AAV gene therapy for treating nephrotic syndrome

Abstract

The present invention provides an adeno-associated virus (AAV) vector gene therapy for use in the treatment of nephrotic syndrome in a single gene form wherein the AAV vector comprises an NS-related transgene and a minimum nephrin promoter NPHS1 or a podocin promoter NPHS2.

Description

[0001] This application is a divisional application of the Chinese invention patent application with the application date of January 17, 2020, application number 202080016138.4, and invention name “AAV gene therapy for the treatment of nephrotic syndrome”. Field of the Invention

[0002] The present invention relates to gene therapy for the treatment of monogenic forms of nephrotic syndrome. Background of the Invention

[0003] Nephrotic syndrome (NS) is a chronic kidney disease characterized by marked proteinuria, hypoalbuminemia, edema, and hyperlipidemia. It is the most common primary glomerular disease in children, affecting 2 in 100,000 children under the age of 16 in Europe and the United States. NS is associated with varying ages of onset, ranging from diagnosis before 3 months of age to early adulthood, and is divided into distinct patient groups based on their sensitivity to corticosteroids: approximately 80% of children with NS are classified as having steroid-sensitive nephrotic syndrome (SSNS) and can be successfully treated with corticosteroid therapy. A subset of patients originally classified as SSNS relapses and requires further steroid therapy, while an additional 10-15% of patients with NS do not achieve remission after several weeks of corticosteroid treatment and are classified as steroid-resistant nephrotic syndrome (SRNS). Up to 50% of these SRNS patients progress to end-stage renal disease within 10 years and are generally at increased risk of relapse after kidney transplantation, highlighting the lack of appropriate and effective treatments for these patients.

[0004] Podocyte dysfunction and the resulting disruption of the glomerular filtration barrier are central to the pathogenesis of nephrotic syndrome (NS). Podocytes branch out cellular processes, called foot processes, to cover the exterior of the glomerular capillaries, and their interdigitating union with adjacent foot processes forms the glomerular slit membrane, which is crucial for the efficiency of the glomerular filtration barrier and the retention of proteins in the bloodstream. In hereditary forms of NS, mutations in genes encoding key podocyte processes, such as podocyte development, migration, basement membrane interaction, or regeneration, lead to loss of glomerular slit membrane integrity and a nephrotic syndrome phenotype. Approximately 30% of pediatric SRNS cases are hereditary, with the most common mutation in childhood being in NPHS2, encoding podocin, accounting for 10-30% of sporadic cases.

[0005] Podocin is a 42 kDa hairpin-like, membrane-associated, podocyte-specific protein that is a key component of the protein complex at the slit membrane; the intercellular connection between adjacent podocyte foot processes. It is localized to lipid rafts and interacts with other important slit membrane proteins, such as nephrin, CD2AP, and TRPC6. It is crucial for maintaining the integrity of the slit membrane and, therefore, the glomerular filtration barrier. To date, 126 mutations have been reported, but the most common mutation is R138Q, which results in mislocalization of podocin to the endoplasmic reticulum.

[0006] Because effective treatments currently do not exist for patients with monogenic forms of NS, the use of gene therapy to transfer a functional gene copy into diseased podocytes may constitute a promising new strategy to address monogenic forms of NS, reverse the NS phenotype, and correct renal dysfunction. Indeed, US2003 / 0152954 generally proposes the use of viral vectors to deliver nucleic acids encoding polypeptides with podocin activity but fails to disclose or test any specific gene therapy constructs. This may be because the kidney has a complex anatomy, with specialized compartments consisting of glomeruli, tubules, vasculature, and interstitial spaces, making it a difficult target for gene therapy vectors. To date, kidney-targeted gene therapy has been largely unsuccessful because the highly differentiated substructures of the kidney are difficult to target and specifically transduce using viral vectors (van der Wouden et al., 2004).

[0007] A recent study attempted to target the kidney using an rAAV vector combined with a CMV promoter and either a GFP or luciferase gene (administered via tail vein or renal vein injection) (Rocca et al 2014). However, tail vein injection proved unsuitable for renal transduction, and although low-level gene expression was observed in podocytes, widespread expression was observed in the liver, even with a purported kidney-specific promoter. The study also failed to demonstrate successful transduction of nephrotic syndrome-associated transgenes, such as podocin, or long-term functional expression of such genes. The study also did not explore AAV serotypes suitable for transduction of human renal cells.

[0008] The goal of the present invention is to reverse the NS phenotype and correct podocyte-associated renal dysfunction in patients with monogenic forms of NS by administering AAV gene therapy expressing a NS-associated transgene under the control of a podocyte-specific promoter. SUMMARY OF THE INVENTION

[0009] The present invention provides an adeno-associated virus (AAV) vector gene therapy for treating monogenic forms of nephrotic syndrome, wherein the AAV vector contains: a nephrotic syndrome-associated transgene; and a minimal nephrin promoter, NPHS1, or a podocin promoter, NPHS2. This gene therapy vector can reverse the nephrotic syndrome phenotype and correct podocyte-related renal dysfunction in patients with monogenic forms of nephrotic syndrome.

[0010] Suitable AAV serotypes for use in this vector include 2 / 9, LK03, and 3B.

[0011] AAV 2 / 9 serotypes have demonstrated a clear tropism for the kidneys of neonatal and adult mice, localizing to the glomeruli and renal tubules (Luo et al., 2011; Picconi et al., 2014; Schievenbusch et al., 2010), and AAV2 / 9 vectors have been shown to be suitable for kidney-targeted gene delivery when combined with renal vein injection (Rocca et al., 2014). Therefore, AAV2 / 9 is a suitable vector for the gene therapy methods of the present invention.

[0012] Synthetic AAV capsids such as LK03 may also be suitable vectors for the gene therapy methods of the present invention. This vector has been shown to transduce human primary hepatocytes with high efficiency in vitro and in vivo. However, to date, it has not been used for kidney-targeted gene delivery. The present inventors demonstrate herein that the AAV-LK03 vector can achieve high transduction rates of nearly 100% in human podocytes in vitro and can be used to specifically transduce podocytes in vitro.

