Application of Gnai2 protein inhibitor in preparation of medicine for treating diabetic nephropathy

Abstract

The invention discloses an application of a Gnai2 protein inhibitor in preparation of a medicine for treating diabetic nephropathy, and belongs to the technical field of biological medicine, research shows that expression of Gnai2 in a diabetic nephropathy sample is up-regulated and is in positive correlation with a renal injury index, after the Gnai2 gene is knocked out, lipophagy can be promoted, lipid droplet deposition can be reduced, development of diabetic nephropathy can be relieved, and the Gnai2 protein inhibitor can be used for treating diabetic nephropathy. Overexpression of the Gnai2 gene can significantly inhibit lipophagy, promote lipid droplet deposition and aggravate development of diabetic nephropathy. The Gnai2 protein as a drug target can be used for screening and discovering substances for preventing and treating the diabetic nephropathy, and the Gnai2 protein inhibitor has a good application prospect in the aspect of preparing drugs for treating the diabetic nephropathy. According to the invention, the blank of'lipid metabolism disorder 'research in the pathogenesis of diabetic nephropathy is filled, and the normal form transformation of diabetic nephropathy from single sugar control treatment to'lipid metabolism-inflammation / fibrosis' multi-channel precise treatment is promoted.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of Gnai2 protein inhibitors in the preparation of drugs for the treatment of diabetic nephropathy. Background Technology

[0002] Diabetes mellitus is a metabolic disease characterized by chronic hyperglycemia, with its core pathogenesis being insulin secretion defects and / or impaired insulin action. Long-term hyperglycemia leads to a series of microvascular and macrovascular complications, severely impacting patient prognosis. Diabetic nephropathy (DN) is one of the most common and serious microvascular complications of diabetes, its pathological basis being hyperglycemia-mediated glomerular hypertension, inflammation, and fibrosis. Clinically, it mainly manifests as abnormally increased proteinuria, edema, elevated blood pressure, and progressive deterioration of renal function. If the disease continues to progress, it may eventually develop into end-stage renal disease, one of the leading causes of death in diabetic patients. The key to treating diabetic nephropathy lies in early intervention and comprehensive management. Adopting an active, multi-target comprehensive management strategy for DN is crucial for delaying disease progression and improving long-term patient prognosis.

[0003] Existing technologies have been extensively researched for the treatment of diabetic nephropathy. For example, Chinese patent document CN111494358A discloses drugs for the treatment and prevention of diabetic nephropathy, including tiagogliflozin and a DPP-4 inhibitor. The content of tiagogliflozin is 10-100 mg, and the content of the DPP-4 inhibitor is 10-50 mg. This drug can significantly reduce blood urea nitrogen, serum creatinine, 24-hour urinary protein, urinary protein quantification, and the content or expression level of transforming growth factor-β1, showing good therapeutic and preventive effects on diabetic nephropathy. Chinese patent document CN118490829A discloses the application of Dlat gene expression promoters or agonists in the preparation of drugs for the treatment of diabetic nephropathy. Knocking down Dlat increases renal function and structural damage in mice with high-fat diets combined with streptozotocin, further aggravating fibrosis. Hypericin and other substances can increase Dlat expression and can be used to treat diabetic nephropathy. Although the above inventions are all treatment options for diabetic nephropathy, their clinical efficacy still needs to be investigated. Therefore, it is still necessary to explore new key disease targets to break through the existing treatment bottlenecks.

[0004] Gnai2, a member of the α subunit of the G protein family, is a crucial signal transduction molecule. Gnai2 proteins participate in the regulation of various physiological processes and signal transduction pathways, playing vital roles in receptor-coupled signal transduction pathways such as cell proliferation, differentiation, and death, and are closely related to various pathophysiological processes in the body. Previous studies have found that Gnai2 can serve as a target for screening drugs for stroke treatment (Chinese patent document publication number CN117686718A); however, the role of Gnai2 in diabetic nephropathy has not yet been reported. Summary of the Invention

[0005] This invention provides the application of Gnai2 protein inhibitors in the preparation of drugs for the treatment of diabetic nephropathy. Gnai2 protein can be used as a drug target to screen and discover substances for the prevention and treatment of diabetic nephropathy. Furthermore, by knocking out the Gnai2 gene and inhibiting Gnai2 protein expression, lipophagus can be promoted, lipid droplet deposition can be inhibited, and inflammation and fibrosis of human renal tubular epithelial cells HK-2 can be alleviated, thereby achieving the therapeutic effect on diabetic nephropathy.

[0006] The specific technical solution adopted is as follows: Application of Gnai2 protein inhibitors in the preparation of drugs for the treatment of diabetic nephropathy.

[0007] Gnai2 protein inhibitors are selected from substances that inhibit Gnai2 protein expression, substances that inhibit Gnai2 protein activity, or substances that inhibit Gnai2 gene expression; the nucleotide sequence of the gene encoding Gnai2 protein is shown as Gene ID:2771 in NCBI.

[0008] Furthermore, the Gnai2 protein inhibitor is a recombinant plasmid that inhibits the expression of the Gnai2 gene, named pLenti-Gnai2-sgRNA.

[0009] The present invention also provides a therapeutic drug for diabetic nephropathy, comprising a Gnai2 protein inhibitor.

[0010] Furthermore, the drug components for treating diabetic nephropathy also include pharmaceutically acceptable excipients and are formulated into pharmaceutically acceptable dosage forms.

