Polyadenylation functional site marker related to auxiliary diagnosis of non-small cell lung cancer and application of polyadenylation functional site marker

Abstract

The invention discloses a polyadenylation functional site marker related to auxiliary diagnosis of non-small cell lung cancer and application of the polyadenylation functional site marker. The site is rs9606. Large-scale population data and biofunctional experiments prove that the rs9606 site affects the expression of the target gene LYRM4 by affecting the 3 'UTR length of the target gene LYRM4, and finally affects the risk of non-small cell lung cancer. According to the present invention, the rs9606 mutation detection can be performed on the normal population by using the real-time fluorescent quantitative PCR through the specific primer and probe design on the rs9606 site, such that the high risk population of the non-small cell lung cancer can be identified so as to assist the early screening and diagnosis of the non-small cell lung cancer patient. The technical method is reasonable in design, simple and feasible, detection can be carried out only by taking a venous blood sample of a patient, and invasive operation such as tissue biopsy is not needed. The method is accurate and reliable in result, can be popularized in hospitals at all levels, and is greatly helpful for evaluating the risk of non-small cell lung cancer.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering and tumor medicine, and in particular relates to a polyadenylation functional site marker related to auxiliary diagnosis of non-small cell lung cancer and its application. Background Art

[0002] Lung cancer, as one of the most common malignant tumors worldwide, consistently ranks first in cancer-related mortality, posing a serious threat to human health. According to the 2022 China Malignant Tumor Disease Burden Report released by the National Cancer Center, there were 1,060,600 new cases of lung cancer and 733,300 deaths in my country in 2022, making it the malignant tumor with the highest morbidity and mortality in my country. Non-small cell lung cancer, as the main subtype of lung cancer, accounts for approximately 85% of all lung cancer cases. Therefore, if screening and early diagnosis can be more accurately targeted at high-risk individuals for non-small cell lung cancer, it will be more acceptable to patients and save the country a significant amount of medical expenses.

[0003] Genetic factors play a significant role in the development and progression of non-small cell lung cancer (NSCLC). Single nucleotide polymorphisms (SNPs), the most prevalent form of genetic variation in the genome, are significantly associated with the pathogenesis of numerous complex, multifactorial diseases. Alternative polyadenylation (APA) refers to the selective alteration of the tailing signal during mRNA processing, resulting in transcripts with varying 3' untranslated region (3'UTR) lengths. APA-mediated 3'UTR length variation can regulate gene expression by altering mRNA stability, translation efficiency, and subcellular localization. APA dysregulation is closely associated with tumorigenesis and progression. Furthermore, a growing number of studies have revealed functional associations between genetic variation and APA regulation. Genetic variation may influence the APA process of target genes through various mechanisms, such as altering poly(A) signaling and affecting RBP binding, thereby further influencing disease susceptibility. Therefore, polyadenylation functional site markers can be used for the identification of individuals at high risk for NSCLC, early screening, and auxiliary diagnosis. Summary of the Invention

[0004] The present invention aims to provide a functional polyadenylation site marker associated with the auxiliary diagnosis of non-small cell lung cancer and its application. The site is rs9606. Large-scale population data and biofunctional experiments have confirmed that the rs9606 site affects the expression of the target gene LYRM4 by affecting its 3'UTR length, ultimately affecting the risk of non-small cell lung cancer.

[0005] This invention utilizes real-time fluorescence quantitative PCR to detect rs9606 mutations in healthy individuals by designing specific primers and probes for the rs9606 locus, thereby identifying individuals at high risk for non-small cell lung cancer (NSCLC) and assisting in the early screening and diagnosis of NSCLC patients. This method is rationally designed, simple, and feasible, requiring only a venous blood sample from the patient for testing, eliminating the need for invasive procedures such as tissue biopsies. The results are accurate and reliable, and can be replicated in hospitals at all levels, significantly contributing to the risk assessment of NSCLC.

[0006] In order to achieve the above objectives, this application adopts the following technical solutions:

[0007] In a first aspect, the present invention provides a use of a detection reagent for a polyadenylation functional site marker in the preparation of a non-small cell lung cancer auxiliary diagnosis kit or a biochip, wherein the polyadenylation functional site marker is rs9606.

[0008] In the above technical solution, the detection reagent is a specific amplification primer, the forward primer sequence is shown in SEQ ID NO: 1, and the reverse primer sequence is shown in SEQ ID NO: 2.