[0013] The AAV-LK03 cap sequence is composed of segments from seven different wild-type serotypes (AAV1, 2, 3B, 4, 6, 8, and 9), although AAV-3B represents 97.7% of the cap gene sequence and 98.9% of the amino acid sequence. AAV-3B is also known for its tropism for human hepatocytes, making it another suitable vector for the gene therapy approach described in this invention. To date, it has not been used for kidney-targeted gene delivery.

[0014] The NS-associated transgene used in gene therapy is a gene associated with a monogenic form of NS and expressed in podocytes, encoding a protein of approximately 833 amino acids or less. This size restriction makes the NS-associated transgene suitable for the gene therapy vector of the present invention.

[0015] Suitable NS-associated transgenes include NPHS2; ADCK4; ALG1; ARHGAP24; ARGHDIA; CD151; CD2AP; COQ2; COQ6; DGKE; E2F3; EMP2; KANK2; LAGE3; LMNA; LMX1B; MAFB; NUP85; NUP93; NXF5; OSGEP; PAX2; PDSS2; PMM2; PODXL; SCARB2; SGPL1; Smad7; TP53RK; TPRKB; VDR; WDR73; WT1; ZMPSTE24; or APOL1.

[0016] In an embodiment of the present invention, the NS-associated transgene can be a SRNS-associated transgene, such as ADCK4; CD2AP; DGKE; EMP2; NPHS2; NUP86; NUP93; SGPL1; WDR73; or WT1.

[0017] In a preferred embodiment of the invention, the NS-associated transgene is NPHS2, which encodes podocin. An example of a suitable human NPHS2 transgenic cDNA sequence is shown in Figure 6 middle.

[0018] The species of the transgene preferably matches the species of the patient. For example, when treating human patients, a human transgene is typically used. The transgene can be naturally occurring, such as wild-type, or it can be recombinant. The transgene is typically contained in a gene therapy vector as a cDNA sequence.

[0019] The use of a minimal nephrin promoter such as NPHS1 or the podocin promoter NPHS2 allows gene therapy vectors to be specifically targeted to podocytes (Moeller et al., 2002; Picconi et al., 2014). This enables transgene expression to be specifically targeted to podocytes in the glomerular basement membrane of the kidney and minimizes off-target expression. Since podocytes are terminally differentiated and non-dividing cells, they can be targeted to stably express the transgene and reduce or avoid any risk of vector dilution effects. In a preferred embodiment of the present invention, the promoter is NPHS1. An example of a suitable DNA sequence for the NPHS1 promoter is shown in Figure 5 As with transgenes, the promoter species preferably matches the patient species. For example, human NHPS1 or human NPHS2 is typically used when treating human patients.

[0020] AAV vectors may additionally contain a woodchuck hepatitis posttranscriptional regulatory element (WPRE). WPRE is a DNA sequence that, when transcribed, creates a tertiary structure that enhances expression. Inclusion of a WPRE can increase expression of a transgene delivered by the vector. The WPRE sequence can be mutated to reduce oncogenicity without significantly losing RNA enhancing activity (Schambach et al., 2005, incorporated herein by reference). An example of a suitable WPRE sequence is shown in Figure 7 middle.

[0021] NS-associated transgenes can include a hemagglutinin (HA) tag. HA can be used as an epitope tag and has been shown not to interfere with the biological activity or biodistribution of the added protein. The HA tag can facilitate detection, isolation, and purification of the transgene.

[0022] The AAV vector may further comprise a Kozak sequence between the promoter and the podocin transgene. The Kozak sequence is known to play an important role in the initiation of translation and thus may enhance the expression of the podocin transgene.

[0023] The AAV vector may additionally contain a polyadenylation signal, such as the bovine growth hormone (bGH) polyadenylation signal, e.g., Figure 8 As shown in . Polyadenylation is the addition of a poly(A) tail to messenger RNA. The poly(A) tail is composed of multiple adenosine monophosphates; in other words, it is a stretch of RNA containing only adenine bases. The poly(A) tail is important for nuclear export, translation, and stability of mRNA. Therefore, inclusion of a polyadenylation signal can enhance expression of the podocin transgene.

[0024] AAV gene therapy vectors also typically include inverted terminal repeat (ITR) sequences at either end of the vector. For example, the vector structure can be in the following order: ITR-promoter-transgene (with optional HA tag)-optional WRPE-polyadenylation signal-ITR.

[0025] Thus, the gene therapy vectors of the present invention can be used to treat or manage monogenic forms of NS in patients. As used herein, the term "patient" can include any mammal, including humans. The patient can be an adult or a pediatric patient, such as a newborn or infant. In embodiments of the present invention, the patient can be a pediatric patient between about 1 year old and about 16 years old.

[0026] Patients have a monogenic form of NS. In other words, NS is caused by a mutation in a single gene. Preferably, the mutation is in a gene expressed in podocytes. For example, NS may be SRNS caused by a mutation in NPHS2 (which encodes podocin). Alternatively, a monogenic form of NS may be caused by one or more mutations in any of ADCK4; ALG1; ARHGAP24; ARGHDIA; CD151; CD2AP; COQ2; COQ6; DGKE; E2F3; EMP2; KANK2; LAGE3; LMNA; LMX1B; MAFB; NUP85; NUP93; NXF5; OSGEP; PAX2; PDSS2; PMM2; PODXL; SCARB2; SGPL1; Smad7; TP53RK; TPRKB; VDR; WDR73; WT1; ZMPSTE24; or APOL1. In embodiments of the invention, the monogenic form of NS may be a monogenic form of SRNS caused by one or more mutations in any one of ADCK4; CD2AP; DGKE; EMP2; NPHS2; NUP86; NUP93; SGPL1; WDR73; or WT1.

