OsCDC5 knockout plasmid in step S1 is as follows:

[0032] Two target sites were designed in OsCDC5 using the online CRISPR-P software (http: / / cbi.hzau.edu.cn / crispr / ). A single guide RNA (sgRNA) expression cassette targeting one target site was constructed using primers 5'-GGACTAGTGCCACGCTGCACCGAC-3' (SEQ ID No. 7) and 5'-AAACGAGGGCCCCCGATGCTTCTC-3' (SEQ ID No. 8). This expression cassette was ligated into the pYLCRISPR / Cas9 vector based on the binary vector pCAMBIA-1300 and transformed into Escherichia coli to complete the construction of the OsCDC5 knockout plasmid.

[0033] The present invention has the following beneficial effects:

[0034] The present invention provides a new application of the long non-coding RNA XLOC_047761 or OsCDC5 gene in regulating the taste of rice. The present invention studied the effects of XLOC_047761 and its interacting splicing factor OsCDC5 gene on rice taste, and obtained two rice mutants by knocking out OsCDC5 or knocking down XLOC_047761. The results showed that the endosperm whitening phenotype was observed in these two mutants, with increased amylopectin content and decreased crude protein content, but without affecting rice growth, development, and grain setting. This indicates that XLOC_047761 or OsCDC5 can regulate the amylose content of rice and affect the taste quality of rice. Therefore, by regulating the expression of XLOC_047761 or OsCDC5, the amylose content can be moderately reduced, improving the taste of rice without affecting rice growth, development, and grain setting. This provides a simple and effective method for optimizing rice taste and cultivating high-quality rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 qRT-PCR was used to detect the expression level of XLOC_047761 in RNAi-knockdown XLOC_047761 mutant strain.

[0036] Figure 2 qRT-PCR was used to detect the expression level of OsCDC5 in the OsCDC5 knockout mutant using CRISPR-Cas9 technology.

[0037] Figure 3 Comparison of grain shape and 1000-grain weight between the wild type and mutant strains.

[0038] Figure 4 Comparison of grain cross sections between the wild type and mutant strains.

[0039] Figure 5 Comparison of electron microscopic sections of grains of the wild type and mutant strains.

[0040] Figure 6 Determination of the amylose, amylopectin and crude protein contents of the wild type and RNAi knockdown XLOC_047761 mutant.

[0041] Figure 7 Schematic diagram of the RNA pulldown principle and the WB results of the interaction between long noncoding RNA XLOC_047761 and OsCDC5. DETAILED DESCRIPTION

[0042] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0043] Unless otherwise specified, all reagents and materials used in the present invention are commercially available.

[0044] Example 1 Extraction of total RNA from rice

[0045] This example uses the phenol-chloroform-isoamyl alcohol method to extract rice total RNA. All reagents used are commercially available. The specific steps are as follows:

[0046] (1) 1 g of rice sample was ground into fine powder using liquid nitrogen. 10 mL of RNA zol (100 mL containing 47.2 g of guanidine thiocyanate, 2.5 mL of 1 M sodium citrate (pH 7.0), and 5 mL of 10% sodium lauroyl nitrate) and 1 mL of sodium acetate (2 M, pH 4.0) were added and the powder was further ground.

[0047] (2) Add 10 mL of water-saturated phenol and 4 mL of a mixture of chloroform and isoamyl alcohol (49:1, volume ratio), mix well, transfer to a centrifuge tube, vortex for 1 min, place on ice for 5 min, and then centrifuge at 12,000 rpm for 15 min at 4°C;

[0048] (3) After centrifugation, the supernatant was collected and an equal volume of a mixture of phenol:chloroform:isoamyl alcohol (50:49:1, volume ratio) was added to the supernatant. The mixture was vortexed for 1 min, placed on ice for 5 min, and then centrifuged at 4°C, 12,000 rpm for 15 min.

[0049] (4) After centrifugation, take the supernatant and repeat step (3) 2 to 3 times;

[0050] (5) After centrifugation, remove the supernatant and add isopropanol to the supernatant (the volume ratio of isopropanol to supernatant is 0.6:1). Place on ice for 30 minutes to 1 hour.