[0009] In the above technical solution, the detection reagent is a specific probe, the forward probe sequence of which is shown in SEQ ID NO: 3, and the reverse probe sequence is shown in SEQ ID NO: 4.

[0010] In a second aspect, the present invention provides a non-small cell lung cancer auxiliary diagnosis kit or biochip, wherein the kit or biochip comprises a reagent for detecting rs9606 in a patient's peripheral blood DNA.

[0011] In the above technical solution, the reagent is a specific amplification primer for rs9606, the forward primer sequence is shown in SEQ ID NO: 1, and the reverse primer sequence is shown in SEQ ID NO: 2.

[0012] In the above technical solution, the reagent is a specific probe for rs9606, the forward probe sequence of which is shown in SEQ ID NO: 3, and the reverse probe sequence is shown in SEQ ID NO: 4.

[0013] The beneficial effects of the present invention are as follows: from the molecular biology and gene diagnosis levels, the present invention provides a method for screening a high-risk group for non-small cell lung cancer. Studies have shown that the SNP site rs9606 is associated with the susceptibility to non-small cell lung cancer in the Chinese population. By designing specific primers and probes for the rs9606 site and relying on fluorescent quantitative PCR, the genetic variation of the rs9606 site can be detected in the normal population, thereby identifying the high-risk group for non-small cell lung cancer and assisting in the early screening and diagnosis of patients with non-small cell lung cancer. The technical method is rationally designed, simple and feasible, and only requires taking a venous blood sample from the patient for detection, without the need for invasive procedures such as tissue biopsy. The results are accurate and reliable, and can be promoted in hospitals at all levels. It is of great help in assessing the risk of non-small cell lung cancer and is helpful in clinical screening and early intervention for non-small cell lung cancer in this group of people. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 :Flowchart for screening of potential pathogenic SNP site rs9606 in non-small cell lung cancer;

[0015] Figure 2 : Figure 2 A is the 3'-RACE result in non-small cell lung cancer cell lines, Figure 2 B is the sequence alignment result of the amplified products;

[0016] Figure 3 : Figure 3 A shows the effect of different genotype transcripts corresponding to SNP site rs9606 on the proliferation ability of non-small cell lung cancer cells. Figure 3 B shows the effect of different genotype transcripts corresponding to SNP site rs9606 on the clone formation ability of non-small cell lung cancer cells. Figure 3 C shows the effect of transcripts with different genotypes corresponding to the SNP site rs9606 on the migration ability of non-small cell lung cancer cells. DETAILED DESCRIPTION

[0017] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. The present invention can be implemented in many different forms and should not be construed as limited to the embodiments set forth herein. On the contrary, these embodiments are provided so that this disclosure will be thorough and complete and will fully convey the concept of the present invention to those skilled in the art. The present invention will be limited only by the claims.

[0018] The present invention provides a method for preparing a non-small cell lung cancer auxiliary diagnosis kit or biochip by using a detection reagent for a polyadenylation functional site marker, wherein the polyadenylation functional site marker is rs9606.

[0019] The detection reagent is a specific amplification primer, the forward primer sequence of which is shown in SEQ ID NO: 1, and the reverse primer sequence is shown in SEQ ID NO: 2; or

[0020] The detection reagent is a specific probe, the forward probe sequence of which is shown in SEQ ID NO: 3, and the reverse probe sequence is shown in SEQ ID NO: 4.

[0021] The technical solution of the present invention includes: (1) establishing a specimen library and database with unified standards: collecting venous blood samples of subjects that meet the standards according to standard operating procedures, and systematically collecting complete demographic and clinical data.

[0022] (2) Genotype detection: Non-small cell lung cancer cases and healthy controls were selected to find functional site markers related to the incidence of non-small cell lung cancer in the Chinese population on the abnormal polyadenylation gene LYRM4.

[0023] (3) The positively associated functional site markers screened out are verified in an external independent sample cohort to determine the stability and effectiveness of their association.

[0024] (4) Development of auxiliary diagnostic kit for non-small cell lung cancer: Development of auxiliary diagnostic kit based on genetic functional site markers with significant differences in genotype distribution frequencies between non-small cell lung cancer cases and healthy controls.

