Integrated nucleic acid detection system based on RCA-CRISPR / Cas12a and application

Abstract

The invention discloses an integrated nucleic acid detection system based on RCA-CRISPR / Cas12a and application of the integrated nucleic acid detection system. The detection system comprises an RCA-CRISPR / Cas12a system, a padlock probe and auxiliary DNA (deoxyribonucleic acid), the padlock probe comprises a target binding region and a Cas12a-crRNA recognition region, the Cas12a-crRNA recognition region corresponds to a crRNA sequence, and the Cas12a-crRNA recognition region comprises an auxiliary DNA (Deoxyribose Nucleic Acid) binding region; the auxiliary DNA comprises a padlock probe binding region and a target binding region, and the padlock probe binding region corresponds to the auxiliary DNA binding region of the padlock probe in sequence; and the two target binding regions correspond to the sequence of the target nucleic acid molecule. According to the invention, an RCA technology and a CRISPR / Cas12a system are coupled into a system, so that nucleic acid can be detected in a single-hole, high-sensitivity and ultra-fast manner; the specificity is high, and the pollution rate is low.

Description

Technical Field

[0001] The present invention belongs to the field of molecular diagnostic technology, and specifically relates to the establishment of a nucleic acid detection method based on the integration of CRISPR / Cas12a and RCA, which is independent of PAM sequence and reverse transcription process, and is used for single-hole high-sensitivity and ultra-fast detection of long-chain nucleic acids of viruses. Background Art

[0002] In recent years, respiratory infections such as coronavirus (COVID-19), influenza A virus (Inf A), and influenza B virus (Inf B) have frequently emerged, posing a significant challenge to global public health. Symptoms in infected individuals range from asymptomatic and mild discomfort to severe respiratory problems and even death. Given the similarities in symptoms and transmission routes among these viruses, early and accurate diagnosis is crucial for timely treatment and prevention. Although quantitative polymerase chain reaction (qPCR) remains the gold standard for nucleic acid detection, it relies on meticulous sample processing, expensive equipment, and specialized personnel in centralized laboratories. Therefore, the development of a diagnostic technology comparable to qPCR is urgent. Recently, technologies based on clustered regularly interspaced short palindromic repeats (CRISPR) and its associated proteins (Cas) offer new possibilities for nucleic acid detection. Among CRISPR-based diagnostic technologies, the most notable and highly discussed innovations are methods combining isothermal nucleic acid amplification with the CRISPR-Cas12a system. These methods have garnered widespread attention due to their isothermal properties, high sensitivity, and strong specificity. However, these methods all require a two-stage detection process: an initial stage of nucleic acid pre-amplification, followed by a CRISPR-Cas12a-mediated nucleic acid cleavage reaction. This phased operation inevitably increases the complexity of the detection process and prolongs the detection cycle. It is also important to note that the step-by-step operation requires opening the reaction tube and transferring liquids, which increases the risk of aerosol contamination and may cause false-positive results. Integrating the isothermal amplification system with the CRISPR-Cas12a system in the same tube presents a technical challenge: the cleavage activity of the CRISPR-Cas12a system may damage the nucleic acid amplification template or primers, which will affect amplification efficiency and detection sensitivity. Furthermore, target detection using the CRISPR-Cas12a system is susceptible to restrictions due to the protospacer adjacent motif (PAM) sequence, a limitation that has become a drawback of current CRISPR-Cas12a-based detection methods. It is also important to note that for RNA detection, most technologies based on the CRISPR-Cas12a system and isothermal amplification cannot avoid the reverse transcription process, which complicates the detection process. Summary of the Invention

[0003] The purpose of the present invention is to solve the problems of long time, high cost, separate operation and complex process for RNA detection based on CRISPR-Cas12a and isothermal amplification technology, and to provide a method for ultra-fast detection of viral RNA in a single well without dependence on reverse transcription process and PAM sequence.

[0004] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0005] An integrated nucleic acid detection system based on RCA-CRISPR / Cas12a, comprising: an RCA-CRISPR / Cas12a system, a 5'-phosphorylated padlock probe, and auxiliary DNA;

[0006] The 5'-phosphorylated padlock probe comprises two key regions, namely the target binding region and the Cas12a-crRNA recognition region, the Cas12a-crRNA recognition region corresponds to the crRNA sequence, wherein the Cas12a-crRNA recognition region comprises an auxiliary DNA binding region;

[0007] The auxiliary DNA comprises two key regions, namely the padlock probe binding region and the target binding region, and the padlock probe binding region corresponds to the auxiliary DNA binding region sequence of the padlock probe;

[0008] The target binding regions of the padlock probe and the helper DNA both correspond to the sequence of the target nucleic acid molecule.