[0051] (6) Centrifuge at 12,000 rpm for 15 min at 4°C, discard the supernatant, add 1.2 mL of DEPC-treated water to the tube to dissolve the precipitate at the bottom of the tube, and then transfer 600 μL of each tube into 1.5 mL centrifuge tubes;

[0052] (7) Add 600 μL of a mixture of phenol:chloroform:isoamyl alcohol (50:49:1, volume ratio) to the above 1.5 L centrifuge tube, mix thoroughly by inversion, place on ice for 5 minutes, and centrifuge at 12,000 rpm for 15 minutes at room temperature;

[0053] (8) After centrifugation, take the supernatant and repeat step (7) 2 to 3 times;

[0054] (9) After centrifugation, the supernatant was collected and aliquoted into new centrifuge tubes (300 μL per tube). 1 / 10 of the supernatant volume of 3 M NaAc (pH 5.2) and 3 times the supernatant volume of anhydrous ethanol were added to the aliquoted centrifuge tubes, mixed well, and placed at -20°C overnight.

[0055] (10) Centrifuge at 12,000 rpm for 15 min at 4°C, discard the supernatant, wash twice with 70% ethanol and once with 95% ethanol, air-dry, and dissolve in 15–30 μL of DEPC-treated water to obtain rice total RNA. Store at −20°C until use.

[0056] Example 2 Construction of Rice Mutant Strain with OsCDC5 Knockout and RNA Interference XLOC_047761

[0057] In this example, the RNA of Example 1 was used as a template to further amplify and construct a rice mutant strain with OsCDC5 knockout and RNA interference XLOC_047761.

[0058] 1. Construction of XLOC_047761 interference expression plasmid

[0059] In this example, an RNA interference vector modified from pCAMBIA1305.2, pUC18-Pubi, and pZEro-T was selected. This vector was donated by Professor Liu Yaoguang of South China Agricultural University.

[0060] A portion of the XLOC_047761 sequence was cloned using total RNA from the treated sample prepared in Example 1 as a template. The nucleotide sequence of the upstream primer is shown in SEQ ID No. 3, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 4. Himd III and Bamh I restriction sites were added to both ends of the amplified product. PCR amplification reaction conditions were based on the instructions for the PCR amplification kit.

[0061] Upstream primer (SEQ ID No. 3): 5-CGGGATCCAGGGGGACATCGCCATGGT-3′;

[0062] Downstream primer (SEQ ID No. 4): 5′-CGAGCTCGTCAAGAGATGTTGCATTAACAGATAGCATTGTCAAATACAT-3′.

[0063] After the PCR, the amplified product was recovered and double-digested with Himd III and Bamh I. Simultaneously, the RNA interference vector was also double-digested with Himd III and Bamh I. The two double-digested products were then ligated with T4 ligase to construct an intermediate plasmid.

[0064] The cloned fragment was amplified again from the intermediate plasmid using RNAi vector-specific primers with MLuⅠ and PstⅠ restriction sites at both ends (SEQ ID No.5: 5'-CCCAAGCTTGTCAAGAGATGTTGCATTAACAGATAGCATTGTCAAATAC A-3'; SEQ ID No.6: 5'-ATAAGAATGCGGCCGCAGGGGGACATCGCCATGGTC-3'). After double digestion with PstⅠ and MLuⅠ, it was cloned into the intermediate recombinant plasmid digested with the same enzymes, completing the construction of the XLOC_047761 interference plasmid.

[0065] The amplification product recovery, double enzyme digestion reaction, T4 ligation and other reactions involved in the above-mentioned process were all performed using conventional procedures in the art, and the vectors, reagents and the like involved in the experiment were all commercially available.

[0066] 2. Construction of OsCDC5 knockout plasmid

[0067] A target site was designed on OsCDC5 using the online software CRISPR-P (http: / / cbi.hzau.edu.cn / crispr / ). A sgRNA expression cassette for the target site was constructed using primers 5'-GGACTAGTGCCACGCTGCACCGAC-3' (SEQ ID No. 7) and 5'-AAACGAGGGCCCCCGATGCTTCTC-3' (SEQ ID No. 8).

[0068] The expression cassette was ligated into the pYLCRISPR / Cas9 vector with the binary vector pCAMBIA-1300 as the backbone and transformed into Escherichia coli to complete the construction of the OsCDC5 knockout plasmid.

[0069] The experiments mentioned above all adopted routine operations in this field, and the carriers, reagents, etc. involved in the experiments were all commercially available.