[0027] The gene mutation causing SRNS may be an NPHS2 mutation affecting podocin expression, such as one or more of those listed in Table A below.

[0028] Table A: Non-exhaustive list of podocin (NPHS2) mutations.

[0029]

[0030] In a preferred embodiment of the present invention, the gene mutation may be p.Arg138Gln, also known as R138Q. R138Q is the most common podocin mutation in children with SRNS in Caucasian populations. This mutation results in endoplasmic reticulum retention of podocin, preventing it from reaching the slit membrane and interacting with other important slit membrane proteins to form a functional filtration barrier.

[0031] Because NPHS2 mutations all affect the same gene, any combination of these mutations can be treated with the AAV gene therapy vectors of the present invention comprising the NPHS2 transgene. In other words, a patient can have the p.Arg138Gln mutation and can have one or more of the other mutations identified in Table A above.

[0032] The presence or absence of a single gene form of NS can be determined by laboratory testing, such as that offered by Bristol Genetics Laboratories in the U.K. Typically, genetic testing can be performed by analyzing a blood sample obtained from the patient.

[0033] AAV vector gene therapy can be administered systemically, such as by intravenous injection. In an embodiment of the present invention, AAV vector gene therapy can be administered by injection into the renal artery. In another embodiment of the present invention, AAV vector gene therapy can be administered by retrograde administration, such as via the ureter using a urinary catheter.

[0034] Gene therapy can be administered in a single dose, in other words, there may be no need for subsequent doses of vector. In cases where repeated doses are required, different AAV serotypes can be used in the vector. For example, the vector used in the first dose may contain AAV-LK03 or AAV-3B, while the vector used in subsequent doses may contain AAV 2 / 9.

[0035] Optionally, gene therapy can be administered in conjunction with temporary immunosuppression of the patient, for example by administering the gene therapy simultaneously with or after oral steroid therapy. Immunosuppression may be desirable before and / or during gene therapy treatment to suppress the patient's immune response to the vector. However, the AAV capsid is only transiently present in the transduced cells because it is not encoded by the vector. Therefore, the capsid is gradually degraded and cleared, which means that a short-term immunomodulatory regimen that blocks the immune response to the capsid until the capsid sequence is cleared from the transduced cells can allow long-term expression of the transgene. Therefore, immunosuppression may be desirable for a period of about six weeks after administration of gene therapy.

[0036] AAV vector gene therapy can be administered in the form of a pharmaceutical composition. In other words, AAV vector gene therapy can be combined with one or more pharmaceutically acceptable carriers or excipients. Suitable pharmaceutical compositions are preferably sterile.

[0037] The present disclosure also relates to the following embodiments:

[0038] Embodiment 1. Adeno-associated virus (AAV) vector gene therapy for treating monogenic forms of nephrotic syndrome, wherein the AAV vector comprises:

[0039] NS-associated transgenes; and

[0040] Minimal nephrin promoter NPHS1 or podocin promoter NPHS2.

[0041] Embodiment 2. The AAV vector gene therapy according to embodiment 1, wherein the AAV vector is AAV serotype 2 / 9, LK03 or 3B.

[0042] Embodiment 3. The AAV vector gene therapy for use according to embodiment 1 or 2, wherein the NS-associated transgene is NPHS2; ADCK4; ALG1; ARHGAP24; ARGHDIA; CD151; CD2AP; COQ2; COQ6; DGKE; E2F3; EMP2; KANK2; LAGE3; LMNA; LMX1B; MAFB; NUP85; NUP93; NXF5; OSGEP; PAX2; PDSS2; PMM2; PODXL; SCARB2; SGPL1; Smad7; TP53RK; TPRKB; VDR; WDR73; WT1; ZMPSTE24; or APOL1.

[0043] Embodiment 4. The AAV vector gene therapy for use according to any one of embodiments 1 to 3, wherein the AAV vector further comprises a woodchuck hepatitis posttranscriptional regulatory element (WPRE).

[0044] Embodiment 5. The AAV vector gene therapy for use according to any one of embodiments 1 to 4, wherein the NS-associated transgene is human and / or comprises a hemagglutinin (HA) tag.

[0045] Embodiment 6. The AAV vector gene therapy for use according to any one of embodiments 1 to 5, wherein the AAV vector further comprises a Kozak sequence between the promoter and the podocin transgene.

[0046] Embodiment 7. An AAV vector gene therapy for use according to any one of embodiments 1 to 6, wherein the AAV vector further comprises a polyadenylation signal, such as a bovine growth hormone (bGH) polyadenylation signal.

[0047] Embodiment 8. An AAV vector gene therapy for use according to any one of embodiments 1 to 7, wherein the AAV vector gene therapy is to be administered to a human patient.

[0048] Embodiment 9. The AAV vector gene therapy according to embodiment 8, wherein the patient is a pediatric patient.

[0049] Embodiment 10. The AAV vector gene therapy for use according to any one of embodiments 1 to 9, wherein the monogenic form of NS is a monogenic form of steroid-resistant nephrotic syndrome.

[0050] Embodiment 11. An AAV vector gene therapy for use according to any one of embodiments 1 to 10, wherein the AAV vector gene therapy is to be administered systemically.

[0051] Embodiment 12. An AAV vector gene therapy for use according to any one of embodiments 1 to 11, wherein the AAV vector gene therapy is to be administered by intravenous injection.

[0052] Embodiment 13. An AAV vector gene therapy for use according to any one of embodiments 1 to 12, wherein the AAV vector gene therapy is to be administered by injection into the renal artery. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] The present invention will now be described in detail, by way of example only, with reference to the accompanying drawings.