[0011] Furthermore, the excipients are selected from one or more combinations of buffers, encapsulating agents, fillers, binders, transdermal absorbents, humectants, disintegrants, absorption promoters, surfactants, colorants, flavoring agents, and adsorbents.

[0012] The corresponding drug treatments for diabetic nephropathy include promoting lipophagus, inhibiting lipid droplet deposition, and alleviating inflammation and fibrosis of human renal tubular epithelial cells HK-2.

[0013] This invention also provides the application of Gnai2 protein as a drug target in screening drugs for the treatment of diabetic nephropathy. The drugs screened for the treatment of diabetic nephropathy are those that can inhibit the expression of the Gnai2 gene, and are for non-diagnostic and non-therapeutic purposes.

[0014] This invention demonstrates that Gnai2 is upregulated in diabetic nephropathy samples and is positively correlated with kidney damage indicators, including urinary protein and urinary creatinine levels.

[0015] Specifically, studies using a mouse model of diabetic nephropathy have found that the serum Gnai2 protein level in diabetic nephropathy mice is significantly higher than that in healthy control mice, and is significantly positively correlated with urinary protein and urinary creatinine levels. Knockout of the Gnai2 gene promotes lipophagus, reduces lipid droplet deposition, and alleviates the progression of diabetic nephropathy, while overexpression of the Gnai2 gene significantly inhibits lipophagus, promotes lipid droplet deposition, and exacerbates the progression of diabetic nephropathy.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: 1) This invention fills the research gap in the pathogenesis of diabetic nephropathy by "lipid metabolism disorder", expands the traditional pathological framework, and can provide new biomarkers and interventionable molecular targets for diabetic nephropathy. It also provides the application of Gnai2 protein in the screening of drugs for the treatment of diabetic nephropathy and in the treatment of diabetic nephropathy.

[0017] 2) This invention helps to promote the paradigm shift of diabetic nephropathy from single blood sugar control treatment to precision treatment of multiple pathways of "lipid metabolism-inflammation / fibrosis", which has significant social and economic benefits. Attached Figure Description

[0018] Figure 1 The expression of Gnai2 in diabetic nephropathy patients and mice is shown, where A represents healthy individuals. n = 9) and diabetic nephropathy (DN, n = 10) Differences in Gnai2 gene expression in kidney biopsy samples; B) Correlation analysis of Gnai2 gene expression and glomerular filtration rate (GFR) in humans (n ​​= 11); C) Correlation analysis of Gnai2 gene expression and creatinine (CRE) in humans (n ​​= 10) n= 62); D represents the serum Gnai2 level in mice in the control and diabetic nephropathy groups; E represents the Gnai2 protein level and quantification results in kidney tissue; FH represents the correlation analysis between serum Gnai2 levels and urinary related indicators; I represents kidney tissue samples from healthy control mice (CON) and diabetic nephropathy experimental groups (DN) at week 8; J represents the expression of Gnai2 family homologous genes in HK-2 cells treated with no glucose (CON) and 30 mmol / L glucose for 24 h (HG); KL represents immunofluorescence co-staining images of kidney samples from DN patients and kidney samples from mice at week 8 of DN, respectively; LTL represents the proximal tubule, PNA the distal tubule, and Synaptopodin podocytes. Data are expressed as mean ± standard error. * p < 0.05,** p < 0.01, # p < 0.05, ## p < 0.01 indicates a significant difference.

[0019] Figure 2 The results of the study on the changes in Gnai2 and lipophage are presented below. AB shows the fluorescence images and quantitative results of autophagy changes characterized by red mCherry and green GFP fluorescence in HK-2 cells transfected with AdPlus-mCherry-GFP-LC3B adenovirus under 30 mmol / L high glucose treatment. CE shows the immunofluorescence co-staining images of Gnai2 (red) and autophagy protein LC3 (green), Gnai2 (red) and lipid droplets Bodipy (green), and LC3 (red) and lipid droplets Bodipy (green) in mouse kidney tissue, captured using a fluorescence microscope. FH shows the immunofluorescence co-staining images of Gnai2 (red) and autophagy protein LC3 (green), Gnai2 (red) and lipid droplets Bodipy (green), and LC3 (red) and lipid droplets Bodipy (green) in HK-2 cells, captured using a fluorescence microscope. Data are expressed as mean ± standard error. p < 0.01 indicates a significant difference.

[0020] Figure 3 This study demonstrates the negative regulation of lipophage by Gnai2. In image A, Western blotting (WB) analysis of Gnai2 and autophagy protein levels was performed after transfecting HK-2 cells with the CRISPR / Cas9-Gnai2 plasmid. Images and quantification results are presented in Oil Red stained images. Images and quantification results are presented in DE, showing co-staining immunofluorescence images of autophagy protein LC3 (red) and Bodipy lipid droplets (green). Data are expressed as mean ± standard error. p < 0.01 indicates a significant difference.

[0021] Figure 4 To investigate the effect of Gnai2 overexpression downregulating lipophage levels, images AB show the changes and quantification of Gnai2 and autophagy protein levels after transfection of HK-2 cells with a Gnai2 overexpression plasmid using Western blotting. Images CD show Oil Red staining and quantification results. Images EF show co-staining immunofluorescence images of autophagy protein LC3 (red) and Bodipy lipid droplets (green). Data are presented as mean ± standard error. p < 0.01 indicates a significant difference.