[0009] The crRNA of the RCA-CRISPR / Cas12a system, that is, the crRNA structural sequence common to the Cas12a protein, corresponds to the Cas12a-crRNA recognition region sequence of the padlock.

[0010] The RCA reaction in the integrated nucleic acid detection system is coupled to the Cas12a cutting reaction as a system, without the step of system transfer or step-by-step reaction. Specifically, the reaction process mainly includes the formation of nucleic acid trimers, ligase connects the gap, and the polymerase starts primary RCA with the help of the 3' end of auxiliary DNA and a chain displacement reaction occurs. Cas12a-crRNA recognizes and cis-cuts primary RCA amplified products, and the cis-cut product can continue as a primer for triggering a new round of RCA, coupling cutting and amplification two reactions to form RCA cycles, and the continuously running RCA cycle can continuously activate the trans activity of Cas12a, causing Cas12a to continuously non-specifically cut the single-stranded DNA reporter gene labeled with a fluorophore quencher and release fluorescent signal, thereby greatly improving sensitivity. Because the RCA amplified product is single-stranded DNA, there is the feature of being recognized by the Cas12a-crRNA complex without PAM, and viral DNA or RNA is directly combined with padlock probe and auxiliary DNA, and the reaction is started by auxiliary DNA, so there is no reverse transcription process dependence. Realize visualization and integrated nucleic acid detection method without PAM sequence dependence and reverse transcription process dependence.

[0011] Preferably, the RCA-CRISPR / Cas12a system includes an ssDNA Reporter, the nucleic acid sequence of which is 5'-FAM-TTATT-BHQ1.

[0012] Preferably, the RCA-CRISPR / Cas12a system includes Cas12a protein or a Cas protein having a paralogous single-stranded DNA cleavage activity similar to that of Cas12a.

[0013] Preferably, the crRNA of the RCA-CRISPR / Cas12a system has a nucleic acid sequence of UAAUUUCUAAGUGUAGAUUGGACCAUGUGAUGAGAUUG;

[0014] The nucleic acid sequence of the padlock probe is one of the following:

[0015]

[0016] The nucleic acid sequence of the auxiliary DNA is one of the following:

[0017]

[0018] Preferably, the detection system further comprises reagents for RCA amplification and reagents for sample pretreatment.

[0019] Preferably, the nucleic acid detection system comprises:

[0020] RCA-CRISPR / Cas12a system: In a 20 μL total reaction system, the following mixtures are used: 100-800 μM dNTPs, 0-0.2 mg / mL BSA, 0.2-0.4 U / μL phi29 DNA polymerase, 0.4-1 U / μL PBCV-1 ligase or 7-30 U / μL T4 ligase, 3-8 nM Cas12a-crRNA complex, 1-5 μM ssDNA reporter, 0.25-2.25 μL T4 buffer, and 1-4 μL phi29 polymerase buffer.

[0021] The Cas12a-crRNA complex is prepared by incubating 2±0.5 μL of ddH2O, 1±0.5 μL of NE2.1 buffer, 1±0.5 μL of Cas12a at a concentration of 1±0.5 μM, and 1±0.5 μL of crRNA at a concentration of 1±0.5 μM at 37±5°C (10-30 min).

[0022] Sample pretreatment system: 2±0.5 μL of T4 buffer, 2±0.5 μL of padlock probe with a concentration of 100-1000 nM, 2±0.5 μL of auxiliary DNA with a concentration of 0.5-5 μM, 2±0.5 μL of sample and 2±0.5 μL of ddH2O.

[0023] The application of the nucleic acid detection system in non-diagnostic nucleic acid detection comprises the following steps:

[0024] (1) Mixing the sample with the padlock probe and auxiliary DNA for pretreatment;

[0025] (2) The pretreated sample was mixed with the RCA-CRISPR / Cas12a system and reacted at 37±5°C for 2.5 to 40 minutes. When irradiated with a blue light, yellow-green fluorescence indicated that the sample contained the target nucleic acid molecule, and no fluorescence indicated that the sample did not contain the target nucleic acid molecule.

