Application of salvia miltiorrhiza-kudzu vine root vesicle-like nanoparticles

By extracting well-stable vesicle-like nanoparticles from the decoction of Salvia miltiorrhiza and Pueraria lobata, the difficulty in the application of the decoction of Salvia miltiorrhiza and Pueraria lobata in the treatment of abdominal aortic aneurysm was solved, and significant therapeutic effects and safety were achieved.

CN120695067AActive Publication Date: 2025-09-26QINGDAO UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511084803.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-04
Publication Date
2025-09-26
Estimated Expiration
2045-08-04

Smart Images

  • Figure CN120695067A_ABST
    Figure CN120695067A_ABST
Patent Text Reader

Abstract

The invention discloses application of salvia miltiorrhiza-kudzu vine root vesicle-like nanoparticles, and belongs to the technical field of biological medicines. Salvia miltiorrhiza-kudzu vine root vesicle-like nanoparticles (SPVLNs) are extracted and purified from a salvia miltiorrhiza-kudzu vine root decoction by adopting a differential ultra-high-speed centrifugation method, and the SPVLNs have good blood compatibility, so that when the SPVLNs are applied to treatment of abdominal aortic aneurysm, the SPVLNs can be used for treating abdominal aortic aneurysm, and the SPVLNs can be used for treating abdominal aortic aneurysm. The traditional Chinese medicine composition is capable of obviously relieving thickening of blood vessel walls, reducing infiltration cells of a middle artery membrane and an outer artery membrane, improving reduction and breakage of elastic fibers of the blood vessel walls, increasing extensibility of the elastic fibers of the blood vessel walls, reducing the content of tissue muscle fibers and collagenous fibers and reducing the fibrosis degree of the collagenous fibers; the pathological change, caused by Ang II, of the abdominal aorta of the mouse is obviously improved, and safety and non-toxicity are achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the application of salvia miltiorrhiza-kudzu root vesicle-like nanoparticles. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] Abdominal aortic aneurysm (AAA) is a vascular disease that seriously threatens the life and health of middle-aged and elderly people. Its pathological characteristics are mainly manifested by localized dilation of the abdominal aorta exceeding 50% of its normal diameter. Epidemiological survey data show that the prevalence of this disease in people over 55 years old is 2%-8%, and with the accelerated aging of the population, the clinical detection rate has shown a significant upward trend. It is worth noting that AAA has the characteristics of insidious development. About 80% of patients have no obvious clinical symptoms before the aneurysm ruptures. Once rupture occurs, even with emergency surgical intervention, the mortality rate is still as high as 65-85%, making it a clinical problem that needs to be solved urgently in the cardiovascular field. Therefore, AAA seriously endangers human health and survival, and the research and development of drugs to treat AAA is very important.

[0004] Traditional Chinese medicine (TCM) has long attracted attention for its multi-target synergistic therapeutic potential, chronic disease management, and low side effects. However, its complex composition and processing techniques have limited its further application. In recent years, self-assembled nanoparticles from TCM have become a hot topic of research. The active ingredients of TCM interact with each other to form nanostructures such as nanotubes, nanofibers, micelles, and vesicles, which facilitate drug efficacy. Natural nanoparticles have been discovered in many decoctions. For example, researchers have identified nanostructures in aqueous extracts of 60 single TCM herbs and 24 TCM compound formulas. These nanoparticles exhibit promising pharmacological effects, including anti-inflammatory, reparative, and immunomodulatory. These studies suggest that vesicle-like nanoparticles (SPVLNs) extracted from decoctions may represent a novel natural product and a promising candidate for new drug development. However, there are currently no reports of extracellular vesicles derived from Salvia miltiorrhiza and Pueraria lobata.

[0005] Furthermore, the oral dosage of Danshen-Kuang root decoction is large, its bitter taste is difficult to swallow, and its complex composition and strict storage conditions (-20°C) have hindered further research. Therefore, it remains unknown whether the extraction of vesicle-like nanoparticles from Danshen-Kuang root decoction is feasible, whether the extracted vesicle-like nanoparticles retain the original biological activity of the decoction, and whether the extracted vesicle-like nanoparticles have good stability.

[0006] Therefore, it is of great significance to provide a vesicle-like nanoparticle with good stability and guaranteed biological activity for the treatment of abdominal aortic aneurysm (AAA). Summary of the Invention

[0007] In order to address the deficiencies of the prior art, the present invention aims to provide an application of Danshen-Pueraria lobata vesicle-like nanoparticles. The present invention efficiently separates and purifies high-purity vesicle-like nanoparticles (SPVLNs) from Danshen-Pueraria lobata decoction, which can effectively delay the progression of abdominal aortic aneurysm when applied to abdominal aortic aneurysm.

[0008] The biomedical potential of plant vesicle-like nanoparticles (PVLNs) has garnered significant attention. In addition to small molecule chemical components, the co-decoction extract of Danshen and Puerariae Radix contains PVLNs with diameters ranging from 30 to 150 nm. These natural nanocarriers can carry active ingredients such as salvianolic acid B and daidzein, and possess unique advantages in crossing biological barriers and enabling targeted drug delivery. These findings provide important insights into the cross-species regulatory mechanisms of PVLNs and suggest that Danshen-Puerariae PVLNs may exert their therapeutic effects on abdominal aortic aneurysms through a synergistic "component-carrier" interaction.

[0009] The Danshen-Kuang root compound has the efficacy of promoting blood circulation and removing blood stasis, promoting new blood circulation, and is used to treat a variety of cardiovascular and cerebrovascular diseases. This invention provides a method for extracting vesicle-like nanoparticles from a Danshen-Kuang root decoction. The function of the extracted vesicle-like nanoparticles is studied in depth to explore their potential application in the treatment of abdominal aortic aneurysms.

[0010] The present invention provides a method for extracting vesicle-like nanoparticles from a decoction of Danshen and Puerariae Radix, evaluates their composition and safety, and further explores their protective effect on abdominal aortic aneurysms. The vesicle-like nanoparticles from the decoction of Danshen and Puerariae Radix in the present invention meet the generally recognized characteristics of vesicle-like nanoparticles, contain multiple lipid compounds and miRNA components, and exhibit good stability and biosafety. Treatment with vesicle-like nanoparticles from Danshen and Puerariae Radix improves Ang II-induced changes in the cellular structure of the abdominal aorta in mice, specifically by alleviating vascular wall thickening, reducing infiltrating cells in the arterial media and adventitia, improving the reduction and rupture of vascular wall elastic fibers, increasing the extensibility of vascular wall elastic fibers, reducing the content of tissue muscle fibers and collagen fibers, and reducing the degree of collagen fiber fibrosis. The present invention provides a theoretical basis and scientific basis for the treatment of abdominal aortic aneurysms with vesicle-like nanoparticles derived from a decoction of Danshen and Puerariae Radix.

[0011] In order to achieve the above object, the technical solution of the present invention is: In a first aspect, the present invention provides the use of Danshen-Pueraria root vesicle-like nanoparticles (SPVLNs) in the preparation of a drug for treating abdominal aortic aneurysm.

[0012] In one or more embodiments of the present invention, the average particle size of the Danshen-Kuanga vesicle-like nanoparticles is 50-200 nm, such as 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200. The average particle size is preferably 60-120 nm, more preferably 80-90 nm, and most preferably 88 nm. The particles exhibit a saucer-like structure, which is consistent with the size and morphology of exosomes.

[0013] The salvia miltiorrhiza-kudzu root vesicle-like nanoparticles are mostly membrane vesicles that are nearly circular or elliptical.

[0014] Compared with fresh SPVLNs, the SPVLNs of the Danshen-Pueraria lobata vesicle-like nanoparticles stored at -20°C for 3 months did not undergo significant changes in particle size and potential characteristics, showing good stability.

[0015] In one or more embodiments of the present invention, the components of the Danshen-Pueraria lobata vesicle-like nanoparticles include lipid compounds and microRNA.

[0016] The main components of lipid compounds in SPVLNs include: glycerides (TG, DG, etc.), sphingolipids (Cer, etc.), and glycerophospholipids (PC, PE, PG, etc.): among them, the SPH content accounts for 39.61%, the WE content accounts for 24.202%, and the PG content accounts for 17.216%.

[0017] SPVLNs contain a variety of microRNAs (miRNAs), of which 40 have expression levels >50. Among them, the miRNA with the highest expression level is gma-miR6300, accounting for 17%, followed by ptc-miR6478, whose expression level accounts for 4%.