[0025] Specifically, the experimental method of the present invention mainly includes the following contents:

[0026] For this study, we downloaded a European NSCLC genotype and phenotype dataset from the OncoArray Consortium Lung Cancer Research Project from the Database of Genotypes and Phenotypes (dbGaP), comprising 13,835 cases and 13,835 controls. Furthermore, we performed genotyping on 4509 NSCLC patients with complete medical records and clear genotypes, as well as 4509 normal controls from a Chinese population with no history of cancer. Both the NSCLC patients and normal controls were of Han Chinese descent. Patients were diagnosed by histopathology, with no age restrictions; normal controls had no history of cancer and no physical signs of tumors on physical examination. Each participant provided informed consent to participate in the study and donated 2 mL of peripheral venous blood for genomic DNA isolation. Table 1 contains basic information on the gender, age, and other characteristics of the European and Chinese subjects.

[0027] Table 1. European and Chinese non-small cell lung cancer patients and normal controls used in the study

[0028]

[0029] This study used an unconditional logistic regression additive model to calculate the association between the SNP site rs9606 and the susceptibility to non-small cell lung cancer, and adjusted for sex and age. The results showed that after adjusting for sex and age, in European and Chinese populations, each additional risk T allele increased the risk of non-small cell lung cancer by 9% (OR = 1.09, 95% CI: 1.06-1.13, P = 8.77×10 -8 ) and 21% (OR=1.21, 95% CI: 1.12-1.32, P=5.08×10 -6 The association results between rs9606 and the risk of non-small cell lung cancer are shown in Table 2.

[0030] Table 2. Results of association analysis between rs9606 and the risk of non-small cell lung cancer in European and Chinese populations

[0031]

[0032] To functionally analyze the association of rs9606 with non-small cell lung cancer risk, this study used APA quantitative trait loci (apaQTL) analysis to find that different alleles of this functional locus were significantly associated with the 3'UTR length of the target gene LYRM4. Subsequently, a 3' RACE assay (3' RACE assay) was used to confirm that overexpression of the rs9606 [T] risk allele promoted the use of proximal poly(A) tailing signals in two non-small cell lung cancer cell lines, shortening the 3' UTR length of LYRM4 and increasing the expression of short transcripts. The 3' RACE results in the two non-small cell lung cancer cell lines and Sanger sequencing were used to align and verify their products. Figure 2 .

[0033] To further explore the effect of LYRM4[T] or LYRM4[G] on the malignant phenotype of non-small cell lung cancer cells, this study overexpressed plasmids LYRM4[T] or LYRM4[G] corresponding to different alleles in A549 and H1299 non-small cell lung cancer cell lines. CCK-8 and clone formation assays were used to detect cell proliferation ability, and Transwell assays were used to detect cell migration ability. The results showed that the target gene LYRM4 plays a carcinogenic role in non-small cell lung cancer, and compared with LYRM4[G], overexpression of LYRM4[T] makes non-small cell lung cancer cells more proliferative and migratory. The results of CCK-8, clone formation and Transwell assays are shown in Figure 3 .

[0034] Combining these large-scale population data with biological functional experimental results suggests that the T risk allele at the rs9606 locus increases expression of the target gene LYRM4 by shortening its 3'UTR, promoting cancer cell proliferation and ultimately increasing the risk of non-small cell lung cancer in individuals. Therefore, rs9606 genotyping in the population can help identify high-risk individuals for non-small cell lung cancer and assist in the diagnosis of non-small cell lung cancer patients.

[0035] Experimental methods:

[0036] 1. DNA Extraction from Subjects' Venous Blood Samples

[0037] Peripheral blood DNA was extracted using the blood DNA extraction kit (Cat. No.: DC111) provided by Novozymes. The specific steps are as follows:

[0038] 1) Take 1 ml of anticoagulated whole blood and add 2 times the volume of blood sample to ACK Lysis Buffer. Centrifuge at 10,000 rpm for 1 min at room temperature. Immediately pour off the supernatant and fill up to 200 μL with PBS. Vortex and mix thoroughly before proceeding to the next step.

[0039] 2) Add 20 μL Proteinase K and 200 μL Buffer BCL to the treated blood sample, shake well, and heat at 56°C for 10 min.

[0040] 3) Add 200 μL of anhydrous ethanol to the solution treated in step 2 and shake to mix.

[0041] 4) Transfer the mixture to a FastPure gDNA Mini Columns adsorption column, centrifuge at 12,000 rpm for 1 min, carefully discard the filtrate, and place the adsorption column in a collection tube.

[0042] 5) Add 500 μL of Buffer WA (with anhydrous ethanol) to the adsorption column, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate.