[0026] Preferably, the pretreatment conditions in step (1) are denaturation at 95±5°C for 5 to 120 seconds and then cooling.

[0027] Preferably, the target nucleic acid molecule is a long-chain nucleic acid.

[0028] Preferably, the target nucleic acid molecule includes DNA or RNA of any one of SARS-CoV-2 virus, Influenza-A virus, and Influenza-B virus.

[0029] Preferably, the nucleic acid is as follows;

[0030]

[0031] The present invention uses auxiliary DNA obtained by engineering screening to initiate the reaction, and with the help of the cis activity of the CRISPR-Cas12a system and the padlock probe obtained by engineering screening, the single RCA is converted into an RCA cycle, and the trans activity of Cas12a is used to cut the ssDNA reporter to release the signal. The RCA amplicon recognized by Cas12a-crRNA in the present invention is single-stranded DNA, so there is no PAM sequence dependence. In the present invention, the viral RNA directly binds to the padlock probe and the auxiliary DNA, and the reaction is initiated by the auxiliary DNA, so there is no dependence on the reverse transcription process. The detection method couples the RCA technology with the CRISPR / Cas12a system into a system, which can detect RNA viruses such as SARS-CoV-2 in a single hole, with high sensitivity and ultra-fast detection; and has high specificity and low contamination rate.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] 1. The present invention couples RCA amplification and Cas12a cutting into a reaction system for reaction, without the need for other steps such as opening the lid and transferring, which can greatly reduce the problem of aerosol pollution.

[0034] 2. The reaction is simple to operate. After 2.5 to 40 minutes of reaction at 37°C, the reaction can be observed with the naked eye under a blue light. No large instruments or electrophoresis detection are required, which greatly shortens the detection time. Moreover, when detecting viral RNA with a concentration exceeding 10pM, it can be detected in just 2.5 minutes.

[0035] 3. The CRISPR / Cas12a-based cleavage reaction in the present invention eliminates the reliance on the PAM sequence of the detection target.

[0036] 4. The present invention eliminates the reliance on the reverse transcription process when detecting viral RNA.

[0037] 5. The detection method of the present invention is highly universal and is not only applicable to the detection of DNA, including long-chain DNA, but can also be widely applied to the detection of RNA virus nucleic acid. For example, it can be used to detect SARS-CoV-2 virus, various respiratory viruses (such as influenza A virus and influenza B virus), and other long-chain RNA viruses (such as Zika virus and norovirus). Detection of different DNA or RNA viruses can be achieved by simply replacing the corresponding primers. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the fluorescence picture obtained by taking pictures in Example 1.

[0039] Figure 240 min-RCA-CRISPR / Cas12a detection triggered by different concentrations of SARS-CoV-2 DNA in the present invention; Inset: Corresponding linear curve between the logarithm of fluorescence and the logarithm of target concentration.

[0040] Figure 3 40 min-RCA-CRISPR / Cas12a detection triggered by different concentrations of Influenza A DNA in the present invention; Inset: corresponding linear curve between the logarithm of fluorescence and the logarithm of target concentration.

[0041] Figure 4 40 min-RCA-CRISPR / Cas12a detection triggered by different concentrations of Influenza B DNA in the present invention; Inset: corresponding linear curve between the logarithm of fluorescence and the logarithm of target concentration.

[0042] Figure 5 Figure 40 min of RCA-CRISPR / Cas12a detection initiated by different concentrations of SARS-CoV-2 RNA. Inset: Corresponding linear curves between the logarithm of fluorescence and the logarithm of target concentration.

[0043] Figure 6 This is the 2.5min-RCA-CRISPR / Cas12a ultra-fast detection triggered by different concentrations of SARS-CoV-2 RNA in the present invention.

[0044] Figure 7 Fluorescence images obtained by taking photos of SARS-CoV-2 throat swab samples with different concentrations after 40 min of RCA-CRISPR / Cas12a detection in the present invention; Inset: Grayscale value measured after grayscale conversion of the fluorescence image using ImageJ.

[0045] Figure 8 Fluorescence images obtained by taking photos after 40 min-RCA-CRISPR / Cas12a detection of Influenza A throat swab samples with different concentrations in the present invention; Inset: Grayscale value measured after grayscale conversion of the fluorescence image using ImageJ.