[0022] Figure 5 The effect of Gnai2 deficiency on the kidneys is shown in Figures AB, where serum creatinine and blood urea nitrogen levels in conditionally knockout DN mice are measured; kidney TG levels in mice are measured; and H&E, PAS, and MASSON staining results of kidney tissue sections from mice are shown. Data are expressed as mean ± standard error. * p < 0.05,** p < 0.01, ## p < 0.01 indicates a significant difference. Detailed Implementation

[0023] To make the objectives, features, and advantages of this invention more apparent and understandable, a detailed description is provided below through specific embodiments. Many specific details are set forth in the following description to provide a thorough understanding of the invention. However, the invention can be practiced in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below. Technical features in various embodiments of the invention can be combined appropriately without mutual conflict.

[0024] Unless otherwise specified, the operating methods in the following examples are generally performed under conventional conditions or as recommended by the manufacturer. Contents not described in detail in this specification are prior art known to those skilled in the art. Unless otherwise specified, the experimental materials used in the examples below can be purchased from conventional biochemical reagent companies.

[0025] This invention aims to provide precision treatment strategies for diabetic nephropathy, including diabetic nephropathy, by verifying the clinical translational potential of Gnai2 as an intervention target and a screening target for therapeutic drugs for diabetic nephropathy. The research content and conclusions in the embodiments mainly include the following aspects: 1) Discovery and Validation: This invention confirms that Gnai2 is significantly elevated in the kidneys and serum of patients with diabetic nephropathy (DN) and model animals, and is positively correlated with renal function-related indicators. It can be used as a molecular marker for non-invasive diagnosis and disease grading of diabetic nephropathy. Furthermore, this invention clarifies that Gnai2 is mainly located in the proximal tubular epithelial cells, providing precise histological evidence for subsequent targeted intervention.

[0026] 2) Function and Mechanism: This invention demonstrates, through a high-glucose cell model, gene knockdown and overexpression, and a conditional gene knockout animal model, that Gnai2 deficiency promotes lipophage, reduces lipid droplet deposition, improves renal function, and thus alleviates inflammation. TNF-α , MCP-1 , IL-6 ) and fibrosis ( α-SMA , TGF-β , Collagen-I Conversely, Gnai2 overexpression significantly exacerbates the above response.

[0027] Example 1: Expression of Gnai2 in diabetic nephropathy patients and mice 1. Human kidney data analysis The correlation between Gnai2 and kidney function was assessed using Nephroseq (https: / / www.nephroseq.org / ), a data platform for mining kidney disease datasets. The specific implementation steps are as follows: 1) On the Nephroseq v5 homepage, click "Browse Datasets" and set the filter criteria as follows: Disease = "Diabetic Kidney Disease"; Tissue = "Human kidney biopsy (glomerulus ortubulointerstitium)"; Data type = "RNA-seq"; finally, healthy individuals will be included. n = 9) and diabetic nephropathy (DN, n = 10) Two cohorts, all samples of which have complete clinical indicators such as estimated glomerular filtration rate (eGFR).

[0028] 2) Enter the gene symbol "Gnai2" in the "Gene Search" field and select the glomerular and tubulointerstitial dataset: Calculate the Pearson correlation between Gnai2 log2(TPM+1) and eGFR (CKD-EPI formula); Calculate the Pearson correlation between Gnai2 log2(TPM+1) and urinary protein protein (Proteinuria); Using Nephroseq's built-in "Clinical Correlation" module, it automatically outputs the correlation coefficient, 95% confidence interval (CI), and FDR-corrected p-value, and generates scatter plots and fitted curves.

[0029] 2. Enzyme-linked immunosorbent assay (ELISA) Seventy 8-week-old mice were randomly divided into a control group (CON) and a diabetic nephropathy model group (DN). The control group consisted of 30 mice fed a normal diet and given sterile water. The DN model group consisted of 40 mice fed a 60% high-fat diet and given sterile water. After four weeks of feeding the normal and high-fat diets, all mice underwent a 16-hour fast. DN mice received intraperitoneal injections of 0.1 M streptozotocin (STZ) dissolved in sodium citrate buffer for five consecutive days, while CON mice received the same dose of sodium citrate buffer. Three days after the injections, the mice were fasted for 16 hours, and fasting blood glucose levels were measured by tail vein sampling. A fasting blood glucose level ≥ 11.1 mmol / L was considered a successful establishment of the diabetic nephropathy model. Mice with successful DN were continued to be fed a high-fat diet to induce the model. Both groups of mice were weighed weekly, fasting blood glucose was measured every two weeks by tail vein sampling, and urine was collected every four weeks using metabolic cages. Both groups of mice were sacrificed in batches via cervical dislocation at five time points: week 0, week 4, week 8, week 12, and week 16. Serum, urine, and tissue samples were collected at these five time points. Week 0 refers to the period of four weeks on a high-fat diet without STZ injection. Blood samples were collected through the mouse's orbit. After centrifugation at 7000 rpm for 7 min, serum was collected to detect indicators such as blood glucose and serum creatinine. After sacrifice, the required tissues were collected. Serum, urine, and tissues were stored together in an ultra-low temperature freezer at -80°C, and kidney tissue was fixed and sectioned for subsequent experiments.