[0054] Figure 1 shows that AAV 2 / 9, administered via tail vein injection, transduced the kidney and expressed HA-tagged podocin in podocytes. A) AAV vectors used to express mouse or human podocin or GFP. All vectors contain a Kozak sequence between the promoter and the transgene, as well as WPRE (woodchuck hepatitis posttranscriptional regulatory element) and bovine growth hormone (bGH) polyadenylation signals. B) AAV vectors expressed in 8-week-old iPod NPHS2 mice. fl / fl Mice were injected with either vector or saline via the tail vein and induced with doxycycline starting 10-14 days later. C) qPCR shows the presence of AAV ITR in the renal cortex of mice injected with viral vector. D) Representative immunofluorescence shows NPHS2 in iPod injected with AAV 2 / 9. fl / fl Expression of HA-tagged podocin and podocyte-specific proteins nephrin and podocin in mice. The control (saline) image is a mouse model without complete iPodNPHS2 injection. fl / fl Images of mice with the same genotype, therefore, do not develop proteinuria or diseased glomeruli, as mice with diseased glomeruli show loss of podocyte markers.

[0055] Figure 2 shows that tail vein injection of AAV 2 / 9 expressing wild-type podocin under a podocyte-specific promoter improves the conditional podocin knockout mouse model (iPod NPHS2 fl / flA) Urinary albumin:creatinine ratio in mice injected with AAV 2 / 9 mNPHS1.mpod versus AAV 2 / 9 hNPHS1.mpod versus saline (n = 9 per group, **p < 0.01 ***p < 0.001). B) Representative Coomassie-stained images showing the extent of albuminuria in one mouse from each experimental group. The saline group developed proteinuria starting on day 14 and showed significant amounts of albumin, while the vehicle-treated group showed a later onset and less severe albuminuria. C) Survival curves showing improved survival in mice injected with AAV 2 / 9 hNPHS1.mpod or AAV 2 / 9 mNPHS1.mpod (Log-rank (Mantel-Cox) test p = 0.049, n = 3 in each virus group and n = 4 in the saline group). D) The number of viral DNA copies per 50 ng of total DNA was negatively correlated with the urine albumin:creatinine ratio at day 42 (Spearman r = -0.4596, p = 0.0477). E) Blood results, including cholesterol, albumin, urea, and creatinine, 6 weeks after doxycycline administration. (N = at least 3 mice per group, except for cholesterol, where n = at least 2 per group). F) Histology shows representative light microscopic images from each group. The saline-injected group showed glomerular hypertrophy, increased collagen deposition, and segmental sclerosis, accompanied by tubular dilation, consistent with FSGS. Those injected with AAV 2 / 9 expressing mouse podocin exhibited a range of histological findings that roughly correlated with the urine albumin:creatinine ratio at the time of death. Some mice had healthy, normal glomeruli, while others displayed mild signs of disease, such as pseudocrescent formation (arrows) seen in mice injected with AAV 2 / 9 mNPHS1.mpodHA. G) iPod NPHS2 injected with saline fl / fl Mice displayed a loss of podocin, while nephrin expression showed a shift from a predominantly membranous to a diffuse pattern.

[0056] Figure 3. AAV LK03 demonstrates efficient transduction of human podocytes in vitro using the minimal human nephrin promoter. A, C, E) Immunofluorescence demonstrates transduction of human podocytes (Pod), glomerular endothelial cells (GEnC), and proximal tubular epithelial cells (PTEC) with AAV LK03 CMV GFP. GFP expression is limited to podocytes when the minimal nephrin promoter, AAV LK03 hNPHS1 GFP, is used. B) Western blot demonstrates GFP expression in podocytes only when the minimal human nephrin promoter is used with AAV LK03. D) Flow cytometry demonstrates high-efficiency transduction of podocytes with AAV LK03 CMV GFP and confirms that GFP expression using the minimal nephrin promoter is restricted to podocytes. In contrast, AAV 2 / 9 CMV GFP exhibits low transduction efficiency in podocytes (n = 3). F) Bar graph shows median fluorescence intensity in podocytes transduced with AAV LK03, and histogram shows the extent of green fluorescence in podocytes transduced with AAV LK03 CMV GFP (right peak), AAV LK03 hNPHS1 GFP (middle peak), and untransduced cells (left peak).

[0057] Figure 4. AAV LK03 expressing wild-type human podocin demonstrates functional rescue of the R138Q mutant podocin in a podocyte cell line. A) Western blot shows that AAV LK03.CMV.hpodocinHA and AAV LK03.hNPHS1.hpodocinHA transduced R138Q podocytes and expressed HA-tagged podocin. B) Immunofluorescence demonstrates expression of HA-tagged wild-type podocin in R138Q mutant podocin podocytes. C) Adhesion assays demonstrate reduced adhesion of the R138Q mutant podocin to podocytes, and rescue of adhesion in R138Q podocytes treated with AAV LK03.hNPHS1.hpodHA.WPRE.bGH. D) Confocal microscopy demonstrates that HA-tagged podocin does not colocalize with calnexin, an endoplasmic reticulum marker. E) TIRF microscopy shows expression of HA-tagged podocin within 100 nm of the plasma membrane, with some colocalization with caveolin, a lipid raft marker.

[0058] Figure 5 An example DNA sequence of the minimal human nephrin promoter (NPHS1) is shown.

[0059] Figure 6 Example cDNA sequences of human nephrin transgenes are shown.

[0060] Figure 7 Example DNA sequences showing WPRE sequences.

[0061] Figure 8 An example DNA sequence of the bGH poly(A) signal sequence is shown.