[0046] Figure 9 Fluorescence images obtained by taking photos after 40 min-RCA-CRISPR / Cas12a detection of Influenza B throat swab samples with different concentrations in the present invention; Inset: Grayscale value measured after grayscale conversion of the fluorescence image using ImageJ.

[0047] Figure 10 Schematic diagram of the detection process of viral RNA in the present invention. DETAILED DESCRIPTION

[0048] The present invention will be further described in detail below with reference to the accompanying drawings in specific embodiments.

[0049] Unless otherwise specified, the reagents, methods and equipment used in the present invention are all conventional reagents, methods and equipment. Unless otherwise specified, the materials and reagents used in the present invention are all commercially available.

[0050] The T4 ligase was purchased from Sangon Biotech (Shanghai, China);

[0051] The Cas12a was purchased from New England Biolabs (Guangzhou, China);

[0052] The PBCV-1 ligase was purchased from Beyotime (Shanghai, China) or New England Biolabs (Guangzhou, China);

[0053] The phi29 polymerase was purchased from New England Biolabs (Guangzhou, China).

[0054] The nucleic acids involved are as follows;

[0055]

[0056] Example 1

[0057] The nucleic acid detection method based on the integration of CRISPR / Cas12a and RCA, which is independent of PAM sequence and reverse transcription process, is used to detect SARS-CoV-2 RNA with a final concentration of 0 or 10 pM in a 20 μL reaction. The method specifically comprises the following steps:

[0058] (1) Prepare the Cas12a-crRNA complex by incubating 2 μL of ddH2O, 1 μL of NE2.1 buffer, 1 μL of 1 μM Cas12a, and 1 μL of 1 μM crRNA at 37°C for 20 minutes. The amount of each component used can be adjusted according to the experimental consumption.

[0059] (2) See Figure 10, an RNA virus detection process, first, 2 μL of T4 buffer, 2 μL of 500nM SARS-CoV-2-Padlock, 2 μL of 1μM SARS-CoV-2-A DNA, 2 μL of sample and 2 μL of ddH2O are denatured at 95°C for about 60 seconds, cooled to room temperature for about 9 minutes, and then added to the RCA-CRISPR / Cas12a integrated nucleic acid detection system; the RCA-CRISPR / Cas12a integrated nucleic acid detection system, in a 20μL total reaction system: dNTP is 375μM, BSA is 0.1mg / mL, phi29 DNA polymerase is 0.25U / μL, PBCV ligase is 0.625U / μL, Cas12a-crRNA complex is 5nM, ssDNA reporter is 2μM, T4 buffer is 1μL, and phi29 polymerase buffer is 2μL.

[0060] (3) After mixing, incubate in a 37°C water bath for 20 min. Then, irradiate with a blue light and take photos with a mobile phone. Yellow-green fluorescence indicates the presence of the target sample, while no fluorescence indicates the absence of the target sample.

[0061] (4) See Figure 1 The sample on the left side of the figure is a sample containing SARS-CoV-2 RNA at a concentration of 10pM; the sample on the right side of the figure is a sample without SARS-CoV-2 RNA, which is a negative control.

[0062] Example 2

[0063] The nucleic acid detection method based on the integration of CRISPR / Cas12a and RCA, which is independent of PAM sequence and independent of reverse transcription process, is used to detect SARS-CoV-2 DNA with a final concentration of 0, 1fM, 10fM, 100fM, 1pM, and 10pM in a 20 μL reaction. The method specifically includes the following steps: (1) In this embodiment, the working conditions are the same as those in Example 1 (1).

[0064] (2) First, 2 μL of T4 buffer, 2 μL of 500 nM SARS-CoV-2-Padlock, 2 μL of 1 μM SARS-CoV-2-A DNA, 2 μL of sample and 2 μL of ddH2O were denatured at 95°C for about 60 seconds, cooled to room temperature for about 9 minutes, and then added to the RCA-CRISPR / Cas12a integrated nucleic acid detection system; the RCA-CRISPR / Cas12a integrated nucleic acid detection system, in a 20 μL total reaction system: dNTP is 375 μM, BSA is 0.1 mg / mL, phi29 DNA polymerase is 0.25 U / μL, T4 ligase is 15 U / μL, Cas12a-crRNA complex is 5 nM, ssDNA Reporter is 2 μM, T4 buffer is 1 μL, and phi29 polymerase buffer is 2 μL.

