Lassa virus mRNA vaccine with prefusion conformation GPC as target and preparation method thereof

By constructing a Lassa virus mRNA vaccine with pre-fusion conformation GPC and preparing it into lipid nanoparticles, the problems of high cost and long cycle of existing vaccines were solved, and a safe and effective Lassa virus prevention effect was achieved.

CN120695172APending Publication Date: 2025-09-26INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202510986590.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-17
Publication Date
2025-09-26

AI Technical Summary

Technical Problem

There is currently no licensed Lassa fever vaccine. The existing vaccines have high research and development costs, long development cycles, and insufficient safety and effectiveness, making it difficult to effectively prevent Lassa virus infection.

Method used

A Lassa virus mRNA vaccine targeting the prefusion conformation GPC was designed. By searching the GPC amino acid sequence of LASV, a stable prefusion conformation GPC was formed. After optimizing the codons, a plasmid was constructed, and the mRNA was transcribed and prepared into lipid nanoparticles LNP for immunization.

Benefits of technology

The vaccine produced high binding antibody titers and T cell immune responses in mouse immunization experiments, significantly reduced multi-organ viral loads and tissue and organ damage, and had a certain protective efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120695172A_ABST
    Figure CN120695172A_ABST
Patent Text Reader

Abstract

The invention provides a Lassa virus mRNA vaccine with prefusion conformation GPC as a target and a preparation method of the Lassa virus mRNA vaccine, and relates to the technical field of vaccine preparation. The amino acid sequence of the Lassa virus mRNA vaccine is shown as SEQ ID NO.1, the nucleotide sequence of the Lassa virus mRNA vaccine is shown as SEQ ID NO.2, and the Lassa virus mRNA vaccine is obtained by determining the conservative GPC amino acid sequence of Lassa virus and coding the amino acid sequence of the conformation GPC before fusion. The invention overcomes the defects of the prior art, and can design and prepare a vaccine which has a good prevention effect on LASV infection, and is safe, stable, short in research and development period and low in cost.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of vaccine preparation, and in particular to a Lassa virus mRNA vaccine targeting the pre-fusion conformation GPC. Background Art

[0002] Lassa virus (LASV), the pathogen that causes Lassa fever (LF), belongs to the Arenaviridae family. The virus was first discovered in 1969 in the town of Lassa, Nigeria, hence its name. The primary reservoir for Lassa virus is the multimammate rat (Mastomys natalensis), which is widely distributed in West Africa. Infected rats do not develop the disease, but their excretions (such as urine and feces) contain the virus, which can contaminate food and the environment and subsequently infect humans. Lassa fever is primarily endemic in West Africa, including Benin, Ghana, Guinea, Liberia, Mali, Nigeria, and Sierra Leone. It is estimated that over 100,000 new cases occur annually, with approximately 1,000 to 3,000 deaths (a case fatality rate of 1-3%). The case fatality rate for hospitalized patients is 15-25%.

[0003] Humans are primarily infected through contact with food or household items contaminated with feces from infected rodents. Human-to-human transmission primarily occurs in healthcare settings, particularly in the absence of appropriate infection prevention and control measures. Humans are generally susceptible to Lassa virus, and while most infections are mild or asymptomatic, severe cases can lead to multi-organ dysfunction. The incubation period for Lassa fever ranges from 2 to 21 days.

[0004] For symptomatic patients, the onset of illness is typically gradual, beginning with fever, general weakness, headache, and malaise. Sore throat, muscle aches, chest pain, nausea, vomiting, diarrhea, cough, and abdominal pain may develop several days later. As the disease progresses, severe cases may develop facial swelling, pulmonary effusions, bleeding from the mouth, nose, vagina, or gastrointestinal tract, and low blood pressure. Shock, seizures, tremors, disorientation, and coma may occur in late stages. Approximately 15% of hospitalized patients die from Lassa fever. In fatal cases, death usually occurs within 14 days of symptom onset. Lassa fever infection during pregnancy is associated with increased maternal and fetal mortality, particularly in the third trimester. In the third trimester, fetal and maternal mortality rates can exceed 80% and 30%, respectively. Recovery can be prolonged (prolonged recovery) and sometimes lead to other problems (sequelae). Sudden hearing loss can occur both during the acute phase and after recovery, with varying incidences, with up to 25% of recovered patients reporting sudden hearing loss. In most cases, hearing loss is reported to be permanent. Other sequelae, including neurologic signs, visual impairment, joint pain, transient alopecia, and psychological disturbances, have been reported to a lesser extent. Therefore, patients who recover from Lassa fever should receive appropriate diagnosis and treatment for any sequelae they may experience.