[0030] The level of Gnai2 in mouse serum was quantitatively detected using an enzyme-linked immunosorbent assay (ELISA) according to the kit instructions. The specific procedure was as follows: Standard or serum / kidney tissue homogenate was diluted and added to an antibody-coated ELISA plate, followed by the addition of ELISA reagent and incubation for 1 hour. The plate was then washed several times and patted dry. The chromogenic solution was added and incubated for 15 minutes. After adding the stop solution, the absorbance was measured at 450 nm using an ELISA reader within 10 minutes.

[0031] 3. Measurement of urine protein and urine creatinine Urinary protein and creatinine were detected using a urine protein quantification kit (CBB method) and a creatinine assay kit (sarcosine oxidase method), respectively. CBB method: Prepare CBB working solution (CBB reagent: distilled water = 1:4). Set up blank tubes (50 μL double-distilled water + 3 mL working solution), standard tubes (50 μL protein standard solution + 3 mL working solution), and assay tubes (50 μL urine + 3 mL working solution). Mix well and let stand at room temperature for 5 min. Measure absorbance at 595 nm. Urinary protein concentration = (assay OD - blank OD) × standard concentration × dilution factor / (standard OD - blank OD). Creatinine method: Dilute urine 2-10 times with physiological saline. Set up blank, standard and assay wells in a 96-well plate. Add 6 μL of distilled water, 6 μL of 442 μmol / L standard or 6 μL of diluted urine, respectively. Then add 180 μL of enzyme solution A and 60 μL of enzyme solution B in sequence. Incubate at 37 °C for 5 min. Read A1 and A2 at 546 nm and calculate ΔA = A2 - A1. Urine creatinine content (μmol / L) = (ΔA assay - ΔA blank) × 442 / (ΔA standard - ΔA blank) × 186 / 246 × dilution factor.

[0032] 4. Immunofluorescence assay Paraffin sections were dewaxed in xylene for 15 min, then dewaxed again for 10 min with the solution changed. They were then dehydrated sequentially with anhydrous ethanol for 10 min, 95% ethanol for 5 min, and 75% ethanol for 5 min. Fixation with 4% PFA at room temperature for 15 min followed by thorough washing with PBS (3 x 5 min). Permeabilization with 0.25% Triton X-100 / PBS for 15 min, followed by washing with PBS (3 x 5 min). Blocking with 5% FBS / PBS at room temperature in the dark for 1 h. Incubation with 1:800 Gnai2 antibody at 4°C overnight, followed by washing with PBS (10 min). Permeabilization again with 0.25% Triton X-100 / PBS for 10 min, followed by washing with PBS (2 x 10 min). Incubation with 1:500 Alexa Fluor 488 / 594 secondary antibody at room temperature in the dark for 1 h, followed by washing with PBS (3 x 10 min). Finally, mounting with a DAPI-containing fluorescent anti-quenching agent, observation under a fluorescence microscope, and quantitative analysis of fluorescence signals using ImageJ were performed.

[0033] 5. Western blot Kidney tissue samples of appropriate size were selected on dry ice. Magnetic beads and 200 μL of protein extraction lysis buffer containing 1% phosphatase inhibitor and 1% protease inhibitor were added. The tissue was homogenized in a tissue homogenizer at 60 Hz / 90 s / 3 times. The samples were then transferred to a high-speed centrifuge at 12000 rpm, 4°C for 15 min. The supernatant was collected to obtain kidney tissue protein, and the protein concentration was determined using a BCA kit. The sample system was adjusted with protein extraction lysis buffer, and loading buffer was added. After vortexing, the samples were denatured in a 98°C metal bath for 8 min, followed by cooling on ice. Each sample (40 μg protein) was separated by 8% SDS-PAGE and transferred to a polyvinylidene fluoride (PVDF) membrane. The membrane was then blocked with 5% bovine serum albumin (BSA) and incubated with primary antibody overnight at 4°C. The membrane was then washed three times with Tris buffer containing 0.1% Tween 20 and incubated with the corresponding secondary antibody at room temperature for 1 h. The membrane was then washed with Tris buffer for 3 × 5 min. Next, the membrane was treated with the luminescent reagent ECLMaster Mix, and protein bands were imaged. The intensity of each band was scanned and calculated using ImageJ software, and protein expression levels were normalized to β-actin. Normalized data are expressed as fold changes relative to the control group.

[0034] 6. RT-qPCR HK-2 cells were distributed at a rate of 1 × 10⁶ cells per well. 5Cells were seeded at a density of [number] cells per well in 12-well plates and treated according to the experimental protocol. After 24 hours of treatment, the culture medium was discarded, and the cells were rinsed twice with PBS. The PBS was discarded, and 600 μL of Trizol was added and the cells were agitated. RNA extraction was then performed according to the instructions. Finally, RNase-free ddH2O was added, and the concentration and purity of RNA were determined using a Nano-300 ultraviolet-visible spectrophotometer (Ausun, Hangzhou, China). Genomic DNA removal was first performed using the HiScript® II Q RTSuperMix kit (R223, Novizan, Nanjing, China). 4 µL of 4×g DNAwiper Mix and 1000 ng of RNA were added, followed by RNase-free ddH2O to a final volume of 16 µL. After mixing, the mixture was incubated in a 42°C metal bath for 10 min. Next, the reverse transcription reaction system was prepared by adding 5 µL of 5×HiScript II qRT SuperMix II reagent to the above system. After mixing, the mixture was placed in a 50℃ metal bath for 15 min, followed by a 5s reaction at 85℃ to complete the reverse transcription step. The RT-qPCR system was then prepared by adding ddH2O, SYBR, and primers for the target gene. The primer sequences were synthesized by Shanghai Sangon Biotech Co., Ltd. The RT-qPCR reaction was performed under the following conditions: first, a 2-min reaction at 95℃; then a 15-s reaction at 95℃, followed by a 30-s reaction at 60℃, repeated for 40 cycles. After the reaction, the RT-qPCR data were processed and analyzed using the threshold cycle number comparison method. The expression level of each gene was calculated by normalizing the average data from the control group, and Prism plotting was used.