[0062] Figure 9 Shown are human podocytes transduced with HAVDR (A) or HASmad7 (B) using AAV LK03 with a minimal human nephrin promoter. Example

[0063] method

[0064] Vector production

[0065] We use human ( Figure 6 ) and mouse (sequence not shown) podocin cDNA (Origene, Herford, Germany), as well as human VDR and Smad7 cDNAs, were prepared from the CMV eGFP L22Y pUC-AV2 construct (a kind gift from Amit Nathwani) to generate pAV.hNPHS1.mpodHA.WPRE.bGH, pAV.mNPHS1.mpodHA.WPRE.bGH, and pAV.hNPHS1.hpodHA.WPRE.bGH. Figure 1A ) pAV.mNPHS1.hHAVDR.WPRE.bGH and pAV.mNPHS1.hHASmad7.WPRE.bGH. Human embryonic kidney 293T cells were transfected with capsid plasmids (pAAV9 from Penn Vector Core, pAAV LK03 was a kind gift from Mark Kay), helper plasmids harboring adenoviral genes, and a transgene plasmid using polyethyleneimine. Cells and supernatants were harvested 72 hours after transfection. Cells underwent five freeze-thaw cycles, and supernatants underwent PEG precipitation (8% PEG 0.5N NaCl). These were pooled and incubated with 0.25% sodium deoxycholate and 70 units / ml Benzonase at 37°C for 30 minutes. The vectors were purified by iodixanol gradient ultracentrifugation and subsequently concentrated in PBS. The vectors were titrated by qPCR using a standard curve method with the following primers:

[0066] ITR F GGAACCCCTAGTGATGGAGTT,

[0067] ITR R CGGCCTCAGTGAGCGA,

[0068] ITR probe FAM-5′-CACTCCCTCTGCGCTCG-3′-TAMRA.

[0069] animal

[0070] All animal experiments and procedures were approved by the UK Home Office under the Animals (Scientific Procedures) Act 1986 and followed the Guide for the Care and Use of Laboratory Animals. flox / flox Mice (kind gift from Corinne Antignac, INSERM U983, Paris) were mated with NPHS2-rtTA / Tet-On Cre mice to generate NPHS2-rtTA / Tet-On Cre / NPHS2 flox / flox Upon exposure to doxycycline, these mice develop podocyte-specific podocin knockout. From here on, these will be referred to as iPod NPHS2 fl / fl Mice were of mixed background and equal numbers of each sex were used. AAV was administered to mice via tail vein injection at 8 weeks of age. Figure 1B After 10 to 14 days of treatment, mice were given drinking water supplemented with 2 mg / ml doxycycline and 5% sucrose for 3 weeks. Urine was obtained weekly. Six weeks after the start of doxycycline, mice were sacrificed according to Schedule 1. A small number of mice were retained beyond 6 weeks to test for effects on survival. All mice were regenotyped based on tissues obtained at the time of death.

[0071] Cell culture

[0072] Conditionally immortalized human podocytes (Pod) were cultured in RPMI with L-glutamine, NaHCO3, and 10% fetal bovine serum (Sigma Aldrich, Gillingham, UK). Conditionally immortalized human glomerular endothelial cells (GEnC) were cultured in EGMTM-2 Endothelial Cell Growth Medium-2 BulletKit. TM The cells were cultured in EBM™-2 endothelial cell growth medium 2 (Lonza, Basel, Switzerland). Immortalized proximal tubule epithelial cells (ATCC, Teddington, UK) (PTEC) were cultured in DMEM / F12 supplemented with insulin, transferrin, selenium, hydrocortisone, and 10% FBS.

[0073] AAV was used at 5 x 10 5Cells were transduced at an MOI of 1:1. For GFP expression, cells were used 5-7 days after transduction to allow comparison between different cell lines. For podocin, VDR, and Smad7 expression, cells were used 10-14 days after transduction (when podocytes are maximally differentiated).

[0074] Quantitative PCR

[0075] DNA was extracted from mouse renal cortex using the DNeasy Blood and Tissue Kit (Qiagen, Manchester, UK). AAV DNA was detected using the above primers for viral titration and normalized to mouse beta-actin.

[0076] RNA was extracted using the RNeasy Mini Kit with RNase-Free DNase Set (Qiagen, Manchester, UK).

[0077] Immunofluorescence

[0078] Sections (5 μm) were fixed with 4% PFA and blocked with 3% BSA, 0.3% Triton X-100, and 5% goat or donkey serum. Primary antibodies were rat IgG1 anti-HA high-affinity (Roche, Basel, Switzerland), guinea pig anti-nephrin (1243-1256) antibody (Origene, Herford, Germany), and rabbit anti-NPHS2 antibody (Proteintech, Manchester, UK).

[0079] Cells were fixed with 4% PFA and / or ice-cold methanol, incubated with 0.03 M glycine for 5 minutes, permeabilized with 0.3% Triton, and blocked with 3% BSA. Primary antibodies were mouse HA.11 epitope tag antibody (Biolegend, San Diego, USA), mouse anti-GFP (Roche, Basel, Switzerland), rabbit anti-calnexin (Merck Millipore, Darmstadt, Germany), and rabbit anti-caveolin-1 (Cell Signaling, Danvers, USA).

[0080] Secondary antibodies were AlexaFluor 488 donkey anti-mouse, AlexaFluor 488 donkey anti-rabbit, AlexaFluor 488 goat anti-guinea pig, AlexaFluor 555 goat anti-rabbit, and AlexaFluor 633 goat anti-rat, as well as AlexaFluor 633 phalloidin (Invitrogen, Thermo Fisher Scientific, Waltham, USA). Sections were counterstained with DAPI and mounted in Mowiol. Images were acquired using LAS (Leica Application Suite) X software on a Leica SPE single-channel confocal laser scanning microscope attached to a Leica DMi8 inverted epifluorescence microscope, a Leica SP5-II confocal laser scanning microscope attached to a Leica DMI 6000 inverted epifluorescence microscope, or a Leica AM TIRF MC (Multicolor) system attached to a Leica DMI 6000 inverted epifluorescence microscope.

[0081] Western blotting

[0082] Cells were extracted in SDS lysis buffer. Samples were run on a 12.5% ​​gel and transferred to a PVDF membrane. The membrane was blocked in 5% milk in 0.1% TBST. Primary antibodies used were mouse HA.11 epitope tag antibody (Biolegend, San Diego, USA), mouse anti-GFP in 3% BSA in 0.1% TBST (Roche, Basel, Switzerland), or rabbit anti-NPHS2 antibody (Proteintech, Manchester, UK). Secondary antibodies were anti-rabbit or anti-mouse IgG peroxidase (Sigma Aldrich, Gillingham, UK) in 3% BSA in 0.1% TBST. Membranes were imaged on an Amersham Imager 600.