[0065] (3) After mixing, the reaction was first incubated in a 37°C water bath for 40 min due to the qPCR threshold. Subsequently, the reaction was terminated by heating at 70°C for 10 min. The final fluorescence intensity was measured using a qPCR instrument ( 96) to take measurements.

[0066] (4) See Figure 2 The fluorescence intensity was positively correlated with the concentration of SARS-CoV-2 DNA. Within the range of 1 fM to 10 pM, the logarithm of the SARS-CoV-2 DNA concentration was linearly correlated with the logarithm of the fluorescence signal. The calculated limit of detection for SARS-CoV-2 was 751 aM. The limit of detection was calculated based on the threshold value and the linear fit line. The threshold value was determined by the sum of the mean fluorescence intensity of the negative control and 3 times the standard deviation (mean intensity ± 3SD).

[0067] Example 3

[0068] The nucleic acid detection method based on the integration of CRISPR / Cas12a and RCA, which is independent of PAM sequence and reverse transcription process, is used to detect Influenza-A DNA with a final concentration of 0, 10 fM, 100 fM, 1 pM, and 10 pM in a 20 μL reaction. The method specifically comprises the following steps:

[0069] (1) In this embodiment, the working conditions are the same as those in Example 1(1);

[0070] (2) In this example, SARS-CoV-2-ADNA was replaced with Influenza-A-ADNA, and SARS-CoV-2-Padlock was replaced with Influenza-A-Padlock. Other working conditions were the same as in Example 2(2);

[0071] (3) In this embodiment, the working conditions are the same as those in embodiment 2(3);

[0072] (4) See Figure 3 Fluorescence intensity is positively correlated with Influenza-A DNA concentration. Within the range of 10 fM to 10 pM, the logarithm of the Influenza-A DNA concentration is linearly correlated with the logarithm of the fluorescence signal. The calculated limit of detection for Influenza-A is 3.7 fM. The limit of detection is calculated based on the linear fit line, with the threshold value determined by the sum of the mean fluorescence intensity of the negative control and three standard deviations (mean intensity ± 3SD).

[0073] Example 4

[0074] The nucleic acid detection method based on the integration of CRISPR / Cas12a and RCA, which is independent of PAM sequence and independent of reverse transcription process, was used to detect Influenza-B DNA with a final concentration of 0, 1fM, 10fM, 100fM, 1pM, and 10pM in a 20 μL reaction. The method specifically includes the following steps: (1) In this embodiment, the working conditions are the same as those in Example 1 (1);

[0075] (2) In this example, SARS-CoV-2-ADNA was replaced with Influenza-B-ADNA, and SARS-CoV-2-Padlock was replaced with Influenza-B-Padlock. Other working conditions were the same as in Example 2(2);

[0076] (3) In this embodiment, the working conditions are the same as those in embodiment 2(3);

[0077] (4) See Figure 4 Fluorescence intensity is positively correlated with Influenza-B DNA concentration. Within the range of 1 fM to 10 pM, the logarithm of the Influenza-B DNA concentration is linearly correlated with the logarithm of the fluorescence signal. The calculated limit of detection for Influenza-B is 863 aM. The limit of detection is calculated based on the linear fit line, with the threshold value determined by the sum of the mean fluorescence intensity of the negative control and three standard deviations (mean intensity ± 3SD).

[0078] Example 5

[0079] The nucleic acid detection method based on the integration of CRISPR / Cas12a and RCA, which is independent of PAM sequence and reverse transcription process, is used to detect SARS-CoV-2 RNA with a final concentration of 0, 1fM, 10fM, 100fM, 1pM, and 10pM in a 20 μL reaction. The method specifically comprises the following steps:

[0080] (1) In this embodiment, the working conditions are the same as those in Example 1(1);

[0081] (2) In this embodiment, the working conditions are the same as those in embodiment 1(2);

[0082] (3) In this embodiment, the working conditions are the same as those in embodiment 2(3);

[0083] (4) See Figure 5 The fluorescence intensity was positively correlated with the concentration of SARS-CoV-2 RNA. Within the range of 1 fM to 10 pM, the logarithm of the SARS-CoV-2 RNA concentration was linearly correlated with the logarithm of the fluorescence signal. The calculated limit of detection for SARS-CoV-2 was 964 aM. The limit of detection was calculated based on the threshold value and the linear fit line. The threshold value was determined by the sum of the mean fluorescence intensity of the negative control and 3 times the standard deviation (mean intensity ± 3SD).