[0035] 7. Experimental Results To determine whether Gnai2 is associated with kidney disease (DN), the expression of Gnai2 in the kidney was first analyzed using the publicly available kidney gene expression profiling database Nephroseq. The results showed that, compared with healthy individuals, Gnai2 expression in the kidney was significantly lower. Gnai2 The expression level of the gene is significantly increased in the kidneys of patients with diabetic nephropathy (DN). Figure 1 (A) in the text. (The rest of the text appears to be a fragment and requires further context for accurate translation.) Gnai2 Correlation analysis at the gene level with human kidney function indicators such as proteinuria level, glomerular filtration rate (eGFR), and creatinine level (CRE) showed that in patients with diabetic nephropathy... Gnai2 In the correlation analysis with glomerular filtration rate, Gnai2 It is significantly negatively correlated with GFR ( Figure 1 B in the figure is significantly positively correlated with creatinine level CRE ( Figure 1(C in the text). This suggests that elevated Gnai2 expression may be related to increased glomerular filtration membrane permeability or kidney disease. Further studies in a diabetic nephropathy mouse model revealed that serum Gnai2 levels were significantly higher than in healthy control mice and showed a significant positive correlation with urinary protein and creatinine levels. Figure 1 (DH in the blood). Similar to serum results, ELISA and Western blot results showed that Gnai2 levels were significantly elevated in the kidneys of DN mice.

[0036] Gnai2 protein belongs to the G protein α subunit family. To investigate the expression of its family homologous genes in a DN model, PCR results showed that in the DN model, Gnai1, Gnai3 and Gng2 Gene expression in the group showed no significant change compared to the CON group. GnaiI2 and Gnb1 Significantly increased in the DN group ( Figure 1 (I) In the human renal tubular epithelial cell HK-2 cell HG model, Gnai1, Gnai3, Gnb1 and Gng2 There were no significant changes in gene expression. Gnai2 Significant increase ( Figure 1 (J in the middle), the above results show that Gnai2 The gene was specifically highly expressed in a diabetic nephropathy model. Immunofluorescence staining of renal tissues from DN patients and mice was performed using lotus tetragonolobus lectin (LTL) to label the proximal tubules, peanut agglutinin (PNA) to label the distal tubules, and human synaptopodin (SYNPO) to label podocytes. This determined that Gnai2 was highly expressed in the proximal tubules and poorly expressed in podocytes. Figure 1 KL in the middle).

[0037] Example 2: Study on the changing trends of Gnai2 and lipophage 1. Experimental Design Autophagy flux was monitored using AdPlus-mCherry-GFP-LC3B adenovirus (C3012, Beyotime), a modified tandem fluorescent protein. The adenovirus expressed mCherry and GFP were used to track changes in the LC3 protein during autophagy. The fusion of red mCherry fluorescence and green GFP fluorescence produces yellow fluorescence. Because GFP is sensitive to acidity, the GFP fluorescence is extinguished when autophagosomes fuse with lysosomes. Therefore, during autophagy, red fluorescence is more abundant than yellow fluorescence; when the fusion of autophagosomes and lysosomes is impaired, yellow fluorescence predominates.

[0038] The specific steps are as follows: Cells in logarithmic growth phase were fed at a rate of 1×10⁻⁶. 5 Cells were seeded at a density of 60% in 24-well plates and cultured in complete medium. Once the cell density reached 60%, the cells were confirmed to be in good growth condition under a microscope. The mRFP-GFP-LC3 adenovirus was removed from the -80°C freezer, thawed on ice, and mixed thoroughly before use. The 24-well plates were removed from the cell culture incubator, the old culture medium was discarded, and 300 μL of fresh medium containing the virus at a MOI of 20 was added to each well. Wells without the virus were used as a control group. Approximately 24 hours post-infection, the virus-containing culture medium was removed, and 500 μL of fresh complete medium was added to each well for another 24 hours of culture. Alternatively, 500 μL of 30 mmol / L high-glucose medium was added for the appropriate culture time. Fluorescent protein expression was observed using a fluorescence microscope, and immunofluorescence staining was performed simultaneously.