[0083] Flow cytometry

[0084] Live cells were stained with propidium iodide, and only live single cells were included in the analysis. Flow cytometry was performed on a NovoCyte flow cytometer.

[0085] Adhesion assay

[0086] The cells were trypsinized and 5Resuspend in 50 μl of PBS diluted 1 to 2 and allow to recover for 10 minutes, then plate 50 μl of cells in a 96-well plate. Use technical triplicates. Allow cells to adhere for about 1 hour at 37°C. Wash cells with PBS to remove non-adherent cells and then fix with 4% PFA for 20 minutes. Wash cells with distilled water and then stain with 0.1% crystal violet in 2% ethanol at room temperature for 60 minutes. Wash cells and incubate with 10% acetic acid on a shaker for 5 minutes. Measure absorbance at 570 nm and normalize the results to wild-type cell lines transduced with AAV LK03 CMV GFP.

[0087] Urine

[0088] Albumin levels were measured using a mouse albumin ELISA kit (Bethyl Laboratories Inc, Montgomery, USA), and creatinine levels were measured on a Konelab Prime 60i analyzer.

[0089] blood tests

[0090] Mouse plasma was processed using a Konelab Prime 60i analyzer or a Roche Cobas system using the reagents and protocols supplied by the manufacturers.

[0091] Statistical analysis

[0092] Unless otherwise stated, all data are presented as mean ± SEM. Statistical analyses were performed in GraphPad Prism (Graphpad softward, La Jolla, USA). Statistical tests used included two-tailed t-tests, one-way ANOVA with Tukey's multiple comparison post hoc analysis, two-way ANOVA with Tukey's multiple comparison post hoc analysis, and the log-rank (Mantel-Cox) test for survival analysis.

[0093] result

[0094] Tail vein injection of AAV serotype 9 demonstrated transduction of renal cells and expression in podocytes

[0095] At 8 weeks of age, mice were administered 1.5 × 10 12vg of AAV2 / 9 hNPHS1.mpod or AAV2 / 9 mNPHS1.mpod, or saline. Six weeks later, AAV ITRs were detected in the renal cortex of AAV-injected mice (AAV 2 / 9 hNPHS1.mpod = 39,067 ± 13,285 copies of ssDNA, AAV 2 / 9 mNPHS1mpod = 76,533.33 ± 32047 copies of ssDNA, n = 5-6 / group) ( Figure 1C HA-tagged podocin colocalizes with podocyte markers nephrin and podocin ( Figure 1D )

[0096] AAV2 / 9 expressing wild-type podocin reduces iPod NPHS2 fl / fl Albuminuria in mice

[0097] The vehicle-treated group showed a decrease in urine albumin:creatinine ratio (ACR) ( Figure 2A, 2B). The effect of tail vein injection of podocin-expressing AAV 2 / 9 on urinary ACR yielded an F ratio of F(2,24)=9.61, P<0.001 (n=9 / group). At 14 days after doxycycline, urinary ACR was higher in the saline group than in either vehicle-treated group, although this was not significant (AAV 2 / 9 hNPHS1.mpod = 758.1±488.1 mg / mmol, AAV 2 / 9 mNPHS1.mpod = 59.8±28.0 mg / mmol, saline = 3,770.1±1337.6 mg / mmol, AAV 2 / 9 hNPHS1.mpod vs saline p=0.40, AAV 2 / 9 mNPHS1.mpod vs saline p=0.25). Urinary ACR in the vehicle-treated group was significantly decreased on day 28 (AAV 2 / 9 hNPHS1.mpod = 3,083.0±932.8 mg / mmol, AAV 2 / 9 mNPHS1.mpod = 2,195.1±778.9 mg / mmol, saline = 10,198±3,189.5 mg / mmol, AAV 2 / 9 hNPHS1.mpod vs saline p=0.008, AAV 2 / 9mNPHS1.mpod vs saline p=0.002) and day 42 (AAV 2 / 9 hNPHS1.mpod = 3,266.8±1,212.2 mg / mmol, AAV 2 / 9 mNPHS1.mpod = 3,553.3±1,477.87 mg / mmol, saline = 13,488.8±3,189.5 mg / mmol). In the vehicle-treated groups, 2 of 9 mice in the AAV 2 / 9 hNPHS1.mpod group and 1 of 9 mice in the AAV 2 / 9 mNPHS1.mpod group had urine ACR less than 30 mg / mmol on day 42.

[0098] Although mice in the vector-treated group showed improvement, there was a large degree of variability within the groups, which we hypothesize may be attributed to the amount of vector reaching the kidneys after systemic injection. The amount of viral DNA detected in the renal cortex was inversely correlated with the degree of albuminuria on day 42 (Spearman r = -0.4596, p = 0.0477) ( Figure 2D ).

[0099] AAV2 / 9 expressing wild-type podocin partially rescues iPod NPHS2 fl / flMouse phenotype

[0100] Vehicle-treated mice showed decreased creatinine (saline=39.0±8.5 µmol / L, AAV 2 / 9hNPHS1.mpod=27.3±7.9 µmol / L, AAV 2 / 9 mNPHS1.mpod=18.6±4.4 mmol / L, p=0.1622), decreased urea (saline=39.4±17.6 mmol / L, AAV 2 / 9 hNPHS1.mpod=12.0±2.0 mmol / L, AAV 2 / 9mNPHS1.mpod=11.6±1.6 mmol / L, p=0. 058), and increased albumin (saline=10.5±5.4 g / L, AAV 2 / 9hNPHS1.mpod=17.1±3.6 g / L, AAV 2 / 9 mNPHS1.mpod=11.6±1.6 mmol / L, p=0. g / L, p=0.5602) and cholesterol (saline=15.76±1.75 mmol / L, AAV 2 / 9 hNPHS1.mpod=2.64±0.60 mmol / L, AAV2 / 9 mNPHS2.mpod=4.86±0.76 mmol / L, p=0009) ( Figure 2E ).