[0070] 3. OsCDC5 knockout and RNA interference XLOC_047761 plasmid transformation into rice callus

[0071] The two expression plasmids constructed above were transformed into Agrobacterium tumefaciens (commercially available). The transformation method was conventional in the art. The Agrobacterium tumefaciens strain transformed with the relevant plasmids was then streaked on YEP medium (10 g yeast extract, 10 g peptone, 5 g NaCl, 15 g agar) containing rifampicin, kanamycin and hygromycin. After culturing in the dark at 28°C for 2 to 3 days, a single colony was picked and spread on YEP medium containing the same antibiotics. The cells were cultured in the dark at 28°C for 2 days, and an appropriate amount of cells was scraped and suspended in a liquid co-culture medium containing 100 μM acetosyringone to dilute to an OD of 0. 550 The concentration of Agrobacterium tumefaciens was about 0.3, and the mixture was cultured at 28°C in a shaker (140 rpm) for 40 minutes to prepare the Agrobacterium tumefaciens infection solution, which can be used for infection.

[0072] Mature rice seeds were peeled of their husks, soaked in 75% alcohol for 1 minute, and then washed several times with sterile water. The seeds were then treated with 1% sodium hypochlorite twice for 20 minutes each time, shaken several times during the treatment. The seeds were washed several times with sterile water, and then dried with sterile filter paper. The seeds were then inoculated onto an induction medium (N6 macro, B5 micro, B5 organic, iron salts, 2 mg / L 2,4-D, 30 g / L sucrose, 500 mg / L glutamine, 500 mg / L proline, 300 mg / L hydrolyzed casein, and 3.0 g / L phytogel). The induced embryonic callus was inoculated onto a fresh induction medium for continued culture. Every 2 to 3 weeks, callus with good growth status was selected and inoculated onto a fresh induction medium for subculture.

[0073] Select pale yellow, granular, densely structured, and well-grown callus tissue and place it in a sterile Erlenmeyer flask. After drying, add the prepared Agrobacterium tumefaciens infection solution and infect for 20 minutes, shaking the culture several times. After infection, place the callus in a Petri dish lined with sterile filter paper and air-dry for 1-2 hours. Then, plate the callus onto a co-culture medium covered with a layer of filter paper. After air-drying for about half an hour, incubate the callus in the dark at 26°C for 2-3 days.

[0074] 4. Screening and differentiation of transgenic rice positive callus

[0075] Remove the co-cultivated callus and place it in a sterile Petri dish lined with three layers of filter paper. Let it dry for about a day, then transfer it to screening medium and incubate it in the dark at 26°C for 14-21 days. This is screened twice. Select resistant calli that are growing well and transfer them to pre-differentiation medium and incubate them in the light at 26°C. After 21 days, transfer resistant calli that are growing well and showing green spots to differentiation medium to allow for callus regeneration.

[0076] When seedlings differentiated from the resistant callus reached 4 to 6 cm in length, they were transferred to rooting medium and continued to be cultured at 26°C in the light. Once the seedlings reached 10 to 12 cm in length, with broad, dark green leaves and healthy root systems, the medium and callus attached to their bases were washed off, and the seedlings were potted outdoors to obtain transgenic rice (overexpressing miR397).

[0077] The formula of the above-mentioned screening medium is: N6 medium in large amount + MS medium in trace amount + B5 medium in small amount + 1g / L hydrolyzed casein + 1g / L proline + 2mg / L (2,4-D) + 30g / L sucrose + hygromycin 50mg / L + cephalosporin 500mg / L + 4g / L plant gel, and the final pH of the screening medium is 5.8.

[0078] The formula of the above-mentioned predifferentiation medium is: MS medium + 1g / L hydrolyzed casein + 20g / L sucrose + 1mg / L (2,4-D) + 500mg / L cephalexin + 50mg / L hygromycin + 4g / L phytogel, and the final pH of the predifferentiation medium is 5.8.

[0079] The formula of the differentiation medium is: MS medium + 2 mg / L (6-BA) + 0.5 mg / L naphthaleneacetic acid + 1 mg / L kinetin + 30 g / L sucrose + 3% sorbitol + 4 g / L phytogel, and the final pH of the differentiation medium is 5.8.

[0080] The formula of the above-mentioned rooting medium is 1 / 2MS medium.