[0005] Lassa virus has been designated by the World Health Organization (WHO) as a virus of particular concern. It was included in the first list of priority pathogens published in 2017. In 2016, the WHO designated Lassa fever as a priority disease for epidemic preparedness as part of the WHO Blueprint for Action on Epidemic Preparedness. Because of its potential to cause epidemics, Lassa virus was included in the WHO R&D Blueprint's list of priority pathogens, aimed at accelerating research during epidemics. Due to the risk of Lassa virus transmission and its potential threat to public health, the WHO has been committed to promoting the development of effective medical countermeasures for Lassa fever, including diagnostic tools, treatments, and vaccines. Currently, although several vaccine candidates are in development, no licensed Lassa fever vaccine is available. Summary of the Invention

[0006] In response to the shortcomings of the existing technology, the present invention provides a Lassa virus mRNA vaccine targeting the pre-fusion conformation GPC and a preparation method thereof, and designs and prepares a vaccine that has good preventive effect on LASV infection and is safe, stable, has a short R&D cycle and low cost.

[0007] To achieve the above objectives, the present invention is implemented through the following technical solutions: A Lassa virus mRNA vaccine targeting the pre-fusion conformation GPC, the amino acid sequence of the vaccine being shown in SEQ ID NO.1, and the nucleic acid sequence being shown in SEQ ID NO.2.

[0008] The preparation method of the Lassa virus mRNA vaccine targeting the prefusion conformation GPC comprises the following steps: S1. Search the GPC amino acid sequences of different subtypes of LASV in NCBI and obtain the conserved GPC amino acid sequence as shown in SEQ ID NO. 5. S2. forming a stable pre-fusion conformation GPC, and obtaining an amino acid sequence encoding the pre-fusion conformation GPC as shown in SEQ ID NO.1; S3. The amino acid sequence encoding the pre-fusion conformation of GPC was codon-optimized according to human codon preference to obtain the DNA sequence shown in SEQ ID NO. 2. The DNA sequence was then constructed into the plasmid PUC57 containing a T7 promoter, 5'UTR, 3'UTR, and 100 PolyA residues to complete the plasmid construction; S4, amplifying and transcribing the successfully constructed plasmid to obtain mRNA; S5. The mRNA obtained above is prepared into lipid nanoparticles LNP by a microfluidic method.

[0009] Preferably, the nucleotide sequence of the 5'UTR in step S3 is shown as SEQ ID NO.3, and the nucleotide sequence of the 3'UTR is shown as SEQ ID NO.4.

[0010] Preferably, the specific operation of transcription in step S4 is to use a commercial transcription kit vazyme#DD4203 for transcription, and to purify using RNA magnetic beads to obtain pure RNA.

[0011] Preferably, the specific method of preparing lipid nanoparticles LNP in step S5 includes the following steps: S5-1. Dissolve the mRNA in 50 mM citric acid buffer at pH 4, using a ratio of 1:8 between the phosphorus content of the mRNA and the nitrogen content of SM102 to obtain a final concentration of 108 ng / μL mRNA-citric acid solution. S5-2, prepare an anhydrous ethanol solution with a SM102 mass concentration of 50%, a DMG-PEG2000 mass concentration of 1.5%, a DSPC mass concentration of 10%, and a cholesterol mass concentration of 38.5% to obtain a lipid mixed solution; S5-3. The lipid mixed solution and the mRNA-citric acid solution were filtered through a 0.22 μm microporous filter membrane respectively, and mixed using a microfluidic instrument to obtain lipid nanoparticles LNP.

[0012] Preferably, in step S5-3, the flow rate ratio of the mixing performed by the microfluidic instrument is 15 mL / min: 5 mL / min for the mRNA-citric acid solution: lipid mixed solution.