[0018] In one or more embodiments of the present invention, the functions of preparing the drug for treating abdominal aortic aneurysm are any one or more of the following: (1) Inhibit vascular wall thickening; (2) Reduce the number of infiltrating cells in the arterial media and adventitia; (3) Improve the reduction and breakage of elastic fibers in the blood vessel wall; (4) Increase the stretchability of elastic fibers in the blood vessel wall; (5) Reduce the content of tissue muscle fibers and collagen fibers; (6) Reduce the degree of collagen fiber fibrosis.

[0019] In one or more embodiments of the present invention, a method for extracting Danshen-Kuanga vesicle-like nanoparticles comprises the following steps: (1) Preparation of Danshen-Pueraria decoction: adding water to Danshen slices and Pueraria decoction slices, decocting, filtering, repeating the steps of adding water, decocting, filtering, combining multiple decoctions, and concentrating; (2) centrifuging the Danshen-Kuanga root decoction in step (1) to obtain a supernatant, and subjecting the supernatant to multiple centrifugation treatments to obtain a pre-treatment supernatant; (3) centrifuging the pre-treatment supernatant obtained in step (2), discarding the supernatant, and obtaining a precipitate; (4) Resuspend the precipitate obtained in step (3) in sterile PBS and filter through a filter membrane.

[0020] In one or more embodiments of the present invention, in step (1), the mass ratio of Danshen decoction pieces to Pueraria decoction pieces is (0.9-1.1):(0.9-1.1), preferably 1:1, which is more conducive to fully exerting the effects of both.

[0021] In one or more embodiments of the present invention, in step (1), each time water is added, the amount of water used is 8-12 times the total mass of the Danshen decoction pieces and the Pueraria decoction pieces. For example, it can be 8 times, 9 times, 10 times, 11 times, 12 times, etc., and is preferably 10 times. The purpose of adding a large amount of water is to completely immerse the Danshen decoction pieces and the Pueraria decoction pieces, so as to better obtain the cooking liquid.

[0022] In one or more embodiments of the present invention, in step (1), 2-3 decoctions are combined. The first decoction mainly extracts water-soluble components (such as alkaloids, glycosides) and volatile components. Subsequent decoctions: by extending the contact time or changing the temperature, further extract fat-soluble components (such as volatile oils, resins) or components with dense structures (such as polysaccharides in rhizomes). Chemical analysis shows that a single decoction can only extract about 50%-70% of the active ingredients, while the second decoction can extract an additional 20%-30%. After three decoctions, the total extraction rate can reach more than 90%.

[0023] In one or more embodiments of the present invention, in step (1), the decoction temperature is 90-110°C, and boiling water is used for decoction. The decoction time for each time is 0.5-4 hours, such as 0.5 hours, 1 hour, 1.5 hours, 2 hours, 3 hours, 4 hours, etc., preferably 2-3 hours, and most preferably 2 hours. The medicinal materials of Danshen and Puerariae are hard in texture, and decoction is to fully extract the fat-soluble active ingredients (such as tanshinone and puerarin). Through preliminary experiments, 1 hour, 1.5 hours, 2 hours, and 3 hours were selected in the early stage. It was found that the decoctions of 2 hours and 3 hours had similar effects on improving cellular inflammation (macrophages, LPS stimulation, detection indicators: TNF-α, IL-6), and the efficacy was similar. Therefore, in the embodiment, decoction for 2 hours is preferred.

[0024] High-moisture environments are prone to the growth of bacteria and mold. Concentration reduces the water content of the liquid, extending its storage time at room temperature or in the refrigerator. Furthermore, some active ingredients (such as glycosides and alkaloids) are more stable in low-moisture environments, which can slow down oxidation or hydrolysis reactions. Therefore, concentration is necessary in step (1).

[0025] In one or more embodiments of the present invention, in step (2), a differential ultra-high speed centrifugation method is used for centrifugation. Specifically, the Danshen-Kuanga root decoction in step (1) is centrifuged to obtain a supernatant, which is centrifuged at 1000 g for 5-15 minutes. Furthermore, the supernatant obtained by centrifugation is centrifuged at 2000 g for 15-25 minutes, at 3000 g for 25-35 minutes, and at 10000 g for 50-70 minutes to obtain a pre-treated supernatant. Multiple centrifugations are performed to remove impurities step by step according to particle size.

[0026] In one or more embodiments of the present invention, low temperature conditions are adopted in both step (2) and step (3), and the low temperature is 3-8°C. The low temperature can well ensure the activity of the components extracted from the decoction.

[0027] In one or more embodiments of the present invention, in step (3), ultrahigh-speed centrifugation is performed at 150,000 g for 80-100 min.

[0028] In a second aspect, the present invention provides a pharmaceutical composition, the active ingredient of which comprises the Danshen-Pueraria lobata vesicle-like nanoparticles in the above application.

[0029] Preferably, it also includes a pharmaceutically acceptable carrier or excipient.

[0030] In a third aspect, the present invention provides a pharmaceutical preparation comprising the Danshen-Pueraria lobata vesicle-like nanoparticles used in the above application.

[0031] Preferably, it also includes a pharmaceutically acceptable carrier or excipient.

[0032] The pharmaceutical preparation is an oral preparation or an injection preparation, and the oral preparation includes one of tablets, capsules, solutions or suspensions.

[0033] The carriers used in the pharmaceutical composition of the present invention are common carriers available in the pharmaceutical field, including: binders for oral preparations, lubricants, disintegrants, solubilizers, diluents, stabilizers, suspending agents, pigments, and flavoring agents.

[0034] In a fourth aspect, the present invention provides a method for preventing and / or treating abdominal aortic aneurysm, comprising administering a therapeutically effective dose of the above-mentioned Danshen-Pueraria lobata vesicle-like nanoparticles, the above-mentioned pharmaceutical composition or the above-mentioned pharmaceutical preparation to a subject.

[0035] The subject is an animal, preferably a mammal, and most preferably a human, that has been the subject of treatment, observation, or experiment. A "therapeutically effective dose" is an amount that results in an improvement in any parameter or clinical symptom. The actual dose may vary from patient to patient and does not necessarily refer to a total amount that eliminates all symptoms of the disease and can be determined using methods known in the art.

[0036] One or more of the above technical solutions have the following advantages or beneficial effects: (1) The vesicle-like nanoparticles of Danshen-Kuanga root decoction prepared by the present invention can significantly alleviate the thickening of the vascular wall, reduce the infiltrating cells in the arterial media and adventitia, improve the reduction and breakage of vascular wall elastic fibers, increase the extensibility of vascular wall elastic fibers, reduce the content of tissue muscle fibers and collagen fibers, and reduce the degree of collagen fiber fibrosis when used to treat abdominal aortic aneurysm. It can significantly improve the pathological changes of the abdominal aorta of mice caused by Ang II and is safe and non-toxic.

[0037] (2) The present invention uses a differential ultracentrifugation method to extract and purify Danshen-Pueraria root vesicle-like nanoparticles from Danshen-Pueraria root decoction. This method is simple to operate, does not require special equipment, is green and pollution-free, and can extract a large amount of Danshen-Pueraria root (with an extraction rate of 55 mg / mL and a purity close to 100%) and its vesicle-like nanoparticles.

[0038] (3) The salvia miltiorrhiza-kudzu root vesicle-like nanoparticles extracted by the method provided by the present invention were characterized and found to have an average particle size of 88 nm. Transmission electron microscopy revealed that the nanoparticles were mostly round or elliptical membrane vesicles with a size ranging from 60 to 120 nm. Compared with fresh SPVLNs, SPVLNs stored at -20°C for 3 months showed no significant changes in particle size or potential characteristics, demonstrating good stability.

[0039] (4) The present invention sequenced the lipids and mRNA of the extracted Danshen-Kuang root vesicle-like nanoparticles to clarify the specific components and content of Danshen-Kuang root vesicle-like nanoparticles. The main components of lipid compounds in SPVLNs include: glycerides (TG, DG, etc.), sphingolipids (Cer, etc.), and glycerophospholipids (PC, PE, PG, etc.): among them, SPH content accounts for 39.61%, WE content accounts for 24.202%, and PG content accounts for 17.216%. SPVLNs contain multiple microRNAs (miRNAs), of which 40 have expression levels >50. Among them, the miRNA with the highest expression level is gma-miR6300, accounting for 17%, followed by ptc-miR6478, whose expression level accounts for 4%.