[0039] 2. Experimental Results HK-2 cells were transfected with AdPlus-mCherry-GFP-LC3B adenovirus. Changes in autophagy, characterized by red fluorescent mCherry and green fluorescent GFP, were observed. Because GFP fluorescent protein is sensitive to acidity, its fluorescence extinguished after the fusion of autophagosomes and lysosomes under enhanced autophagy conditions. Fluorescence results showed that red fluorescence gradually increased and green fluorescence gradually decreased from 6 h, with the strongest red fluorescence intensity at 24 h, indicating that autophagy in HK-2 cells was strongest after 24 h of high glucose treatment. Figure 2 (AB in the text). Simultaneously, to investigate the trend changes between Gnai2 and lipophage, kidney tissue sections from DN mice were subjected to pairwise immunofluorescence staining for Gnai2, LC3, and Bodipy, and the fluorescence expression was observed using a fluorescence microscope. The fluorescence results showed (...). Figure 2 In the CE (Chemical Oxidation) assay, the fluorescence levels of Gnai2 and autophagy protein LC3 were strongest at week 8, and the lipid droplet deposition characterized by Bodipy was most severe. Furthermore, the fluorescence overlap between Gnai2 and LC3, and between Gnai2 and Bodipy, was high at week 8. The overlap of red and green fluorescence in the LC3 and Bodipy co-stained image represents the level of lipophage. The results show that the level of lipophage was strong in DN mice at week 8, and began to decrease from week 8 onwards at week 12.

[0040] HK-2 cells were treated with 30 mmol / L glucose for different time periods, followed by pairwise immunofluorescence staining of Gnai2, LC3, and Bodipy cells. Co-staining was observed using a fluorescence microscope. The results showed that ( Figure 2In the study of Gnai2 (FH) in DN mice, the fluorescence levels of Gnai2 and autophagy protein LC3 were strongest at 24 h, and the most severe lipid droplet deposition was characterized by Bodipy. Lipophagy was stronger at 24 h of high glucose treatment, but began to weaken at 48 h compared to 24 h. Combined with the trend of Gnai2 changes in DN mice, it can be seen that the trends of Gnai2 and lipophage are consistent. In conclusion, further research on Gnai2, lipophage, and the relationship between the two can be conducted using the DN mouse model at week 8 and the HK-2 cell model with 24 h of high glucose treatment.

[0041] Example 3: Gnai2 negatively regulates lipophagus 1. Experimental Design Further investigation Gnai2 The role of gene knockout in HK-2 cells, studied using knockout plasmids. Gnai2 The effect of gene knockout on HK-2 cells. Cells were randomly divided into a control group and a high-glucose group (supplemented with 30 mmol / L glucose). Gnai2 Gene knockout control group (transfected) Gnai2 Gene knockout plasmids and Gnai2 Gene knockout high-glucose group (transfected) Gnai2 Four groups were formed by adding 30 mmol / L glucose to the gene knockout plasmid. Gnai2 The nucleotide sequence of the encoding gene is shown as Gene ID 2771 in NCBI; The CRISPR / Cas9-constructed Gnai2 knockout plasmid (L19735, Beyotime, Shanghai, China) was used. The pLenti-Gnai2-sgRNA sequencing primer was hU6, and the forward primer was 5′ATGGACTATCATATGCTTACCGTA3′ (SEQ ID NO.1). The sgRNA sequence was GTACTGCCGGCATTCCTCCT (SEQ ID NO.2). The aligned sequence during sequencing was as follows: ATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGTACTGCCGGCATTCCTCCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTG (SEQ ID NO.3).

[0042] 2. Plasmid transfection 1) Place HK-2 cells at a ratio of 1 × 10⁶ cells per well. 6The cells were seeded at a density of 70%-80% in 6-well plates and cultured in antibiotic-free medium. Plasmid transfection was performed when the cell density reached 70%-80%.

[0043] 2) Dilute two tubes of Lipofectamine 3000 reagent (Thermo Fisher Scientific, New York, USA) with Opti-MEM medium (Zhongke Maichen, Beijing, China) and mix thoroughly. Each tube contains 125 μL of Opti-MEM medium and 3.75 μL of Lipofectamine 3000 reagent. 3) Dilute the plasmid DNA with Opti-MEM medium and mix thoroughly. Each tube contains 250 μL of Opti-MEM medium, 5 μg of plasmid DNA, and 10 μL of P3000 reagent (2 μL / μg DNA). 4) Add diluted plasmid DNA to each tube of diluted Lipofectamine 3000 reagent at a 1:1 ratio and incubate at room temperature for 10-15 min; 5) During incubation, discard the antibiotic-free medium in the six-well plate, wash twice with PBS, and then add 250 μL of serum-free medium. 6) Add 250 μL of DNA-lipid complex to each well of the cells. If the cells are in poor condition 4 h after transfection, replace the medium with serum-containing medium. If the cells are in good condition, replace the medium 6 h after transfection.

[0044] 3. Oil Red O staining 1) Oil Red Mother Liquor: Weigh 0.35g of oil red powder, add 100 mL of isopropanol, filter after complete dissolution, and store at room temperature away from light; 2) Oil Red working solution: Dilute the oil red mother liquor with ddH2O at a ratio of 3:2, let it stand at room temperature in the dark for 20 min, and then filter it for later use. 3) Discard the culture medium inside the cells, wash with PBS, and then discard. 4) Add 10% formalin solution to each well and fix the cells overnight at room temperature; 5) Discard the formalin solution and wash the cells twice with ddH2O; 6) Treat cells with 60% isopropanol for 5 min; 7) Discard the isopropanol solution, remove any remaining reagents, and allow to dry at room temperature; 8. Add Oil Red O working solution to each well and incubate the cells at room temperature for 10 min; 9) Discard the Oil Red O working solution and quickly wash the cells 5 times with ddH2O; 10) Take and save images of the stained areas using a microscope; 11) Add 100% isopropanol to elute Oil Red O dye, and mix on a shaker for 5 minutes; 12) Take the above dye extract and measure the absorbance of each well at 492 nm using an ELISA reader and analyze the data.