[0013] The present invention provides a Lassa virus mRNA vaccine targeting the pre-fusion conformation GPC and a preparation method thereof, which has the following advantages over the prior art: This study uses the conserved sequence of the Lassa virus glycoprotein to construct a prefusion conformation of GPC. Using an mRNA vaccine as the vaccine platform, this mRNA was prepared into lipid nanoparticles (LNPs) using a microfluidic method to produce mRNA-PreGPC. Mouse immunization experiments showed that after two immunizations, the mice produced high binding antibody titers, moderate neutralizing antibody titers, and a high-level T cell immune response. In challenge and protection experiments, the immunized mice controlled viremia and significantly reduced viral loads in multiple organs and tissue and organ damage. These results demonstrate that the prefusion conformation GPC antigen designed using the conserved sequence of the Lassa virus glycoprotein performs well in the mRNA vaccine platform, eliciting a strong humoral and cellular immune response and demonstrating a certain degree of protective efficacy against LASV. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Schematic diagram of the design strategy of the mRNA-PreGPC vaccine of the present invention; Figure 2 Schematic diagram of the particle size and encapsulation efficiency of lipid nanoparticles produced by LNP encapsulation in an embodiment of the present invention; Figure 3 Schematic diagram of RNA electrophoresis of in vitro transcription in an embodiment of the present invention; Figure 4 Schematic diagram of verification of mRNA-PreGPC cell level expression in an embodiment of the present invention; Figure 5 This is a schematic diagram of the weight changes of C57 mice after vaccination according to an embodiment of the present invention; Figure 6 Schematic diagram of the immunization cycle of c57 mice with mRNA-PreGPC vaccine in an embodiment of the present invention; Figure 7 This is a schematic diagram of the binding antibody titer in the serum of mice after immunization in an embodiment of the present invention; Figure 8 This is a schematic diagram of the immunization of c57 mice with the mRNA-PreGPC vaccine according to an embodiment of the present invention; Figure 9 This is a schematic diagram of the IFN-γ level induced by the mRNA-PreGPC vaccine of the present invention after immunization; Figure 10This is a schematic diagram of the weight changes of LASV challenge experiments in c57 mice after immunization in an embodiment of the present invention; Figure 11 This is a schematic diagram of the changes in viremia in LASV challenge experiments in c57 mice after immunization in an embodiment of the present invention; Figure 12 This is a schematic diagram of the changes in viral loads in multiple tissues and organs of LASV challenge experiments in immunized c57 mice according to an embodiment of the present invention; Figure 13 This is a schematic diagram of the pathological injury scoring of the LASV challenge experiment in immunized c57 mice in the embodiment of the present invention; Figure 14 This is a schematic diagram of the staining of pathological injury sections of various tissues in the LASV challenge experiment in immunized c57 mice in an example of the present invention. DETAILED DESCRIPTION

[0015] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention are clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention. Example:

[0016] Preparation of mRNA-PreGPC vaccine: The GPC amino acid sequences of different LASV subtypes were searched in NCBI. A total of 54 sequences were found. Sequence alignment was performed using SnapGene software to obtain the conserved GPC amino acid sequence (shown as SEQ ID NO. 5). An amino acid sequence encoding the pre-fusion conformation of GPC (as shown in SEQ ID NO.1) was constructed by mutating the arginine R at position 206 and the glycine G at position 359 to cysteine ​​C in the conserved GPC amino acid sequence (forming a disulfide bond between 206 and 359, connecting GP1 and GP2); mutating the cleavage site RRLL between GP1 and GP2 to RRRR (a forin cleavage site) to increase cleavage efficiency; and mutating the hydrophilic amino acid glutamic acid E at position 329 to the hydrophobic amino acid proline P to increase protein rigidity (the construction method was the internationally mainstream method for constructing the pre-fusion conformation of Lassa virus GPC). Codon optimization was then performed according to human codon preference to obtain the DNA sequence shown in SEQ ID NO.2, which was then constructed onto the plasmid PUC57 containing a T7 promoter, a 5'UTR (as shown in SEQ ID NO.3), a 3'UTR (as shown in SEQ ID NO.4), and 100 polyA residues. SEQ ID NO.1: MGQIVTFFQEVPHVIEEVMNIVLIALSLLAVLKGLYNVATCGLIGLVTFLLLCGRSCSTLYKGVYELQTLELNMETLNMTMPLSCTKNNSHHYIMVGNETGLELTLTNTSIINHKFCNLSDAHKKNLYDHALMSIISTFHLSIPNFNQYEAMSCDFNGGKISVQYNLSHSYAVDAANHCGTVANGVLQTFMRMAWGGSYIALDSGCGNWDCIMTSYQYLIIQNTTWEDHCQFSRPSPIGYLGLLSQRTRDIYISRRRRGTFTWTLSDSEGNETPGGYCLTRWMLIEAELKCFGNTAVAKCNEKHDEEFCDMLRLFDFNKQAIQRLKAPAQMSIQLINKAVNALINDQLIMKNHLRDIMCIPYCNYSKYWYLNHTVTGKTSLPKCWLVSNGSYLNETHFSDDIEQQADNMITEMLQKEYMDRQGKTPLGLVDLFVFSTSFYLISIFLHLVKIPTHRHIVGKPCPKPHRLNHMGICSCGLYKQPGVPVRWKR; SEQ ID NO.2: SEQ ID NO.3: GAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC; SEQ ID NO.4: CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAG; SEQ ID NO.5: MGQIVTFFQEVPHVIEEVMNIVLIALSLLAVLKGLYNVATCGLIGLVTFLLLCGRSCSTLYKGVYELQTLELNMETLNMTMPLSCTKNNSHHYIMVGNETGLELTLTNTSIINHKFCNLSDAHKKNLYDHALMSIISTFHLSIPNFNQYEAMSCDFNGGKISVQYNLSHSYAVDAANHCGTVANGVLQTFMRMAWGGSYIALDSGRGNWDCIMTSYQYLIIQNTTWEDHCQFSRPSPIGYLGLLSQRTRDIYISRRLLGTFTWTLSDSEGNETPGGYCLTRWMLIEAELKCFGNTAVAKCNEKHDEEFCDMLRLFDFNKQAIQRLKAEAQMSIQLINKAVNALINDQLIMKNHLRDIMGIPYCNYSKYWYLNHTVTGKTSLPKCWLVSNGSYLNETHFSDDIEQQADNMITEMLQKEYMDRQGKTPLGLVDLFVFSTSFYLISIFLHLVKIPTHRHIVGKPCPKPHRLNHMGICSCGLYKQPGVPVRWKR。