[0040] (5) The present invention conducted a safety evaluation on the extracted Danshen-Pueraria lobata vesicle-like nanoparticles, and the results of the hemolysis experiment confirmed that SPVLNs had good blood compatibility.

[0041] (6) The vesicle-like nanoparticles prepared from the decoction of Danshen and Puerariae Radix have aorta targeting. Comparison of drug distribution characteristics after oral and intravenous administration by in vivo fluorescence imaging of small animals shows that the drug has high targeting. Oral administration is conducive to maintaining local drug concentration in the aorta (optimal for 12 hours), while intravenous injection highlights the dynamic distribution of blood vessels and liver accumulation characteristics, providing a reference for optimizing drug delivery strategies.

[0042] (7) Compared with salvia miltiorrhiza vesicle-like nanoparticles (SVLNs) extracted from salvia miltiorrhiza decoction and kudzu root vesicle-like nanoparticles (PVLNs) extracted from kudzu root decoction, the results showed that salvia miltiorrhiza-kudzu root vesicle-like nanoparticles (SPVLNs) had a synergistic anti-inflammatory effect in vitro, and its effect was significantly better than that of salvia miltiorrhiza vesicle-like nanoparticles (SVLNs) and kudzu root vesicle-like nanoparticles (PVLNs) alone. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0044] Figure 1 The extraction and identification of SPVLNs of the present invention; wherein A is a flow chart of the extraction of SPVLNs by gradient centrifugation; B is the particle size, potential and particle concentration of SPVLNs; C is a transmission electron micrograph of SPVLNs; Figure 2 It is the identification diagram of the lipid compounds in SPVLNs; A is the percentage content diagram of the lipid compounds in SPVLNs; B is the bar graph of the content of the lipid compounds in SPVLNs; Figure 3 Figure 2 is a graph showing the identification of miRNA in SPVLNs; A is an agarose gel electrophoresis graph of RNA in SPVLNs; B is a graph showing the percentage of miRNA species in SPVLNs; Figure 4 This is the SPVLNs hemolysis experiment; A is the actual sample picture of the hemolysis experiment; B is the data comparison picture of the hemolysis experiment; Figure 5 For SPVLNs in ApoE - / - Fluorescence distribution in mouse aorta; Figure 6 For SPVLNs in ApoE - / - Fluorescence distribution in mouse liver, spleen, lung, and kidney; Figure 7 ApoE - / - Morphological characteristics of mouse abdominal aorta; A represents ApoE - / - AAA expansion in mice; B is the morphological image and quantitative analysis of the inhibition of abdominal aortic aneurysm by Danshen-Kuanga and its vesicle-like nanoparticles; C is the small animal echocardiography detection of abdominal aorta diameter and quantitative analysis; Figure 8 Improve ApoE for SP and SPVLNs - / - Changes in the fiber structure of the abdominal aorta of mice; A is ApoE - / - Histological staining of mouse abdominal aorta, scale bar is 200 μm; B is ApoE - / - H&E staining quantification of mouse abdominal aorta; C is ApoE - / - Quantification of VVG staining in mouse abdominal aorta; D is ApoE - / - Quantification of Masson staining of mouse abdominal aorta; E stands for ApoE - / - Quantification of SiriusRed staining of mouse abdominal aorta; Figure 9 In vitro anti-inflammatory experiments were conducted on Salvia miltiorrhiza vesicle-like nanoparticles (SVLNs), Pueraria lobata vesicle-like nanoparticles (PVLNs), and Salvia miltiorrhiza lobata vesicle-like nanoparticles (SPVLNs); among them, A is for detecting the anti-inflammatory factor TNF-α, and B is for detecting the anti-inflammatory factor IL-6.

[0045] Figure 10 This is the miRNA library adapter structure. DETAILED DESCRIPTION

[0046] Explanation of terms involved: SP: Salvia miltiorrhiza-Pueraria lobat decoction.

[0047] NPs: Nanoparticles.

[0048] VLNs: Vesicle-like nanoparticles.

[0049] SPVLNs: Salvia miltiorrhiza-Pueraria lobata vesicle-like nanoparticles.

[0050] SVLNs: Salvia miltiorrhiza vesicle-like nanoparticles.

[0051] PVLNs: Pueraria lobata vesicle-like nanoparticles.

[0052] TG: triglyceride.

[0053] DG: diacylglycerol.

[0054] Cer: Ceramide.

[0055] PC: phosphatidylcholine.

[0056] PE: phosphatidylethanolamine.

[0057] PG: Phosphatidylglycerol.

[0058] SPH: sphingomyelin.

[0059] WE: neutral lipids.

[0060] SPVLNsi.g.: oral administration or oral administration.

[0061] SPVLNsi.v.: tail vein injection.

[0062] The present invention provides a method for extracting Danshen-Pueraria root vesicle-like nanoparticles from a Danshen-Pueraria root decoction. The extracted Danshen-Pueraria root vesicle-like nanoparticles are further explored for composition, targeting, and application in the preparation of drugs for treating abdominal aortic aneurysms. Experiments have shown that the Danshen-Pueraria root vesicle-like nanoparticles obtained from the Danshen-Pueraria root decoction have a significant therapeutic effect on abdominal aortic aneurysms, are safe and non-toxic, and can be used to prepare drugs for preventing and treating abdominal aortic aneurysms.

[0063] In the present invention, unless otherwise specified, other test materials and instruments and equipment are conventional test materials in this field and can be purchased through commercial channels.

[0064] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0065] Experimental reagents and instruments: Experimental reagents and consumables: Danshen decoction pieces (Batch number: 240100791, Kangmei Pharmaceutical Co., Ltd.), Pueraria root decoction pieces (Batch number: 240100109, Kangmei Pharmaceutical Co., Ltd.), 25PC thick-walled tube, 3% uranyl acetate, agarose, ethidium bromide, ACQUITY UPLC CSH C18 reversed-phase column (packed with 1.7 μm, 130 Å pore size C18 bonded phase spherical silica particles), acetonitrile, isopropanol, methanol, QIAseq® miRNA Library Kit, NR1 cartridge (Guangding Biotechnology Co., Ltd., a dedicated accessory for Thermo Fisher NanoDrop One / OneC ultramicro-spectrophotometer, full name "NanoDrop One Cuvette Cartridge"), Nuclease-free water, VAHTS DNAClean Beads (purification and sorting magnetic beads), 4% paraformaldehyde, angiotensin II, ALZET Osmotic Pumps, Masson staining kit (Beijing Solebold Technology Co., Ltd., G1340), HE staining kit (Beijing Solebold Technology Co., Ltd., G1120), VVG staining kit (Shanghai Maokang Biotechnology Co., Ltd., MM1033), Oil Red O staining kit (Beijing Solebold Technology Co., Ltd., G1261), pipette, disposable pipette tip, ApoE - / - (Male, 6 weeks old, 20-25 g, purchased from Jinan Pengyue Experimental Animal Breeding Co., Ltd.).

[0066] Experimental instruments: electronic balance, rotary evaporator, transmission electron microscope, low-temperature high-speed centrifuge, low-temperature ultracentrifuge, nano-Coulter particle size analyzer, ultra-high performance liquid chromatography, Q-Exactive Plus mass spectrometer, biological safety cabinet, Quantus Fluorometer, fully automatic nucleic acid and protein analysis system, PCR instrument, UV spectrophotometer, small animal living three-dimensional imaging system, high-frequency small animal ultrasound imaging system, electronic balance, -80℃ refrigerator, biological tissue slicer, frozen slicer, panoramic tissue scanner, gas anesthesia machine.

[0067] Example 1 Preparation of Danshen-Kuanga root decoction: Take 500g of Danshen slices and 500g of Pueraria slices, add 10% distilled water, and boil for 2 hours (boiling in boiling water). Filter. Add the residue to 10% distilled water again, boil for 2 hours, and filter. Add the residue to 10% distilled water again, boil for 2 hours, and filter. Combine the three decoctions, continue concentrating to 1.5L, and store at -20°C until needed.