[0045] 4. Experimental Results The effects of Gnai2 knockout plasmids on lipophage were investigated by constructing and transfecting them into HK-2 cells. Results showed that lipophage levels increased after effective Gnai2 knockout. Figure 3 A). Oil Red staining results showed that Gnai2 knockout reversed high glucose-induced lipid deposition (A). Figure 3 In the BC (Baidu, BC) of Gnai2 knockout, autophagy was enhanced and lipid droplet number decreased after Gnai2 knockout, with high overlap of red and green fluorescence, indicating enhanced lipphagy. Figure 3 (DE in the text). The above results indicate that Gnai2 plays a negative regulatory role in lipophagy. The absence of Gnai2 can activate intracellular lipophagy function, thereby alleviating lipid accumulation caused by high glucose treatment.

[0046] Example 4: Overexpression of Gnai2 downregulates lipophage levels 1. Experimental Design Further investigation Gnai2 The effect of overexpression in HK-2 cells was investigated using the pCMV-Gnai2(human)-3×FLAG-Ne plasmid. Gnai2 The effect of gene overexpression on HK-2 cells. Cells were randomly divided into a control group and a high-glucose group (supplemented with 30 mmol / L glucose). Gnai2 Gene overexpression control group (transfected) Gnai2 Gene overexpression plasmids and Gnai2 Gene overexpression high glucose group (transfected) Gnai2 Four groups were formed by adding 30 mmol / L glucose to the gene overexpression plasmid. Gnai2 The gene overexpression plasmid was synthesized by Wuhan Miaoling Biotechnology. The overexpression plasmid was pCMV-Gnai2(human)-3×FLAG-Ne. The forward primer for constructing the Gnai2 overexpression plasmid was CMV-F: CGCAAATGGGCGGTAGGCGTG (SEQ ID NO.4), and the reverse primer was BGH-R: CTACTCAGACAATGCGATGCAA (SEQ ID NO.5).

[0047] 2. Experimental Results The relationship between Gnai2 and lipophagus was further verified by constructing a Gnai2 overexpression plasmid. The results showed that after plasmid introduction, Gnai2 levels significantly increased, while lipophagus levels decreased. Figure 4 AB in the image). Oil Red results showed that Gnai2 overexpression exacerbated high glucose-induced lipid deposition (AB). Figure 4 CD in the middle). Immunofluorescence showed that lipopythmia was reduced after Gnai2 overexpression ( Figure 4 RAB7 is a small GTPase protein that characterizes intracellular lipophage levels. Under high glucose induction, lipophage increases, and RAB7 expression increases. Increased RAB7 helps promote the fusion of lipid droplets with lysosomes, thereby enabling lipid droplet degradation and energy utilization. However, RAB7 levels decrease after Gnai2 overexpression, i.e., lipophage is downregulated (…). Figure 4 (F in the figure). The above results indicate that activation of Gnai2 downregulates lipophage levels in HK-2 cells.

[0048] Example 5: Effects of Gnai2 deficiency on the kidneys 1. Experimental Design Conditional knockout mice are created by inserting loxP sites flanking the target gene (i.e., flox mice), and then crossing them with mice expressing Cre recombinase in specific tissues. This allows Cre recombinase to mediate the deletion of gene fragments between loxP sites under specific tissue conditions, thus achieving gene knockout under specific conditions. In this experiment, Gnai2 Flox homozygous mice were crossed with GGT-Cre (proximal tubule-specific) mice, and their genotypes were identified by PCR to screen for Gnai2 gene conditional knockout mice. Table 1 shows the primer sequences used for genotype identification.

[0049] Table 1 Primer sequences used in identification (SEQ ID NO. 6-9)

[0050] Thirty-two 8-week-old normal mice and conditional knockout mice were randomly divided into a control group (CON) and a diabetic nephropathy model group (DN). The normal control group consisted of 8 mice each of normal mice (WT-NC) and conditional knockout mice (CKO-NC), fed a standard diet and given sterile water. The diabetic nephropathy model group consisted of 8 mice each of normal mice (WT-DN) and conditional knockout mice (CKO-DN), fed a 60% high-fat diet and given sterile water. After four weeks of feeding the standard and high-fat diets, all mice underwent a 16-hour fasting period. DN mice received intraperitoneal injections of 0.1 M streptozotocin (STZ) dissolved in sodium citrate buffer for five consecutive days, while CON mice received the same dose of sodium citrate buffer. Three days after the injections, the mice were fasted for 16 hours, and fasting blood glucose levels were measured by collecting blood from the tail. A fasting blood glucose level ≥ 11.1 mmol / L was considered a successful establishment of the diabetic nephropathy model in mice. Mice that successfully developed the model were continued to be fed a high-fat diet to induce kidney disease (DN). Both groups of mice were weighed weekly, fasting blood glucose was measured via tail vein sampling every two weeks, and urine was collected every four weeks via metabolic cages. Blood samples were collected through the mouse's orbital cavity. After centrifugation at 7000 rpm for 7 minutes, serum was collected for detecting blood glucose, serum creatinine, and other indicators. Mice were euthanized, and the necessary tissues were collected. Serum, urine, and tissues were stored together in an ultra-low temperature freezer at -80°C, and kidney tissue was fixed and sectioned for subsequent experiments.

[0051] 2. Serum creatinine measurement See Example 1.