[0017] Plasmids were amplified using Top10 strains, extracted, and linearized using BsaI. The linearized fragments were recovered using DNA magnetic beads. Transcription was performed using a commercial transcription kit (vazyme #DD4203), and purified using RNA magnetic beads to obtain pure RNA: The specific method is: Transduce the plasmid into Top10 competent cells, then add 800 μl of LB medium. After initial amplification, take 400 μl and add it to 500 ml of LB medium. Add ampicillin at a 1:1000 ratio and shake on a shaker (37°C, 220 rpm) for 16 hours. Use a commercial plasmid extraction kit for plasmid extraction. Correctly sequenced plasmids were linearized using the following system: 50 μg of plasmid, 10 μl of BsaI, 50 μl of 10× BsaI buffer, and add enzyme-free water to 500 μl. Use commercial DNA magnetic beads (vazyme #N411-01) to recover linearized DNA: Add 0.5 times the volume (250 μl) of DNA magnetic beads to the linearization reaction solution and pipette evenly. Incubate at room temperature for 5 minutes, then place on a magnetic rack. After 5 minutes, aspirate the liquid, add 600 μl of 80% ethanol, aspirate the liquid after 30 seconds, and repeat this process. Discard the liquid, incubate at room temperature for 7 minutes, air dry, remove from the magnetic rack, add 40 μl of enzyme-free water to dissolve the adsorbed magnetic beads, incubate at room temperature for 5 minutes, place on the magnetic rack again, and aspirate the liquid after 5 minutes to obtain the purified linearized product. Transcription was performed using a commercial transcription kit (vazyme#DD4203): Mix according to the following system Add RNase-free ddH2O to 20ul 10 × Co-Reaction Buffer 2ul N1-Me-Pseudo UTP (100 mM) 1.5ul ATP Solution (100 mM) 1.5ul CTP Solution (100 mM) 1.5ul GTP Solution (100 mM) 1.5ul CAG Trimer 1ul T7 RNA Polymerase Mix 2ul React in a 37°C metal bath for 2 hours, then add 1ul DNaseI Purify RNA using commercially available RNA magnetic beads (vazyme #N412-01): Add 1.8 times the volume (36 μl) of RNA magnetic beads to the transcription reaction mixture and pipette to mix thoroughly. Incubate at room temperature for 5 minutes, then place on a magnetic rack. After 5 minutes, aspirate the liquid, add 200 μl of 80% ethanol, and repeat after 30 seconds. Discard the liquid, incubate at room temperature for 7 minutes, air dry, remove from the magnetic rack, add 50 μl of enzyme-free water to dissolve the adsorbed beads, incubate at room temperature for 5 minutes, place on the magnetic rack again, and aspirate the liquid after 5 minutes. This is the purified transcript.