[0068] Isolation and extraction of Danshen-Pueraria lobata vesicle-like nanoparticles: Take 220 mL of Danshen-Kuanggen decoction, (1) centrifuge at 1000 g for 10 min at 4°C using a low-temperature high-speed centrifuge; take the supernatant and centrifuge at 2000 g for 20 min; take the supernatant and centrifuge at 3000 g for 30 min; take the supernatant and centrifuge at 10,000 g for 60 min to obtain the pre-treatment supernatant; (2) place the pre-treatment supernatant in a centrifuge tube equipped with an ultracentrifuge and centrifuge at 150,000 g for 90 min at 4°C using a low-temperature ultracentrifuge. Discard the supernatant, resuspend the precipitate in 1.5 mL of sterile PBS, and filter (0.22 μm) to obtain SPVLNs (with an extraction yield of 55 mg / mL and a purity close to 100%). Use fresh or store at -80°C until further use.

[0069] Comparative Example 1 Preparation of Danshen decoction: Take 500g of Danshen slices, add 10x distilled water, and boil for 2 hours (in boiling water). Filter. Add 10x distilled water to the residue again, boil for 2 hours, and filter. Add 10x distilled water to the residue again, boil for 2 hours, and filter. Combine the three decoctions, continue concentrating to 1.5L, and store at -20°C until needed.

[0070] Separation and extraction of Danshen vesicle-like nanoparticles: Take 220 mL of Danshen decoction, (1) centrifuge at 1000 g for 10 min at 4°C using a low-temperature high-speed centrifuge; take the supernatant and centrifuge at 2000 g for 20 min; take the supernatant and centrifuge at 3000 g for 30 min; take the supernatant and centrifuge at 10000 g for 60 min to obtain the pre-treatment supernatant; (2) place the pre-treatment supernatant in a centrifuge tube equipped with an ultracentrifuge and centrifuge at 150000 g for 90 min at 4°C using a low-temperature ultracentrifuge. Discard the supernatant, resuspend the precipitate with 1.5 mL of sterile PBS, and filter (0.22 μm) to obtain Danshen vesicle-like nanoparticles.

[0071] Comparative Example 2 Preparation of Pueraria root decoction: Take 500g of Pueraria root slices, add 10 times distilled water, decoct for 2 hours (decoction in boiling water), and filter. Add 10 times distilled water to the residue again, decoct for 2 hours, and filter. Add 10 times distilled water to the residue again, decoct for 2 hours, and filter. Combine the three decoctions, continue concentrating to 1.5L, and store at -20°C for later use. Isolation and Extraction of Pueraria Root Vesicle-Like Nanoparticles: Take 220 mL of Pueraria root decoction, (1) centrifuge at 1000 g for 10 min at 4°C using a low-temperature high-speed centrifuge; take the supernatant and centrifuge at 2000 g for 20 min; take the supernatant and centrifuge at 3000 g for 30 min; take the supernatant and centrifuge at 10000 g for 60 min to obtain the pre-treatment supernatant; (2) place the pre-treatment supernatant in a centrifuge tube equipped with an ultracentrifuge and centrifuge at 150000 g for 90 min at 4°C using a low-temperature ultracentrifuge. Discard the supernatant, resuspend the precipitate in 1.5 mL of sterile PBS, and filter (0.22 μm) to obtain Pueraria root vesicle-like nanoparticles.

[0072] Example 2 The morphology of the Danshen-Pueraria lobata vesicle-like nanoparticles extracted in Example 1 was characterized.

[0073] RPS determination of Danshen-Kuanga vesicle-like nanoparticles: Following the instrument test operating instructions, after the instrument system was clean and free of particle contamination, the SPVLNs were diluted 3000-fold with PBS to the optimal detection range. 200 μL of the test solution was added to the sample well of the test card. A NanoCoulter counter equipped with a nanopore chip with a measurement range of 60-200 nm was used to measure and calculate the concentration, particle size distribution, and zeta potential of the SPVLN sample using NanoCoulter software.

[0074] TEM observation of Danshen-Pueraria lobata vesicle-like nanoparticles: The size and morphology of SPVLNs were examined by transmission electron microscopy. SPVLNs were deposited on carbon-coated copper grids and fixed with 3% uranyl acetate for 1–10 minutes. After blotting with filter paper and air-drying at room temperature, transmission electron microscopy imaging was performed at an accelerating voltage of 80 kV.

[0075] Example 3 The components of the Danshen-Pueraria lobata vesicle-like nanoparticles extracted in Example 1 were analyzed.

[0076] 1. Lipid composition analysis 1) Sample preprocessing method Take an appropriate amount of sample, add 200L water, vortex with MP, add 800μL MTBE, vortex mix, add 240μL pre-cooled methanol, vortex mix, sonicate in a low-temperature water bath for 20min, place at room temperature for 30min, centrifuge at 14000g and 10℃ for 15min, take the upper organic phase, blow dry with nitrogen, add 200μL 90% isopropanol acetonitrile solution to dissolve it for mass spectrometry analysis, vortex thoroughly, take 90mL of the reconstituted solution, centrifuge at 14000g and 10℃ for 15min, and take the supernatant for analysis.

[0077] 2) Chromatography-mass spectrometry analysis A. Chromatographic Conditions Samples were separated using a UHPLC NexeraL C-30A ultra-high performance liquid chromatography system. A C18 column was used at a column temperature of 45°C and a flow rate of 300 μL / min. The mobile phases consisted of: A: acetonitrile in water (acetonitrile:water = 6:4, v / v) + 0.1% formic acid + 0.1 mM ammonium formate; B: acetonitrile in isopropanol (acetonitrile:isopropanol = 1:9, v / v) + 0.1% formic acid + 0.1 mM ammonium formate. The gradient elution program was as follows: 0–3.5 min, B maintained at 40%; 3.5–13 min, B linearly ramped from 40% to 75%; 13–19 min, B linearly ramped from 75% to 99%; and 19–24 min, B maintained at 40%. Samples were maintained in an autosampler at 10°C throughout the analysis. To minimize the influence of instrument signal fluctuations, samples were analyzed sequentially in random order.

[0078] B. Mass Spectrometry Conditions Electrospray ionization (ESI) detection was performed in both positive and negative ion modes. Samples were separated by ultrahigh-performance liquid chromatography (UHPLC) and analyzed by mass spectrometry on a QExactive series mass spectrometer (Thermo Scientific® M). ESI source conditions were as follows: Heater Temp 300°C, Sheath Gas Flow Rate 45 arb, Aux Gas Flow Rate 15 arb, Sweep Gas Flow Rate 1 arb, spray voltage 3.0 kV, Capillary Temp 350°C, S-Lens RF Level 50%. MS1 scan range: 200–1800 mass-to-charge ratios of lipid molecules and lipid fragments. Each full scan (fμLscan) was followed by 10 fragmentation spectra (MS2scan, HCD). Resolution was 70,000 for MS1 at m / z 200, and 17,500 for MS2 at m / z 200.

[0079] C. Data Analysis Process LipidSearch was used to perform peak identification, peak extraction, and lipid identification (secondary identification) of lipid molecules and internal standard lipid molecules. Key parameters were: precursor tolerance: 5 ppm, product tolerance: 5 ppm, and production threshold: 5%. Data extracted by LipidSearch were first quality-assessed and then analyzed.

[0080] 2. RNA agarose gel electrophoresis 1) Prepare agarose gel: Weigh 0.5g of agarose and place it in a clean 100mL Erlenmeyer flask. Add 40mL of distilled water and microwave until the agarose dissolves thoroughly. Allow the gel to cool to 60-70°C. Then, add 9mL of formaldehyde, 5mL of 10× MOPS buffer, and 0.5μL of ethidium bromide, sequentially, and mix thoroughly. Cast the agarose gel and add 1× TAE electrophoresis buffer until the gel is covered.

[0081] 2) Sample Preparation: To a DEPC-treated 500μL microcentrifuge tube, add the following reagents in order: 2μL 10× MOPS buffer, 3.5μL formaldehyde, 10μL formamide (deionized), and 4.5μL RNA sample, and mix thoroughly. Place the microcentrifuge tube in a 60°C water bath for 10 minutes, then place on ice for 2 minutes. Add 3μL of loading dye to the tube and mix thoroughly.

[0082] 3) Sample Loading: On a clean bench, pipette 4 μL of total RNA sample onto the sealing film. Add 5 μL of 1× TAE electrophoresis buffer and 1 μL of 10× loading buffer to the sample well. Mix thoroughly and carefully add the sample to the sample well.

[0083] 4) Electrophoresis: Turn on the power switch and adjust the voltage to 100V to allow the RNA to electrophoresed from the negative electrode to the positive electrode. After approximately 30 minutes, place the gel in EB stain solution for 5 minutes and rinse briefly with water. Observe the RNA electrophoresis results on a UV-transmitter.