[0084] Example 6

[0085] The nucleic acid detection method based on the integration of CRISPR / Cas12a and RCA, which is independent of PAM sequence and reverse transcription process, is used to detect SARS-CoV-2 RNA with a final concentration of 0, 50 pM, 100 pM, 1 nM, and 10 nM in a 20 μL reaction. The method specifically comprises the following steps:

[0086] (1) In this embodiment, the working conditions are the same as those in Example 1(1);

[0087] (2) In this embodiment, the working conditions are the same as those in embodiment 1(2);

[0088] (3) In this example, the reaction was incubated for 2.5 min, and other working conditions were the same as in Example 2(3);

[0089] (4) See Figure 6 , RCA-CRISPR / Cas12a detected SARS-CoV-2 RNA at concentrations of 50pM, 100pM, 1nM, and 10nM within 2.5min.

[0090] Example 7

[0091] The nucleic acid detection method based on the integration of CRISPR / Cas12a and RCA, which is independent of PAM sequence and reverse transcription process, is used to detect throat swab samples with a final concentration of 0, 1 fM, 10 fM, 100 fM, 1 pM, and 10 pM of SARS-CoV-2 gene in a 20 μL reaction. The method specifically comprises the following steps:

[0092] (1) One researcher prepared samples by adding different concentrations of SARS-CoV-2 genes to throat swab samples. The concentration range of the prepared samples was within the linear detection range of RCA-CRISPR / Cas12a. Another researcher used RCA-CRISPR / Cas12a to test these throat swab samples.

[0093] (2) In this embodiment, the working conditions are the same as those in embodiment 1 (1);

[0094] (3) In this embodiment, the working conditions are the same as those in embodiment 2 (2);

[0095] (4) In this embodiment, the working conditions are the same as those in embodiment 1(3);

[0096] (5) See Figure 7 The RCA-CRISPR / Cas12a assay accurately measured the concentration of the SARS-CoV-2 gene in SARS-CoV-2 throat swab samples, and the results were consistent with the preset concentration. Grayscale analysis using ImageJ confirmed that the fluorescence intensity visible to the naked eye was correctly aligned.

[0097] Example 8

[0098] The nucleic acid detection method based on the integration of CRISPR / Cas12a and RCA, which is independent of PAM sequence and reverse transcription process, is used to detect throat swab samples with a final concentration of Influenza-A gene of 0, 10 fM, 100 fM, 1 pM, and 10 pM in a 20 μL reaction. The method specifically comprises the following steps:

[0099] (1) One researcher prepared samples by adding different concentrations of the Influenza-A gene to throat swab samples. The concentration range of the prepared samples was within the linear detection range of RCA-CRISPR / Cas12a. Another researcher tested these throat swab samples using RCA-CRISPR / Cas12a.

[0100] (2) In this embodiment, the working conditions are the same as those in embodiment 1 (1);

[0101] (3) In this embodiment, the working conditions are the same as those in embodiment 3(2);

[0102] (4) In this embodiment, the working conditions are the same as those in embodiment 1(3);

[0103] (5) See Figure 8The RCA-CRISPR / Cas12a assay accurately measured the concentration of the Influenza-A gene in the Influenza-A throat swab sample, and the results were consistent with the pre-set concentration. Grayscale analysis using ImageJ confirmed the correct alignment of the fluorescence intensities visible to the naked eye.

[0104] Example 9

[0105] The nucleic acid detection method based on the integration of CRISPR / Cas12a and RCA, which is independent of PAM sequence and reverse transcription process, is used to detect throat swab samples with a final concentration of Influenza-B gene of 0, 1 fM, 10 fM, 100 fM, 1 pM, and 10 pM in a 20 μL reaction. The method specifically comprises the following steps:

[0106] (1) One researcher prepared samples by adding different concentrations of the Influenza-B gene to throat swab samples. The concentration range of the prepared samples was within the linear detection range of RCA-CRISPR / Cas12a. Another researcher tested these throat swab samples using RCA-CRISPR / Cas12a.