[0101] Saline-treated mice developed histological features of FSGS by 6 weeks. Vehicle-treated mice did not show histological features of FSGS under light microscopy but exhibited a range of histological findings, ranging from completely normal glomeruli to pseudocrescents or mesangial hypercellularity. Figure 2F )

[0102] These mice also exhibited prolonged survival (n=3-4 / group), with a median survival of 75.5 days (range, 38 to 111 days) in the saline group compared to a median survival of 192 days (range, 74 to 206 days alive) in the AAV 2 / 9 hNPHS1.mpod and 192 days (range, 131 to 206 days alive) in the AAV 2 / 9 mNPHS1.mpod (p=0.049).

[0103] Untreated mice showed loss of podocin expression and a change in the nephrin expression pattern to a diffuse pattern ( Figure 2G This is in stark contrast to the predominantly membranous expression pattern of nephrin and podocin in vehicle-treated mice ( Figure 1D ).

[0104] AAV LK03 efficiently transduces human podocytes in vitro using the minimal human nephrin promoter

[0105] AAV LK03 with CMV GFP and AAV LK03 hNPHS1 GFP were used at 5 × 10 5 Human podocytes, glomerular endothelial cells, and proximal tubular epithelial cells were transduced at an MOI of 100 μg / mL. Flow cytometry (n=3) showed that AAV LK03 CMV GFP had high transduction efficiency in podocytes (% GFP expression = 98.83±0.84), AAV LK03 hNPHS1 GFP had good transduction (% GFP expression = 71.3±3.39), and the expression in untransduced cells was not significant (% GFP expression = 0.89±0.36) ( Figure 3D This is reflected in immunofluorescence ( Figure 3A 、 3C , 3E) and Western blotting ( Figure 3B Although the proportion of GFP-positive cells was high in podocytes transduced with AAV LK03 hNPHS1 GFP, the fluorescence intensity of these cells was lower than that of cells transduced with AAV LK03 CMVGFP ( Figure 3F ).

[0106] Interestingly, AAV LK03 CMV GFP showed lower transduction in GECs (% GFP expression = 7.35 ± 0.19). AAV LK03 hNPHS1 GFP showed minimal transduction in GECs (% GFP expression = 0.59 ± 0.10), similar to the level of untransduced GECs (% GFP expression = 0.23 ± 0.02). As AAV 2 / 9 is the best serotype for transducing renal cells in vivo in rodent kidneys, we tested AAV 2 / 9 CMV GFP expression on human renal cell lines. AAV 2 / 9 CMV GFP showed low transduction efficiency in both podocytes (% GFP expression = 13.9 ± 1.98) and GECs (% GFP expression = 21.99 ± 4.35). Figure 3D Human podocytes were transduced using AAV LK03 with AAV LK03hNPHS1 HAVDR and AAV LK03 hNPHS1 hSmad7, showing good expression of both proteins ( Figure 9 ).

[0107] AAV LK03 expressing human podocin under the minimal nephrin promoter shows functional rescue in the mutant podocin R138Q podocyte cell line

[0108] The R138Q podocin mutant results in mislocalization of podocin from the plasma membrane to the endoplasmic reticulum. A podocyte cell line expressing the R138Q podocin mutant was obtained from a patient's kidney and conditionally immortalized using the temperature-sensitive SV40 T antigen. R138Q podocytes were transduced with AAV LK03 hNPHS1 hpod and expressed HA-tagged podocin ( Figure 4A , 4B). HA-tagged podocin was observed on the plasma membrane under confocal microscopy and co-localized with caveolin-1 (a lipid raft protein) as observed under TIRF microscopy ( Figure 4B , 4E). Untransduced R138Q podocytes did not show any podocin expression at the plasma membrane ( Figure 4B HA-tagged podocin does not colocalize with calnexin, an endoplasmic reticulum marker ( Figure 4D ).

[0109] Podocytes display decreased or increased adhesion in disease states. Previous work from our laboratory has shown that the R138Q mutation results in decreased podocyte adhesion. AAV transduction leads to decreased podocyte adhesion, but R138Q podocytes still display decreased adhesion compared to wild-type podocytes, and transduction with AAV LK03 hNPHS1 hpod rescues the adhesion function of R138Q podocytes ( Figure 4C ).

[0110] discuss

[0111] Here, we successfully targeted mouse podocytes with AAV 2 / 9 using a minimal nephrin promoter to express mouse podocin in a conditional mouse knockout model, demonstrating partial phenotypic rescue and improved albuminuria in vector-treated mice. As a first proof-of-principle study, we chose to inject the vector before doxycycline induction, allowing for efficient vector rescue upon podocin knockout. The effects of doxycycline induction were rapid, with progression to severe nephropathy (8–14 days) and FSGS relatively rapid (approximately 6 weeks). We show that in vitro, introduction of wild-type human podocin into R138Q podocytes resulted in podocin expression reaching the plasma membrane and rescue of podocyte adhesion.

[0112] Although we have shown that this vector improves albuminuria and survival in these mice, there is a great deal of variability in the extent of albuminuria between treated and untreated mice. This variability within treated mice can be explained, at least in part, by the amount of viral transduction in the kidney ( Figure 2D ).

[0113] AAV LK03 demonstrated high transduction rates of nearly 100% in human podocytes in vitro, which decreased to 72.3% when the minimal human nephrin promoter was used. We have demonstrated that this serotype can be used to specifically transduce podocytes in vitro and functionally rescue wild-type podocin expression in R138Q mutant podocytes. The use of AAV LK03 has potential implications for translation, as such efficient transduction of human podocytes could significantly reduce the effective dose in humans. A recent UK study demonstrated a low 23% seroprevalence of neutralizing antibodies against AAV LK03, nadiring in late childhood (Perocheau, DP et al.), making this particular serotype a promising candidate for translational research.