[0084] 3. microRNA sequencing 1) Experimental process RNA extraction 1.700 μL RNA lysis buffer was added to SPVLNs and placed at room temperature for 5 minutes.

[0085] 2. Add 140 μL of chloroform and vortex mix for 15 seconds.

[0086] 3. Incubate at room temperature for 3 minutes, then centrifuge at 4°C, 12,000 g for 15 minutes (pre-cool the centrifuge and return to room temperature immediately after this step).

[0087] 4. Transfer the upper aqueous phase to a new EP tube (avoid aspirating the middle phase), add 1.5 times the volume of anhydrous ethanol (usually 525µL), and mix by pipetting.

[0088] 5. Pipette 700 µL of the mixture (including any precipitate) and transfer it to an RNeasy column. Centrifuge at 8000 g for 15 seconds at room temperature. Discard the filtrate (reuse the collection tube, similarly below) and repeat this step with the remaining mixture.

[0089] 6. Add 700 μL of Buffer RWT to wash the adsorption column. Centrifuge at 8000 g for 15 seconds at room temperature and discard the filtrate.

[0090] 7. Add 500 μL of Buffer RPE to wash the column, centrifuge at 8000 g for 15 seconds at room temperature, and discard the filtrate.

[0091] 8. Add 500 μL of Buffer RPE to wash the adsorption column. Centrifuge at 8000 g for 2 min at room temperature. Discard the filtrate and collection tube (carefully remove the column to avoid touching the filtrate and residual alcohol).

[0092] 9. Transfer the adsorption column to a new 2 mL centrifuge tube (self-prepared), centrifuge at 12000g for 1 min to dry, and discard the filtrate and collection tube.

[0093] 10. Transfer the adsorption column to a new 1.5 mL centrifuge tube, add 30 μL of RNase-free water to the center of the adsorption membrane, and centrifuge at 8000 g for 1 min to elute the RNA.

[0094] 11. Immediately transfer to a -80℃ freezer for storage.

[0095] RNA concentration determination 1 μL of the extracted RNA was taken out for staining, and the RNA concentration was measured on a Quantus Fluorometer.

[0096] RNAQsep100 assay According to the RNA concentration, take an appropriate amount of RNA stock solution and dilute it with the NR1 card holder matching diluent, and then test it on the instrument after dilution.

[0097] 3' Adaptor ligation Prepare the following reaction system in a PCR tube: Table 1

[0098] After mixing, perform the following reaction in a PCR instrument: Table 2

[0099] After the reaction is completed, proceed to the next step immediately.

[0100] 5' Adaptor ligation In each PCR tube of the upstream reaction, add the following reaction system: Table 3

[0101] After mixing, perform the following reaction in a PCR instrument: Table 4

[0102] After the reaction is completed, proceed to the next step immediately.

[0103] cDNA synthesis In each PCR tube of the upstream reaction, add the following reaction system: Table 5

[0104] After mixing, perform the following reaction in a PCR instrument: Table 6

[0105] After the above reaction is completed, add the following reaction system to each PCR tube: Table 7

[0106] After mixing, perform the following reaction in a PCR instrument: Table 8

[0107] cDNA purification: 1. Add 143 μL of QMNBeads to the reverse transcription product, vortex mix for 3 seconds, centrifuge briefly, and incubate at room temperature for 5 minutes.

[0108] 2. After centrifugation, place the tube on a magnetic rack. After the magnetic beads are completely adsorbed, carefully remove the supernatant.

[0109] 3. Add 200µL of freshly prepared 80% ethanol, taking care not to disturb the beads. Immediately and carefully remove the supernatant, and repeat once.

[0110] 4. Absorb all residual liquid and dry with the lid open for 10 minutes.

[0111] 5. Remove the centrifuge tube, add 17µL NF-Water to cover the magnetic beads, pipette to mix, and incubate at room temperature for 2 minutes.

[0112] 6. After a brief centrifugation, place the centrifuge tube on a magnetic rack. After the magnetic beads are completely adsorbed, carefully transfer 15µL of the supernatant to a new centrifuge tube. This is the purified cDNA, which can be frozen at -20°C.

[0113] Library amplification Prepare the following reaction system in a PCR tube: Table 9

[0114] After mixing, perform the following reaction in a PCR instrument: Table 10

[0115] After the reaction is completed, the cells are taken out and library sorting is performed or stored at -20°C.

[0116] Library sorting 1. Take 75 μL of amplified product and add 75 μL of QMNBeads, vortex mix for 3 seconds, centrifuge briefly, and incubate at room temperature for 5 minutes.

[0117] 2. After centrifugation, place the tube on a magnetic rack. After the magnetic beads are completely adsorbed, transfer 145 μL of the supernatant to a new centrifuge tube.

[0118] 3. Take 130 μL of QMNBeads and the supernatant and vortex mix for 3 seconds. Centrifuge briefly and incubate at room temperature for 5 minutes.

[0119] 4. After centrifugation, place the tube on a magnetic rack. After the magnetic beads are completely adsorbed, carefully remove the supernatant.

[0120] 5. Add 200µL of freshly prepared 80% ethanol, taking care not to disturb the beads. Immediately and carefully remove the supernatant, and repeat once.

[0121] 6. Absorb all residual liquid and dry with the lid open for 10 minutes.

[0122] 7. Remove the centrifuge tube, add 17µL NF-Water to cover the magnetic beads, pipette to mix, and incubate at room temperature for 2 minutes.

[0123] 8. After a brief centrifugation, place the centrifuge tube on a magnetic rack. After the magnetic beads are completely adsorbed, carefully transfer 15µL of the supernatant to a new centrifuge tube. This is the miRNA library.

[0124] 9. Take an appropriate amount of miRNA library for concentration and fragment size detection, and store the remaining at -20℃.

[0125] miRNA library adapters Refer to the instructions, the miRNA library adapter structure is as follows Figure 10 As shown, the linker sequence is AACTGTAGGCACCATCAATNNNNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC, which is described as follows: The sequence of miRNA is shown in SEQ ID NO. 1: TAGCTTATCAGACTGATGTTGA; The sequence of the Qiagen adapter is shown in SEQ ID NO. 2: AACTGTAGGCACCATCAAT; The sequence of the Illumina adapter sequence is shown in SEQ ID NO. 3: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC.

[0126] 2) Data Analysis The small RNA sequencing library was sequenced using the PE150 protocol, and the quality of the sequencing library was assessed using fastqc. Fastp was used to remove N bases at both ends of the sequence, filter Q20, and remove the adapter. The clean sequence was aligned with the Rfam library using the bowtie short sequence alignment tool to remove nCRNAs such as rRNA and tRNA. Bowtie is then used to align the sequences to the genome. For non-model species, the miRbase database does not contain their small RNA sequences. Therefore, all small RNAs in the miRbase database are used as a reference for quantitative analysis of possible small RNAs in the sample (plant species are compared with all plant species, animal species are compared with all animal species, and other species are compared with all species). Simultaneously, a literature review is conducted. MiRNAs identified in the miRbase database are combined and retained as a single record based on complete sequence and expression level consistency. Small RNAs are assigned ID numbers in order of expression based on sequence uniqueness. The corresponding miRNA families are then searched in the miRbase database.

[0127] Example 4 Safety evaluation of the Danshen-Kuanga vesicle-like nanoparticles (SPVLNs) extracted in Example 1 A hemolysis test was performed to evaluate the potential effect of SPVLNs on red blood cells (RBCs) to determine whether their biocompatibility was good. - / - Blood samples were collected from mice and collected into tubes containing sodium heparin. The blood was then centrifuged at 2500 rpm for 5 minutes, washed three times with normal saline until the supernatant was colorless, and then diluted 50-fold with normal saline. 500 μL of red blood cell suspension was mixed with 500 μL of SPVLNs solutions of varying concentrations to prepare final concentrations of 10, 20, 30, 50, and 100 μg / mL. For the positive control tube, 500 μL of H2O was added to 500 μL of red blood cell suspension. For the negative control tube, 500 μL of red blood cell suspension was added to 500 μL of normal saline. All centrifuge tubes were incubated at 37°C for 1 hour and 3 hours, and their hemolysis was observed and photographed according to grouping. The tubes were then centrifuged at 2500 rpm for 3 minutes, the supernatant removed, and placed in a 96-well plate. The absorbance at 541 nm was measured using a microplate reader.