[0043] 6) Add 700 μL of Buffer WB (with anhydrous ethanol), centrifuge at 12,000 rpm for 30 seconds, discard the filtrate, and repeat twice.

[0044] 7) Place the adsorption column into the collection tube, centrifuge the empty column at 12,000 rpm for 2 minutes, and leave it at room temperature with the lid open for 5 minutes.

[0045] 8) Place the adsorption column in a new 1.5 mL enzyme-free EP tube, add 50 μL of Elution Buffer, incubate at room temperature for 5 minutes, and then spin at 12,000 rpm for 1 minute.

[0046] 9) Discard the adsorption column and store the DNA product at -80°C.

[0047] 2. Genotyping

[0048] The typing platform used was TaqMan genotyping technology (ABI 7900HT Real Time PCR system, Applied Biosystems). The 5 μL PCR reaction system is shown in Table 3 below:

[0049] Table 3. TaqMan genotyping PCR reaction system

[0050]

[0051] The reaction conditions were: pre-denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min.

[0052] The primers and probes used in the reaction are as follows:

[0053] rs9606 primers:

[0054] Forward primer: AAGGCTATTGTAAGCTGGTTTTGG (SEQ ID NO: 1)

[0055] Reverse primer: CCACCTTCAGCATCCACTCTCT (SEQ ID NO: 2)

[0056] rs9606 probe:

[0057] Forward probe: fam-CCCCCAACTCAAA-mgb (SEQ ID NO: 3)

[0058] Reverse probe: vic-CCCCCATCTCAAA-mgb (SEQ ID NO: 4)

[0059] 3. cDNA 3' end rapid amplification experiment

[0060] The Novozymes HiScript-TS 5' / 3' RACE Kit (RA101-01) was used. The specific steps are as follows:

[0061] 1) First-strand cDNA synthesis

[0062] (1) Take out the components required for first-strand synthesis and thaw them on ice for later use.

[0063] (2) Prepare the reaction system according to Table 4, and then run the following program in a PCR instrument: 37°C for 3 minutes, then immediately place on ice for 2 minutes.

[0064] Table 4. Sample preparation reaction system

[0065]

[0066] (3) Prepare the reverse transcription reaction system according to Table 5, and then run the following program in a PCR instrument: 42°C for 90 min, 70°C for 15 min, and hold at 4°C.

[0067] Table 5. 3'-RACE reverse transcription reaction system

[0068]

[0069] (4) Take 10 μL of reverse transcription product and add 10 μL of Dilution Buffer for dilution. The remaining 10 μL of product is stored in a -20°C refrigerator for long-term storage. The resulting product is 3' RACE-Ready cDNA.

[0070] 2) Rapid amplification of 3' ends

[0071] (1) Take out the components required for PCR amplification reaction and thaw them on ice for later use.

[0072] (2) Prepare the PCR amplification reaction system according to Table 6:

[0073] Table 6. 3'-RACE amplification reaction system

[0074]

[0075] (3) Run the following program in the PCR instrument according to Table 7:

[0076] Table 7. 3'-RACE amplification reaction conditions

[0077]

[0078] 3) Nested PCR amplification

[0079] (1) Take 5 μL of the product from the previous PCR amplification and add it to 245 μL of RNase-free ddH2O. Vortex and mix thoroughly.

[0080] (2) Prepare the nested PCR amplification reaction system according to Table 8:

[0081] Table 8. Nested PCR amplification reaction system

[0082]

[0083] (3) Run the program in Table 2-11 again in the PCR instrument for amplification, and store the amplified product in a -20°C refrigerator.

[0084] 4) Agarose gel electrophoresis: Take 5-10 μL of the PCR reaction solution for electrophoresis to confirm the experimental amplification product.

[0085] 5) Sequencing analysis: Sequencing analysis is performed on possible target bands to further confirm the amplified products.

[0086] 4. Cell Proliferation Assay

[0087] 1) 24 hours after cells were transfected with different plasmids, they were digested into single cell suspension and the cells were counted.

[0088] 2) Dilute the cell suspension with culture medium to an appropriate concentration so that 100 μL of the suspension contains 2,000 cells.

[0089] 3) Pipette 100 μL of cell suspension, inoculate into four 96-well plates, and culture in an incubator.

[0090] 4) Prepare CCK8 detection solution at a ratio of serum-free culture medium to CCK8 reagent of 10:1 and mix thoroughly by pipetting.