[0107] (2) In this embodiment, the working conditions are the same as those in embodiment 1 (1);

[0108] (3) In this embodiment, the working conditions are the same as those in embodiment 4 (2);

[0109] (4) In this embodiment, the working conditions are the same as those in embodiment 1(3);

[0110] (5) See Figure 9 The RCA-CRISPR / Cas12a assay accurately measured the concentration of the Influenza-B gene in the Influenza-B throat swab sample, and the results were consistent with the pre-set concentration. Grayscale analysis using ImageJ confirmed the correct alignment of the fluorescence intensities visible to the naked eye.

[0111] The implementation methods of the present invention are not limited to the above-mentioned embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. An integrated nucleic acid detection system based on RCA-CRISPR / Cas12a, characterized in that: The detection system comprises: an RCA-CRISPR / Cas12a system, a 5'-phosphorylated padlock probe, and auxiliary DNA; The 5'-phosphorylated padlock probe comprises two key regions, namely the target binding region and the Cas12a-crRNA recognition region, the Cas12a-crRNA recognition region corresponds to the crRNA sequence, wherein the Cas12a-crRNA recognition region comprises an auxiliary DNA binding region; The auxiliary DNA comprises two key regions, namely the padlock probe binding region and the target binding region, and the padlock probe binding region corresponds to the auxiliary DNA binding region sequence of the padlock probe; The target binding regions of the padlock probe and the helper DNA both correspond to the sequence of the target nucleic acid molecule.

2. The nucleic acid detection system according to claim 1, characterized in that The RCA-CRISPR / Cas12a system includes an ssDNA reporter, the nucleic acid sequence of which is 5'-FAM-TTATT-BHQ1.

3. The nucleic acid detection system according to claim 2, characterized in that The RCA-CRISPR / Cas12a system includes Cas12a protein or a Cas protein having a paralogous single-stranded DNA cleavage activity similar to that of Cas12a.

4. The nucleic acid detection system according to claim 3, characterized in that The crRNA of the RCA-CRISPR / Cas12a system has a nucleic acid sequence of UAAUUUCUAAGUGUAGAUUGGACCAUGUGAUGAG AUUG; The nucleic acid sequence of the padlock probe is one of the following: The nucleic acid sequence of the auxiliary DNA is one of the following:

5. The nucleic acid detection system according to claim 4, characterized in that The detection system also includes reagents for RC A amplification and reagents for sample pretreatment.

6. The nucleic acid detection system according to any one of claims 1 to 5, characterized in that: include: RCA-CRISPR / Cas12a system: In a 20 μL total reaction system, the following mixtures are used: 100-800 μM dNTPs, 0-0.2 mg / mL BSA, 0.2-0.4 U / μL phi29 DNA polymerase, 0.4-1 U / μL PBCV-1 ligase or 7-30 U / μL T4 ligase, 3-8 nM Cas12a-crRNA complex, 1-5 μM ssDNA reporter, 0.25-2.25 μL T4 buffer, and 1-4 μL phi29 polymerase buffer. The Cas12a-crRNA complex is prepared by incubating 2±0.5 μL of ddH2O, 1±0.5 μL of NE2.1 buffer, 1±0.5 μL of Cas12a at a concentration of 1±0.5 μM, and 1±0.5 μL of crRNA at a concentration of 1±0.5 μM at 37±5°C. Sample pretreatment system: 2±0.5 μL of T4 buffer, 2±0.5 μL of padlock probe with a concentration of 100-1000 nM, 2±0.5 μL of auxiliary DNA with a concentration of 0.5-5 μM, 2±0.5 μL of sample and 2±0.5 μL of ddH2O.

7. Use of the nucleic acid detection system according to any one of claims 1 to 6 in non-diagnostic nucleic acid detection, characterized in that: The steps include: (1) Mixing the sample with the padlock probe and auxiliary DNA for pretreatment; (2) The pretreated sample was mixed with the RCA-CRISPR / Cas12a system and reacted at 37±5°C for 2.5 to 40 minutes. When irradiated with a blue light, yellow-green fluorescence indicated that the sample contained the target nucleic acid molecule, and no fluorescence indicated that the sample did not contain the target nucleic acid molecule.

8. The use according to claim 7, characterized in that The pretreatment conditions of step (1) are denaturation at 95±5°C for 5 to 120 seconds and then cooling.

9. The use according to claim 6, characterized in that The target nucleic acid molecule is a long-chain nucleic acid.

10. The use according to any one of claims 7 to 9, characterized in that: The target nucleic acid molecule includes DNA or RNA of any one of SARS-CoV-2 virus, Influenza-A virus, and Influenza-B virus.

Images