[0128] Example 5 ApoE - / -Construction of mouse abdominal aortic aneurysm model 1. Animal grouping 30 6-week-old ApoE - / - The mice were adaptively housed for two weeks and randomly divided into five groups (n=6): Table 11

[0129] 2. Construction of abdominal aortic aneurysm model (1) Twenty-four 8-week-old mice were randomly selected and divided into four groups. After 2 weeks of high-fat diet intervention, an abdominal aortic aneurysm (AAA) model was established. Surgical instruments and consumables such as EP tubes were sterilized with high-pressure steam (121°C, 30 min) before the experiment. The average body weight of mice in each group was measured using a precision electronic balance (accuracy 0.1 mg). The total dose required for each group was calculated based on an AngⅡ infusion rate of 1.44 mg / kg / d × 28 days. Referring to the technical parameters of the Alzet micro-osmotic pump (Model 2004, flow rate 0.25 μL / h), the theoretical total output volume for 28 days was 168 μL. Considering the operating loss, a 5% margin was added, and the final solution was prepared at 175 μL / mouse.

[0130] (2) Preparation of Ang II solution. Accurately weigh the calculated amount of Ang II powder into a sterile EP tube and add sterile saline to prepare a working concentration solution (the final concentration is calculated based on body weight). Use a 200 μL pipette to accurately measure 175 μL of solution and inject it into the EP tube. Slowly infuse it into the osmotic pump reservoir via a 1 mL sterile syringe, taking care to eliminate gas interference. The prepared osmotic pump is placed in sterile saline at 37°C for 24 hours for standby use.

[0131] (3) Surgical implantation. The experimental animals were anesthetized with 2% isoflurane (containing 30% oxygen) and maintained with 1.5% isoflurane inhalation anesthesia. The animals were fixed in a prone position on a thermostatic operating table (37°C). After hair removal, the surgical area was disinfected with 75% ethanol and povidone iodine. A 1 cm longitudinal incision was made along the midline of the neck and the subcutaneous connective tissue was bluntly dissected to form a pouch. The osmotic pump preloaded with Ang II solution or control saline was implanted into the pouch. The incision was sutured in layers with 5-0 absorbable sutures. The animals were housed in single cages in an SPF environment for recovery.

[0132] (4) The mice were continuously fed a high-fat diet during the whole process. After 28 days of modeling, the mice were euthanized and the aorta, heart, liver, spleen, lung, and kidney tissues were completely removed. After being rinsed three times with PBS buffer (0.1M, pH 7.4), half of the mice were placed in 10 volumes of 4% paraformaldehyde fixative (4°C, pH 7.4) and fixed for 24 hours. The other half were placed in specimen bags and stored at -80°C for histological identification.

[0133] Example 6 Ultrasound Imaging of Small Animals The morphology of the abdominal aorta was evaluated 7, 14, 21, and 28 days after the micro-osmotic pump implantation. A high-frequency small animal ultrasound imaging system was used to evaluate the abdominal aorta. (1) First, the gas circuit system of the small animal anesthesia machine was established. The oxygen flow rate was set at 1.5 L / min, and the vaporizer was pre-filled with isoflurane (2% vol induction concentration, 1.2% vol maintenance concentration). The experimental animals were placed in an induction box (30×20×15 cm 3 ) After inhalation anesthesia, the mouse was transferred to a thermostatic operating table (37°C) and maintained in anesthesia with a nose cone. (2) After trimming the hair on the chest and abdomen, a hair removal cream (Nair™) was evenly applied for 3 minutes, and the skin surface was cleaned with saline. The surgical area was disinfected with 75% ethanol and iodine-containing disinfectant (povidone iodine) in sequence. (3) The ultrasound system was started and preheated for 15 minutes. A 23-MHz high-frequency linear array probe (X10-23L, VisualSonics) was selected and the parameters were set as follows: imaging depth 1.2 cm, dynamic range 50 dB, and frame rate 30 Hz. Sterile ultrasound coupling agent was applied to the mouse abdomen. The ultrasound probe was held and placed under the xiphoid process of the mouse sternum. The longitudinal section of the descending aorta was identified in two-dimensional mode. The color Doppler mode (velocity scale 15 cm / s) was switched to confirm the characteristic laminar flow signal. The probe was rotated at the level of the superior mesenteric artery branch to obtain a cross-sectional image. The probe was moved downward to the level of the left renal artery to confirm the abdominal aorta. Returning to the longitudinal section, measure the distance between the anterior and posterior intimal walls of the left renal artery 1 mm below its inferior margin. When the color Doppler mode detects a fluctuating blood flow signal consistent with the heart rate, switch the color Doppler ultrasound machine to two-dimensional ultrasound mode and measure the maximum diameter of the abdominal aorta beneath the renal artery. The average of three consecutive cardiac cycle measurements is used as the final result.

[0134] Example 7 Small Animal Fluorescence Imaging Experiment SPVLNs distribution experiment in AAA model mice: ApoE - / - Mice were randomly divided into DIO-SPVLNs group (18 mice) according to body weight. They were fed with high-fat diet for 2 weeks and high-fat diet combined with AngⅡ intervention for 4 weeks. After oral administration and tail vein injection of DIL-SPVLNs, the dynamic observation of ApoE was performed at 6h, 12h, and 24h. - / - Distribution changes of SPVLNs in mice.

[0135] Example 8 Masson staining 1. Tissue Embedding (1) Fixation: The tissue was fixed in 4% paraformaldehyde for at least 24 h, cut into appropriate sizes, placed in a tissue embedding box, and rinsed with running water overnight; (2) Dehydration and transparency: Dehydrate in a gradient of 50% ethanol for 40 min, 70% ethanol for 40 min, 80% ethanol for 40 min, 95% ethanol for 40 min, anhydrous ethanol for 11 h, and anhydrous ethanol for 11 h; then place in xylene for 11 h and xylene for 11 h until the sample becomes transparent; (3) Embedding: Melt the wax at 55-60℃ in advance, soak in soft wax for 1 hour, soak in hard wax for 1 hour, and place in the embedding box; (4) Sectioning: Use a paraffin slicer to cut the embedded tissue into slices with a thickness of 4 μm, unfold them in warm water, remove the slides and dry them for later use.

[0136] 2. Dyeing (1) Dewaxing: Place the abdominal aorta slices in a 60°C constant temperature oven for at least 1.5 hours. Then, place the slices in xylene I for 15 minutes, xylene II for 15 minutes, anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, 95% ethanol for 2 minutes, 85% ethanol for 2 minutes, 75% ethanol for 2 minutes, 50% ethanol for 2 minutes, distilled water for 2 minutes, and PBS for 5 minutes three times. It should be noted that xylene I and xylene II are the same reagent, and the two reagents are placed in each for 15 minutes. The same applies to anhydrous ethanol I and anhydrous ethanol II.

[0137] (2) Stain with prepared Weigert iron hematoxylin solution for 5 minutes; differentiate with differentiation solution for 5-15 seconds, and wash with water; (3) Dye with Ponceau fuchsin solution for 3 min, and wash with weak acid working solution for 1 min; (4) Wash with phosphomolybdic acid solution for 1 min, then wash with weak acid working solution for 1 min; dye with aniline blue solution for 1.5 min, then wash with weak acid working solution for 1 min; (5) Dehydration and transparent mounting: Place the sections in 95% ethanol for 1 min, anhydrous ethanol I for 1 min, anhydrous ethanol II for 1 min, xylene I for 1 min, xylene II for 1 min, and then mount with neutral resin.

[0138] Example 9 HE staining (1) Dewaxing: same as step 2 of Example 8; (2) Hematoxylin staining: stain with hematoxylin for 3 minutes, rinse with tap water; differentiate with differentiation solution for 30 seconds, rinse with tap water; (3) Eosin staining: Eosin dye staining for 2 minutes; (4) Dehydrate and transparently seal the slides.

[0139] Example 10 VVG dyeing (1) Dewaxing: same as step 2 of Example 8; (2) Dewax the paraffin sections to water using conventional methods. Place the sections into a dye vat containing the prepared complete Verhǒeff stain and stain for 15-30 minutes until the color turns dark black. Rinse quickly with running water to remove excess dye.

[0140] (3) Use Verhǒeff differentiation solution to differentiate for a few seconds until the elastic fibers are clear, and then rinse thoroughly with running water.