[0091] 5) After the cells adhere, remove the culture medium from one 96-well plate and add 100 μL of the prepared CCK8 detection solution. Return the plate to the incubator and incubate for 1.5 hours. Then, measure the absorbance at 450 nm using a microplate reader and record it as 0 hours.

[0092] 6) After 24 h, 48 h, and 72 h, test the remaining three plates using the above method.

[0093] 7) Draw the cell proliferation curve of each group based on the recorded absorbance values.

[0094] 5. Clone Formation Assay

[0095] 1) 24 hours after cell transfection, digest the cells into single cell suspension and count them.

[0096] 2) Depending on the cell concentration, add 200 cells of the cell suspension to each well of a 6-well plate, add medium to 2 mL, and continue culturing for approximately 2 weeks.

[0097] 3) After the incubation period, the culture medium was aspirated and the cells were washed twice with PBS. 2 mL of 0.1% crystal violet solution prepared with methanol was then added to each well and the cells were allowed to stand at room temperature for 20 minutes for staining.

[0098] 4) After absorbing the crystal violet, rinse the plate repeatedly with pure water and dry it until clear colonies are visible.

[0099] 5) Take photos and record the number of clones.

[0100] 6. Transwell assay

[0101] 1) 24 hours after cell transfection with the plasmid, digest the cells into a single cell suspension, centrifuge, and resuspend in serum-free medium to an appropriate concentration.

[0102] 2) Take 2×10 4 The cell suspension was seeded in the upper chamber of Transwell, 500 μL of culture medium containing 20% ​​FBS was added to the lower chamber, and the cells were placed in an incubator and cultured for 24 h.

[0103] 3) After the incubation period, the chamber was removed and carefully washed twice with PBS, and then fixed and stained with 0.1% crystal violet solution prepared in methanol.

[0104] 4) Carefully rinse the chamber three times with PBS and carefully wipe off the unmigrated cells in the upper chamber with a cotton swab.

[0105] 5) Place the chamber back into the 24-well plate and take a photo under a microscope.

[0106] In summary, this study combined a large sample of case-control studies in the European population and found that rs9606 located in the 6p25.1 region has the most significant non-small cell lung cancer apaQTL effect value. At the same time, combined with the Chinese population non-small cell lung cancer risk association study, it was found that compared with rs9606[G] individuals, individuals carrying the rs9606[T] allele variant significantly increased the risk of non-small cell lung cancer. Functionally, rs9606[T] affects the variable polyadenylation process of the target gene LYRM4, resulting in a shortened 3'UTR, thereby increasing the stability of LYRM4mRNA, thereby promoting the proliferation of tumor cells. The specific process of screening for this pathogenic site is shown in Figure 1 Therefore, the rs9606 functional site located in the 3'UTR region of the LYRM4 gene is significantly associated with the risk of non-small cell lung cancer. Individuals carrying rs9606[T] can be considered as a high-risk group for non-small cell lung cancer. The discovery of this risk genetic variation site is expected to be applied clinically to assist in the early diagnosis of non-small cell lung cancer and the early detection of non-small cell lung cancer patients.

[0107] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will readily appreciate that other variations or modifications based on the above descriptions are possible. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. Use of a polyadenylation functional site-labeled detection reagent in the preparation of a non-small cell lung cancer auxiliary diagnosis kit or biochip, characterized in that: The polyadenylation functional site is marked as rs9606.

2. The application according to claim 1, characterized in that: The detection reagent is a specific amplification primer, the forward primer sequence of which is shown in SEQ ID NO: 1, and the reverse primer sequence is shown in SEQ ID NO:

2.

3. The application according to claim 1, characterized in that: The detection reagent is a specific probe, the forward probe sequence of which is shown in SEQ ID NO: 3, and the reverse probe sequence of which is shown in SEQ ID NO:

4.

4. A non-small cell lung cancer auxiliary diagnosis kit or biochip, characterized by: The kit or biochip contains reagents for detecting rs9606 in the patient's peripheral blood DNA.

5. The kit or biochip according to claim 4, characterized in that: The reagent is a specific amplification primer for rs9606, the forward primer sequence is shown in SEQ ID NO: 1, and the reverse primer sequence is shown in SEQ ID NO:

2.

6. The kit or biochip according to claim 4, characterized in that: The reagent is a specific probe for rs9606, the forward probe sequence of which is shown in SEQ ID NO: 3, and the reverse probe sequence of which is shown in SEQ ID NO: 4.

Images