[0081] The formulations of MS medium, 1 / 2MS medium, and N6 medium used in this example all adopt conventional formulations in the art. The reagents involved in the above-mentioned medium formulations are all commercially available.

[0082] Example 3 Detection of OsCDC5 Expression and XLOC_047761 Expression in Mutant Rice Planting and Phenotypic Analysis, and Starch Content Analysis of Mutant Rice

[0083] 1. Experimental methods

[0084] (1) Using the two rice mutants constructed in Example 2, the total RNA of each mutant was obtained using the method of Example 1.TM II (TaKaRa) reverse transcriptase was used for reverse transcription, and the amount of total RNA used was 500 ng.

[0085] Roche's real-time quantitative PCR instrument was used to detect the expression levels of OsCDC5 and XLOC_047761. The control sample was a wild-type plant, and the internal reference gene was Actin2.

[0086] Amplification primers are as follows:

[0087] Actin2-F: 5'-GTGCTTCCCTCTATGCT-3' (SEQ ID No. 9),

[0088] Actin2-R: 5'-CTCGGCAGAGGTGGTGAA-3' (SEQ ID No. 10);

[0089] OsCDC5-F: 5'-AGGGGTGATGCTATTATGATGGAGGC-3' (SEQ ID No. 11), OsCDC5-R: 5'-TTGCCAAAGGTGTGCCATTG-3' (SEQ ID No. 12);

[0090] XLOC_047761-F: 5'-GAGGCCGCCTGTCCAA-3' (SEQ ID No. 13),

[0091] XLOC_047761-R: 5'-GATGTCCCCCTCCTCCTCC-3' (SEQ ID No. 14).

[0092] (2) All knockout and RNAi mutant phenotypic analyses were performed using T3 rice plants. Rice seeds were germinated with water, planted on flat trays for one week, and then transplanted to the field to mature grains. Seed size and 1000-grain weight were compared using fully mature, dried seeds; grain number per panicle was calculated using fully mature, dried, intact panicles; and seed set rate was calculated using mature, intact panicles. All statistical data are averages of more than 30 rice seedlings.

[0093] 2. Results

[0094] Figure 1 qRT-PCR analysis of XLOC_047761 expression in RNAi-knockdown mutants. Figure 1 on the far left is the wild-type control, and Figures 2 through 4 represent different transgenic lines of T3-generation mutants. The results showed a significant decrease in XLOC_047761 expression in the mutants.

[0095] Figure 2The expression levels of OsCDC5 knockout mutants using CRISPR-Cas9 technology are shown. The leftmost row shows the wild-type control, while rows 2 through 4 represent different transgenic series of T3-generation mutants. The results show that OsCDC5 expression levels are significantly reduced in the mutants.

[0096] Figures 1 and 2 The results showed that the present invention successfully constructed the XLOC_047761 mutant and the OsCDC5 mutant.

[0097] Figure 3 The results show that there is no significant difference between the wild type and two rice mutant strains in terms of grain length, grain width, grain thickness and thousand-grain weight. Figure 4 The phenotypes of wild-type and two rice mutants were observed under a stereomicroscope after cross-section. The results showed that the XLOC_047761 mutant knocked down by RNAi and the OsCDC5 mutant knocked out by CRISPR-Cas9 technology showed obvious endosperm whitening.

[0098] Figure 5 The phenotypes of wild-type and two rice mutants observed under an electron microscope after cross-sectioning. The results show that the amyloplasts are regular polyhedral structures, while the amyloplasts of the XLOC_047761 mutant knocked down by RNAi and the OsCDC5 mutant knocked out by CRISPR-Cas9 technology are spherical or ellipsoidal.

[0099] Figure 6 The amylose, amylopectin and crude protein contents of the wild type and RNAi knockdown XLOC_047761 mutant were determined; the results showed that the amylose content of the XLOC_047761 mutant was lower than that of the wild type, the amylopectin content was higher than that of the wild type, and the crude protein content was lower than that of the wild type.

[0100] Figures 3 to 6 Results showed that reduced expression of XLOC_047761 or OsCDC5 did not affect rice growth, development, or grain set, but did result in mutants exhibiting reduced amylose content, increased amylopectin content, decreased crude protein content, partial whitening of the endosperm, spherical or ellipsoidal starch granules, and waxy seeds. XLOC_047761 or OsCDC5 affected the starch composition and waxiness of rice.