[0141] (4) Rapidly rinse and deiodinate with 95% ethanol.

[0142] (5) Rinse with running water for 2-3 minutes.

[0143] (6) Place the slices in 5% sodium thiosulfate solution for 3 minutes.

[0144] (7) Rinse thoroughly with running water or distilled water.

[0145] (8) Re-stain with VG staining solution for 30 seconds and absorb the excess staining solution.

[0146] (9) Rapid differentiation using 95% ethanol.

[0147] (10) Dehydrate and transparently seal the slides.

[0148] Example 11 Sirius Red Staining (1) Dewaxing: same as step 2 of Example 8; (2) Prepare iron hematoxylin staining solution before use, add it dropwise for 5-10 minutes, wash with distilled water for 10-20 seconds to remove excess staining solution, wash with tap water for 5-10 minutes to return to blue, and wash with distilled water three times, each time for 5-10 seconds.

[0149] (3) Stain with Sirius Red solution for 10-15 minutes. For tissues that are easy to stain, the staining time can be controlled within 5-10 minutes. Rinse the sections quickly with distilled water to remove excess stain.

[0150] (4) Dehydrate and transparently seal the slides.

[0151] Example 12 In vitro experiment The salvia miltiorrhiza and kudzu root vesicle-like nanoparticles (SPVLNs) prepared in Example 1 and the salvia miltiorrhiza and kudzu root vesicle-like nanoparticles (SVLNs) and kudzu root vesicle-like nanoparticles (PVLNs) prepared in Comparative Examples 1 and 2 were subjected to an in vitro anti-inflammatory experiment. The specific experimental steps are as follows: In order to compare the anti-inflammatory effects of the three vesicle-like nanoparticles, RAW264.7 cell suspensions were cultured at a concentration of 5 × 10 3The cells were seeded at a density of 10 μg / mL / well in a 96-well plate. When the confluency of RAW264.7 cells reached approximately 80%, 10 μg / mL LPS was added for stimulation for 12 h. Subsequently, the cells were divided into five groups: (1) control group (2) model group (3) 20 μg / mL SVLNs group (4) 20 μg / mL PVLNs group (5) 20 μg / mL SPVLNs group.

[0152] After 24 h of treatment, the supernatants of each group of cells were collected and the levels of TNF-α and IL-6 in the supernatants were detected according to the detection procedures of the ELISA kit.

[0153] Experimental results: 1. Extraction and identification of Danshen-Pueraria lobata vesicle-like nanoparticles like Figure 1 As shown in Figure A, this experiment used gradient centrifugation to separate and purify nanoparticles (NPs) from Salvia miltiorrhiza-Pueraria lobata decoction (SP). The average particle size of the NPs was 88 nm as measured by a nano-Coulter particle size analyzer. Figure 1 As shown in B; and under transmission electron microscopy, it was observed that the NPs were mostly membrane vesicles with a shape close to round or oval, and the size was between 60-120nm, as shown in Figure 1 As shown in C in Figure 2. These characterization results fully demonstrate that the isolated NPs meet the generally accepted characteristics of vesicle-like nanoparticles (VLNs), indicating that this method successfully extracted Salvia miltiorrhiza-Pueraria lobata decoction vesicle-like nanoparticles (SPVLNs) from SP. It is worth noting that compared with fresh SPVLNs, SPVLNs stored at -20°C for 3 months did not show significant changes in particle size and potential characteristics, showing good stability. Figure 1 As shown in B.

[0154] 2. Composition Analysis of Danshen-Pueraria Vesicle-like Nanoparticles: Identification and analysis of lipid compounds: like Figure 2 As shown in the figure, the main components of lipid compounds in SPVLNs are glycerides (TG, DG, etc.), sphingolipids (Cer, etc.), and glycerophospholipids (PC, PE, PG, etc.): among them, the content of SPH accounts for 39.61%, the content of WE accounts for 24.202%, and the content of PG accounts for 17.216%.

[0155] AcCa: Acetylcarnitine. Cer: Ceramide. CerP: Ceramidephosphate. CL: Cardiolipin. DG: Diacylglycerol. DGDG: Digalactosyldiacylglycerol. DGMG: Digalactosylmonoacylglycerol. GM3: Monosialodihexosylganglioside. Hex1Cer: Monosaccharide-ceramide. Hex2Cer: Disaccharide-ceramide. LPC: Lysophosphatidylcholine. LPE: Lysophosphatidylethanolamine. LPG: Lysophosphatidylglycerol. LPI: Lysophosphatidylinositol. MG: Monoglyceride. MGDG: Monogalactosyldiacylglycerol. MGMG: Monogalactosylmonoacylglycerol. OAHFA: Esterified ω-hydroxy fatty acid. PC: Phosphatidylcholine. PE: Phosphatidylethanolamine. PG: Phosphatidylglycerol. phSM: Phosphorylated sphingomyelin. PI: Phosphatidylinositol. PS: Phosphatidylserine. SM: Sphingomyelin. SPH: Sphingosine. SQDG: Sulfoquinovosyl diacylglycerol. ST: Sterol ester. TG: Triglyceride.WE:Wax ester.

[0156] MicroRNA component identification and analysis: like Figure 3 As shown: SPVLNs contain a variety of microRNAs (miRNAs), of which 40 have an expression level >50. Among them, the miRNA with the highest expression level is gma-miR6300, accounting for 17%, followed by ptc-miR6478, whose expression level accounts for 4%.

[0157] 3. Safety evaluation of Danshen-Pueraria lobata vesicle-like nanoparticles: Hemolysis test results Figure 4 As shown. Comparison of the nanocarriers in the experimental group with the positive control group showed that red blood cells did not show obvious rupture, indicating that SPVLNs have good blood compatibility ( p <0.0001). Specifically, the hemolysis absorbance of SPVLNs at different concentrations did not change significantly at 1 hour and 3 hours. The hemolysis test results confirmed that SPVLNs have good blood compatibility.

[0158] 4. Targeted drug delivery effect of Danshen-Kuanga vesicle-like nanoparticles Figure 5 In vivo fluorescence imaging of DIL-SPVLNs in ApoE - / - Distribution in mouse aorta. Figure 6 In vivo fluorescence imaging of DIL-SPVLNs in ApoE - / - Distribution in various organs of mice.

[0159] This study compared the drug distribution characteristics after oral and intravenous administration using in vivo fluorescence imaging in small animals. In the SPVLNs (ig) group, the fluorescence intensity of the aorta (including the heart) gradually increased from 6 to 12 hours (peaking at 12 hours) and disappeared at 24 hours, indicating that the drug diffused to the aorta after intestinal absorption. In the SPVLNs (iv) group, the aorta fluorescence was strongest at 6 hours, then attenuated and migrated (accumulating in the abdominal aorta at 12 hours and sinking to the iliac arteries at 24 hours), reflecting the dynamic distribution of the drug after entering the blood. Figure 5 ).

[0160] In addition, the liver fluorescence of the SPVLNs (ig) group was weak at 6 hours, increased at 12 hours, and weakened at 24 hours, which may be related to portal vein absorption and liver metabolism; the fluorescence of both kidneys peaked at 6 hours, then weakened with excretion and disappeared at 24 hours, indicating that the kidneys are the main excretion route. The liver fluorescence continued to increase over time, becoming weak at 6 hours and strongest at 24 hours, suggesting continuous uptake by hepatocytes or accumulation of metabolites; renal clearance was asymmetric, with residual weak fluorescence in the left kidney at 6 hours and 24 hours, which may be related to anatomical / blood flow differences ( Figure 6 ), the other organs in both groups showed no fluorescence.

[0161] At the vascular morphology level, dynamic ultrasound monitoring showed that the SPVLNs intravenous injection group exhibited the best inhibitory effect on vasodilation ( Figure 7 ), which may be due to the particle size effect and surface charge characteristics promoting the passive targeted accumulation of drugs in diseased blood vessels.

[0162] In summary, the drug has a high targeting ability. Oral administration is beneficial for maintaining local drug concentration in the aorta (optimal for 12 hours), while intravenous injection highlights the dynamic distribution of blood vessels and liver accumulation characteristics, providing a reference for optimizing drug administration strategies.