[0052] 3. Histopathological section staining analysis After dissection of the mice, a portion of the kidney tissue was taken and fixed by immersion in 40% formalin. Subsequent experimental steps, including dehydration, embedding, sectioning, and staining, were performed, and the resulting sections were examined under a microscope to observe the pathological condition of the tissue.

[0053] 4. Experimental Results By constructing conditional knockout mice with Gnai2 specifically knocked out in renal tubular epithelial cells, the relationship between Gnai2 and diabetic nephropathy (DN) was further verified. The results showed that the creatinine and blood urea nitrogen levels in conditional knockout DN mice were significantly lower than those in normal DN mice, alleviating kidney damage caused by hyperglycemia. Figure 5 (AB in the text). Furthermore, measurements of renal TG levels showed that the TG levels in conditional knockout DN mice were significantly lower than those in normal DN mice ( ). Figure 5(C) Kidney tissue from different groups was sectioned pathologically and stained for analysis. HE staining results showed that, compared with normal DN mice, the number of lipid droplets in the kidney tissue of conditionally knockout DN mice was reduced, and the inflammatory infiltration was alleviated. Compared with normal DN mice, the kidney tissue of conditionally knockout DN mice showed a reduction in collagen accumulation and mesangial matrix expansion, and the fibrosis in the kidney tissue of conditionally knockout DN mice was improved compared with that of normal DN mice. Figure 5 (D in the text). The above results indicate that the loss of Gnai2 in renal tubular epithelial cells improves renal function in DN mice.

[0054] In summary, in Example 1 of this invention, the expression of Gnai2 in the kidneys / serum of diabetic nephropathy patients and model mice was significantly increased using the publicly available Nephroseq database in combination with ELISA, Western blot, and immunofluorescence. This expression was positively correlated with urinary protein and creatinine levels and negatively correlated with eGFR, suggesting that Gnai2 levels can reflect disease severity and possess non-invasive monitoring potential. This establishes its clinical value as a novel biomarker for diabetic nephropathy and confirms that Gnai2 is mainly located in the proximal tubules of kidney tissue, with a small amount present on podocytes. In Example 2, Gnai2, LC3, and Bodipy were cross-stained with immunofluorescence on kidney tissue sections from DN mice, revealing a consistent trend between Gnai2 and lipophage changes. In Example 3, a Gnai2 knockout plasmid was constructed and transfected into HK-2 cells to study changes in lipophage under Gnai2 deficiency. The results showed that effective Gnai2 knockout increased lipophage levels, reversing high glucose-induced lipid deposition. This indicates that Gnai2 has a negative regulatory effect on lipophage. The absence of Gnai2 can activate intracellular lipophage function, thereby alleviating lipid accumulation caused by high glucose treatment. In Example 4, by constructing a Gnai2 overexpression plasmid, the introduction of the plasmid significantly increased Gnai2 levels and decreased lipophage levels, exacerbating high glucose-induced lipid deposition. The results show that Gnai2 activation downregulates lipophage levels in HK-2 cells. In Example 5, by constructing conditional knockout mice with Gnai2 specifically knocked out from renal tubular epithelial cells, the results showed that the creatinine and urea nitrogen levels in conditional knockout DN mice were significantly lower than those in normal DN mice, the number of lipid droplets was reduced, and inflammatory infiltration was alleviated, improving kidney damage caused by high glucose. The results indicate that the absence of Gnai2 in renal tubular epithelial cells improves renal function in DN mice.

[0055] These examples and analysis results provide a complete chain of molecular-cellular-animal-clinical evidence for Gnai2 as a novel target for targeted intervention in diabetic nephropathy.

[0056] The embodiments described above provide a detailed explanation of the technical solutions of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, additions, or similar substitutions made within the scope of the principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Use of a Gnai2 protein inhibitor in the preparation of a drug for treating diabetic nephropathy.

2. Use according to claim 1, characterized in that, The Gnai2 protein inhibitor is selected from a substance that inhibits the expression of a Gnai2 protein, a substance that inhibits the activity of a Gnai2 protein, or a substance that inhibits the expression of a Gnai2 gene; the nucleotide sequence of the coding gene of the Gnai2 protein is shown in NCBI Gene ID: 2771.

3. Use according to claim 1, characterized in that, The Gnai2 protein inhibitor is a recombinant plasmid that inhibits the expression of a Gnai2 gene, and the name is pLenti-Gnai2-sgRNA.

4. A drug for treating diabetic nephropathy, characterized in that, The component comprises a Gnai2 protein inhibitor.

5. The therapeutic agent for diabetic nephropathy according to claim 4, wherein The component further comprises a pharmaceutically acceptable excipient, which is prepared into a pharmaceutically acceptable dosage form.

6. The therapeutic agent for diabetic nephropathy according to claim 5, wherein The excipient is selected from one or more combinations of a buffering agent, a encapsulating agent, a filling agent, a binding agent, a transdermal absorption agent, a humectant, a disintegrating agent, an absorption promoting agent, a surfactant, a coloring agent, a flavoring agent, and an adsorption carrier.

7. Use of a Gnai2 protein as a drug target in screening a drug for treating diabetic nephropathy.

8. Use according to claim 7, characterized in that, The screened drug for treating diabetic nephropathy is a drug that can inhibit the expression of a Gnai2 gene, and is not for diagnostic or therapeutic purposes.

Images