[0101] Example 4 In vitro RNA pulldown + mass spectrometry

[0102] (1) tRSA-WELL and tRSA RNA were transcribed in vitro according to the instructions of the in vitro transcription kit (Thermo Fisher Scientific, K0441).

[0103] (2) Purify the two RNAs using an RNA purification kit (Thermo Fisher Scientific, K0731).

[0104] (3) Take a tube of 50 pmol of RNA and place it in a PCR instrument. Denature it at 85°C for 5 minutes, then lower the temperature by 1°C every 30 seconds to 4°C to complete RNA folding.

[0105] (4) The ear samples of the OsCDC5-overexpressing plants were ground into powder in a liquid nitrogen pre-cooled mortar, lysed with protease lysis buffer, rotated in a 4°C refrigerator rotator for 30 min, and centrifuged at 13,000 rpm at 4°C for 15 min. The supernatant was collected and used as a protein sample.

[0106] (5) RNA pulldown experiments were performed according to the instructions of the RNA pulldown kit (20164) from Thermo Fisher Scientific.

[0107] (6) The proteins obtained by RNA pulldown were separated by Western blot gel, coated with corresponding antibodies and developed in a darkroom.

[0108] The results are as follows Figure 7 As shown, there is an interaction between XLOC_047761 and OsCDC5 genes, indicating that they regulate starch synthesis through similar mechanisms in rice.

Claims

1. Application of long non-coding RNA XLOC_047761 or OsCDC5 gene in regulating rice taste, characterized in that: The nucleotide sequence of the XLOC_047761 is shown in SEQ ID No. 1, and the nucleotide sequence of the OsCDC5 gene is shown in SEQ ID No.

2.

2. The application according to claim 1, characterized in that The control of rice taste is achieved by controlling the ratio of the amylose content to the amylopectin content in the rice.

3. The application according to claim 2, characterized in that: The application is to increase the expression of the long-chain non-coding RNA XLOC_047761 or OsCDC5 gene in rice, increase the amylose content ratio in rice, increase the rice hardness, and reduce the rice viscosity; or knock down / knock out the long-chain non-coding RNA XLOC_047761 or OsCDC5 gene in rice, reduce the amylose content ratio in rice, reduce the rice hardness, and increase the rice viscosity.

4. The application according to claim 3, characterized in that The method of increasing the expression of the long non-coding RNA XLOC_047761 or the OsCDC5 gene in rice comprises constructing a constitutive expression vector and transforming the vector into rice.

5. The application according to claim 3, characterized in that: The knockdown / knockout of the long non-coding RNA XLOC_047761 or OsCDC5 gene in rice is carried out by using CRISPR-Cas9 technology or RNAi technology.

6. Use of long non-coding RNA XLOC_047761, OsCDC5 gene, or biological materials with knockdown / knockout of long non-coding RNA XLOC_047761 and OsCDC5 gene in cultivating any of the following transgenic rice: (1) transgenic rice with a low amylose content ratio; (2) transgenic rice with low hardness; (3) transgenic rice with high viscosity; the nucleotide sequence of the XLOC_047761 is shown in SEQ ID No. 1, and the nucleotide sequence of the OsCDC5 gene is shown in SEQ ID No.

2.

7. The application according to claim 6, characterized in that The application is to construct transgenic rice with low amylose content ratio, low hardness or high viscosity by knocking down / knocking out long chain non-coding RNA XLOC_047761 or OsCDC5 gene in rice.

8. The application according to claim 6, characterized in that: The biological material includes a recombinant vector capable of knocking down / knocking out the long-chain non-coding RNA XLOC_047761 or OsCDC5 gene, or a recombinant microorganism capable of knocking down / knocking out the long-chain non-coding RNA XLOC_047761 or OsCDC5 gene.

9. The application according to claim 7, characterized in that: The application is to construct transgenic rice with low amylose content ratio, low hardness or high viscosity by knocking down long chain non-coding RNA XLOC_047761 in rice or knocking out OsCDC5 gene in rice.

10. The use according to claim 9, characterized in that: The knockdown of long non-coding RNA XLOC_047761 in rice is carried out by using RNAi technology, and the knockout of OsCDC5 gene in rice is carried out by using CRISPR-Cas9 technology.

Images