[0163] 5. Danshen-Kuanga root and its vesicle-like nanoparticles inhibit the formation of abdominal aortic aneurysm The therapeutic effects of SP and SPVLNs were evaluated at the animal level. Using ultrasound imaging technology, the ApoE levels in each group were examined. - / - Morphological characteristics of the abdominal aorta of mice. Compared with Saline, the Model group showed significant dilation of the abdominal aorta segment ( p =0.0002), such as Figure 7 As shown in Figure B. Different drug administration methods all led to different degrees of reduction in aortic diameter, among which the tail vein injection of SPVLNs treatment group showed a significant reduction ( p =0.0126). The analysis of the vascular diameter measurements was consistent with the ultrasound image results, such as Figure 7 As shown in C.

[0164] 6. Danshen-Kuanga and its vesicle-like nanoparticles improve changes in abdominal aorta tissue fiber structure in mice H&E staining, VVG staining, Masson staining and Sirius Red staining were used to observe the expression of ApoE in each group. - / - Microstructural changes in the abdominal aorta of mice. H&E staining showed that the abdominal aorta wall of the Model group mice was significantly thickened and the number of infiltrating cells in the arterial media increased compared with the Saline group ( p <0.0001); SP and SPVLNs treatment can improve this phenomenon, as shown by the fact that the abdominal aorta wall of the mice in the SP, SPVLNs (ig), and SPVLNs (iv) groups was thinner than that in the Model group, the cells were more densely arranged, and there were fewer infiltrating cells in the arterial media ( p <0.0001), such as Figure 8 As shown in A and B in Figure 3. Iron hematoxylin in VVG staining solution has a strong adsorption capacity for vascular elastic fibers and can be used to observe the morphology and changes of vascular elastic fibers. In this experiment, VVG staining results showed that compared with the Saline group, the elastic fibers in the abdominal aorta wall of the Model group mice were significantly reduced ( p<0.0001), the elasticity decreased and there was a breakage phenomenon, and the original concave and convex shape was lost; while the elastic fibers of the abdominal aorta wall of the mice in the SP, SPVLNs (ig), and SPVLNs (iv) groups were similar to those in the Saline group, and were significantly increased compared with the Model group ( p <0.0001), the stretchability is enhanced and there is no fracture phenomenon, and it still appears concave and convex, such as Figure 8 As shown in A and C. Masson staining is used to distinguish muscle fibers from collagen fibers. Myofibroblasts are stained red while collagen fibers are stained blue. In this experiment, Masson staining found that the collagen fibers in the abdominal aorta of the Model group mice were significantly thicker than those in the Saline group ( p <0.0001), the cells were arranged in disorder and unevenly distributed, and the muscle fiber content was also increased; SP, SPVLNs (ig), and SPVLNs (iv) treatments could alleviate this phenomenon. Compared with the Model group, SP ( p <0.0001), SPVLNs (ig) ( p =0.0075), SPVLNs (iv) ( p <0.0001) group mice had fewer collagen fibers and muscle fibers in the abdominal aorta, and the cells were arranged more orderly, such as Figure 8 As shown in A and D. In addition, Sirius Red staining was used to observe the degree of collagen fibrosis in the abdominal aorta tissue of mice. It was found that compared with the Saline group, the type I, type II, and type IV collagen fibers in the abdominal aorta tissue of mice in the Model group were significantly increased ( p <0.0001); and SP( p =0.0065), SPVLNs (ig) ( p =0.0310), SPVLNs (iv) ( p =0.0002) group mice showed a decrease in type I, type II, and type IV collagen fibers in the abdominal aorta compared with the Model group, similar to the Saline group. Figure 8 As shown in A and E.

[0165] These pathological staining results indicate that treatment with SP, SPVLNs (ig), and SPVLNs (iv) ameliorates Ang II-induced changes in mouse abdominal aortic cellular structure, including alleviation of vascular wall thickening, reduction of infiltrating cells in the media and adventitia, improvement of elastic fiber loss and rupture, increased elastic fiber extensibility, decreased myofiber and collagen fiber content, and reduced collagen fibrosis. These findings provide an important theoretical basis for developing novel anti-aneurysm strategies based on the synergistic effects of multiple components of traditional Chinese medicine (TCM) and offer a methodological basis for modern research on TCM.

[0166] 7. In vitro anti-inflammatory experiment In vitro, the anti-inflammatory effects of the three vesicle-like nanoparticles were compared. Raw264.7 cells were stimulated with LPS, and TNF-α in the supernatant was detected using an ELISA kit (e.g. Figure 9 A) and IL-6 (e.g. Figure 9 The results showed that the anti-inflammatory effect of salvia miltiorrhiza and kudzu root vesicle-like nanoparticles (SPVLNs) was significantly better than that of salvia miltiorrhiza and kudzu root vesicle-like nanoparticles (SVLNs) and kudzu root vesicle-like nanoparticles (PVLNs).

[0167] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. Application of Danshen-Pueraria lobata vesicle-like nanoparticles in the preparation of drugs for the treatment of abdominal aortic aneurysm.

2. The use according to claim 1, characterized in that The average particle size of the Danshen-Kuanga vesicle-like nanoparticles is 50-200 nm; The components of the salvia miltiorrhiza-kudzu root vesicle-like nanoparticles include lipid compounds and microRNA.

3. The use according to claim 1, characterized in that The functions of the drug for treating abdominal aortic aneurysm are any one or more of the following: (1) Inhibit vascular wall thickening; (2) Reduce the number of infiltrating cells in the arterial media and adventitia; (3) Improve the reduction and breakage of elastic fibers in the blood vessel wall; (4) Increase the stretchability of elastic fibers in the blood vessel wall; (5) Reduce the content of tissue muscle fibers and collagen fibers; (6) Reduce the degree of collagen fiber fibrosis.

4. The use according to claim 1, characterized in that The method for extracting the Danshen-Pueraria lobata vesicle-like nanoparticles comprises the following steps: (1) Preparation of Danshen-Pueraria decoction: adding water to Danshen slices and Pueraria decoction slices, decocting, filtering, repeating the steps of adding water, decocting, filtering, combining multiple decoctions, and concentrating; (2) centrifuging the Danshen-Kuanga root decoction in step (1) to obtain a supernatant, and subjecting the supernatant to multiple centrifugation treatments to obtain a pre-treatment supernatant; (3) centrifuging the pre-treatment supernatant obtained in step (2), discarding the supernatant, and obtaining a precipitate; (4) Resuspend the precipitate obtained in step (3) in sterile PBS and filter through a filter membrane.

5. The use according to claim 4, characterized in that In the step (1), the mass ratio of the Danshen decoction pieces to the Pueraria decoction pieces is (0.9-1.1):(0.9-1.1); In the step (1), each time water is added, the amount of water used is 8-12 times the total mass of the Danshen decoction pieces and the Pueraria decoction pieces; In the step (1), 2-3 decoctions are combined; In the step (1), the decoction temperature is 90-110° C., and the decoction time is 0.5-4 h.

6. The use according to claim 4, characterized in that In the step (2), the Danshen-Kuanga root decoction in step (1) is centrifuged at 1000g for 5-15 minutes to obtain the supernatant; the supernatant obtained by centrifugation is centrifuged at 2000g for 15-25 minutes, at 3000g for 25-35 minutes, and at 10000g for 50-70 minutes to obtain the pre-treatment supernatant; In both steps (2) and (3), low temperature conditions are used, and the low temperature is 3-8°C; In the step (3), ultra-high speed centrifugation is used, and the centrifugation is carried out at 150,000 g for 80-100 minutes.

7. A pharmaceutical composition, characterized in that The active ingredients thereof comprise the salvia miltiorrhiza-kudzu root vesicle-like nanoparticles used in any one of claims 1 to 6.

8. The pharmaceutical composition according to claim 7, characterized in that It also includes pharmaceutically acceptable carriers or excipients.

9. A pharmaceutical preparation, characterized in that The invention comprises the Danshen-Pueraria lobata vesicle-like nanoparticles for use according to any one of claims 1 to 6.

10. The pharmaceutical preparation according to claim 9, characterized in that Also includes pharmaceutically acceptable carriers or excipients; The pharmaceutical preparation is an oral preparation or an injection preparation.

Citation Information

Patent Citations

  • Sal-miR-58 and its use in inhibiting vascular inflammatory response and aneurysm formation

    CN110511930A

  • Salvia miltiorrhiza plant exosome vesicles as well as extraction method and application thereof in cerebral trauma treatment

    CN118766983A

  • Pueraria qinlian decoction vesicle-like nanoparticles as well as extraction method and application thereof

    CN119606893A