[0114] We describe the first proof-of-principle study demonstrating that AAV transduction of podocytes with a podocyte-specific promoter improves NPHS2 in iPod fl / fl We also demonstrated that a synthetic capsid AAV, LK03, transduces human podocytes with high efficiency. Taken together, this work represents a first step toward the translation of AAV gene therapy for monogenic diseases targeting podocytes.

[0115] References

[0116] LUO, X., HALL, G., LI, S., BIRD, A., LAVIN, PJ, WINN, MP,KEMPER, AR, BROWN, TT & KOEBERL, DD 2011. Hepatorenal correction of inmurine glycogen storage disease type I with a double-stranded adeno-associated virus vector. Mol Ther, 19, 1961-70.

[0117] MOELLER, MJ, SANDEN, SK, SOOFI, A., WIGGINS, RC & HOLZMAN,LB 2002. Two gene fragments that direct podocyte-specific expression in transgenic mice. J Am Soc Nephrol, 13, 1561-7.

[0118] PEROCHEAU, D. P. et al. Age-Related Seroprevalence of AntibodiesAgainst AAV-LK03 in a UK Population Cohort. doi:10.1089 / hum.2018.098.

[0119] PICCONI, J. L., MUFF-LUETT, M. A., WU, D., BUNCHMAN, E., SCHAEFER, F.& BROPHY, P. D. 2014. Kidney-specific expression of GFP by in-utero deliveryof pseudotyped adeno-associated virus 9. Molecular Therapy. Methods &Clinical Development, 1, 14014.

[0120] ROCCA, C. J., UR, S. N., HARRISON, F. & CHERQUI, S. 2014. rAAV9combined with renal vein injection is optimal for kidney-targeted genedelivery: conclusion of a comparative study. Gene therapy, 21, 618-628.

[0121] SCHIEVENBUSCH, S., STRACK, I., SCHEFFLER, M., NISCHT, R., COUTELLE,O., HÖSEL, M., HALLEK, M., FRIES, J. W. U., DIENES, H.-P., ODENTHAL, M. & BÜNING, H. 2010. Combined Paracrine and Endocrine AAV9 mediated Expression ofHepatocyte Growth Factor for the Treatment of Renal Fibrosis. MolecularTherapy, 18, 1302-1309.

[0122] SCHAMBACH, A., BOHNE, J., BAUM, C., HERMANN, FG, EGERER, L., VONLAER, D. & GIROGLOU, T. 2005. Woodchuck hepatitis virus post-transcriptionalregulatory element deleted from X protein and promoter sequences enhancesretroviral vector titer and expression. Gene Therapy, 13, 641.

[0123] VAN DER WOUDEN, EA, SANDOVICI, M., HENNING, RH, DE ZEEUW, D. &DEELMAN, LE 2004. Approaches and methods in gene therapy for kidneydisease. J Pharmacol Toxicol Methods, 50, 13-24.

[0124] Sequence List Free Text

[0125] [SEQ ID NO: 1] shows the ITR forward primer.

[0126] [SEQ ID NO: 2] shows the ITR reverse primer.

[0127] [SEQ ID NO: 3] shows the DNA sequence of the ITR probe FAM-5′-CACTCCCTCTGCGCTCG-3′-TAMRA.

[0128] [SEQ ID NO: 4] shows Figure 5 An example DNA sequence of the minimal human nephrin promoter (NPHS1) is shown in .

[0129] [SEQ ID NO: 5] shows Figure 6 An example cDNA sequence for a human podocin transgene is shown.

[0130] [SEQ ID NO: 6] shows Figure 7 Example DNA sequences of WPRE sequences are shown.

[0131] [SEQ ID NO: 7] shows Figure 8An exemplary DNA sequence of the bGH poly(A) signal sequence is shown.

Claims

1. An adeno-associated virus (AAV) vector, wherein the AAV vector comprises a NS-associated transgene and a minimal nephrin promoter NPHS1 or a podocin promoter NPHS2.

2. The AAV vector of claim 1, wherein the AAV vector is AAV serotype 2 / 9, LK03, or 3B.

3. The AAV vector of claim 1 or 2, wherein the NS-associated transgene is NPHS2, ADCK4, ALG1, ARHGAP24, ARGHDIA, CD151, CD2AP, COQ2, COQ6, DGKE, E2F3, EMP2, KANK2, LAGE3, LMNA, LMX1B, MAFB, NUP85, NUP93, NXF5, OSGEP, PAX2, PDSS2, PMM2, PODXL, SCARB2, SGPL1, Smad7, TP53RK, TPRKB, VDR, WDR73, WT1, ZMPSTE24, or APOL1.

4. The AAV vector according to any one of claims 1 to 3, wherein the AAV vector further comprises a woodchuck hepatitis posttranscriptional regulatory element (WPRE).

5. The AAV vector according to any one of claims 1 to 4, wherein the NS-associated transgene is human and / or comprises a hemagglutinin (HA) tag.

6. The AAV vector according to any one of claims 1 to 5, wherein the AAV vector further comprises a Kozak sequence between the promoter and the podocin transgene.

7. The AAV vector according to any one of claims 1 to 6, wherein the AAV vector further comprises a polyadenylation signal, such as a bovine growth hormone (bGH) polyadenylation signal.

8. The AAV vector of any one of claims 1 to 7, wherein the AAV vector is formulated for administration to a human patient.

9. The AAV vector of claim 8, wherein the patient is a pediatric patient.

10. The AAV vector of any one of claims 1 to 9, wherein the monogenic form of NS is a monogenic form of steroid-resistant nephrotic syndrome.

11. The AAV vector of any one of claims 1 to 10, wherein the AAV vector is formulated for systemic administration.

12. The AAV vector of any one of claims 1 to 11, wherein the AAV vector is formulated for administration by intravenous injection.

13. The AAV vector of any one of claims 1 to 12, wherein the AAV vector is formulated for administration by injection into the renal artery.

Images