[0018] The purified RNA was dissolved in a 50 mM citric acid buffer at pH 4 to a final concentration of 108 ng / μL to obtain an mRNA-citric acid solution. SM102, DMG-PEG2000, DSPC, and cholesterol were mixed and dissolved in anhydrous ethanol at ratios of 50%, 1.5%, 10%, and 38.5% to obtain a lipid mixture solution. The lipid mixture solution and the mRNA-citric acid solution were filtered through a 0.22 μm microporous membrane and mixed using a microfluidic instrument at a ratio of 1:8, based on the phosphorus content of the mRNA and the nitrogen content of SM102. The flow rate ratio was 15 mL / min:5 mL / min for the mRNA-citric acid solution:lipid mixture solution to obtain mRNA-LNP.

[0019] Detection: The obtained mRNA-LNP was immediately diluted with 15 ml of the above citric acid buffer and ultrafiltered using a 100KD ultrafiltration tube with a centrifugal force of 3000 g. After ultrafiltration to 1 / 4 volume, 20 mM Tris-HCl buffer (PH = 7.5) was added to 15 mL. After repeating twice, the particle size and encapsulation efficiency were measured. It was found that the particle size was about 100 nm and the encapsulation efficiency was above 95% (such as Figure 2 shown); The results of in vitro transcribed RNA electrophoresis were as follows Figure 3 As shown; among them, lane 2 is a DNA marker with a size of 5000; lanes 1, 3, and 6 are blank; lanes 4 and 5 are purified pre-GPC-RNA.

[0020] After preparing mRNA-PreGPC, perform a transfection experiment on 293T cells. After 24 hours, collect the total cell protein and use the Lassa virus GPC antibody to detect whether the target antigen is expressed to ensure that the cells in the mRNA-PreGPC transfection group successfully express the antigen: First, add 50w 293T cells to a 6-well plate and then culture for 16 hours. Use a commercial RNA transfection reagent for RNA transfection. Specifically: aspirate 3.75ul of transfection reagent, add 125ul Opti-MEM, mix well and let it stand for 10 minutes. At the same time, aspirate 5ugRNA, add 250ul Opti-MEM, mix well and aspirate 125ul and add it to the transfection reagent dilution obtained in the previous step, mix well and let it stand for 5 minutes. Finally, add it evenly to the 6-well plate. The control group is not treated. After continuing to culture the cells for 24 hours, aspirate the culture medium in the well, add 200ul / well cell lysate and 2ul / well protease inhibitors. After placing on ice for 30 minutes, aspirate the lysate in the 80ul well, add 20ul 5×loading biffer, mix well and place in 95℃ metal liquid for 10 minutes. After cooling, add the control and experimental groups to the wells of a 12-well 12% precast gel and run the electrophoresis apparatus at 90V for 30 minutes, followed by 180V for 1 hour. Transfer the membrane using a semi-dry transfer method, then add 20ml of blocking buffer and incubate at room temperature for 15 minutes. Discard the blocking buffer and add 10ml of the corresponding primary antibody diluted in blocking buffer. Incubate at 4°C for 16 hours. Discard the primary antibody and add 15ml of 1× TBST to wash the membrane for 10 minutes. Repeat three times. Add 10ml of the corresponding secondary antibody diluted in blocking buffer and incubate at room temperature for 1 hour. Discard the secondary antibody and add 15ml of 1× TBST to wash the membrane for 10 minutes. Repeat three times. Develop the membrane using developer and a developer apparatus and save the image. To ensure that all samples were normal, we then repeated the experiment using an anti-β-actin antibody. This time, we only needed to add the primary antibody, incubate at room temperature for 1 hour, then wash the membrane in 15 ml of 1× TBST for 10 minutes, repeating this three times. The membrane was then developed using a developer.

[0021] Specific results such as Figure 4 As shown: Compared with the control group, the experimental group had specific bands, and the WB experiment using β-Actin showed that the internal control in both the control and experimental groups was expressed normally, indicating that GPC was successfully expressed in 293T cells before antigen fusion.

[0022] The rats were immunized twice with mRNA-PreGPC vaccine at high dose of 10 μg / mouse and low dose of 5 μg / mouse, and PBS was used as control, at 0 day and 21 day respectively.

[0023] mRNA-LNP was prepared as described above, and female c57BL / 6 mice aged 4 to 6 weeks were immunized with a high dose of 10 μg / mouse, a low dose of 5 μg / mouse, and PBS as a control, by intramuscular injection.

[0024] Within five days after immunization with the vaccine pre-GPC, the body weight of the mice was measured every other day. The specific results are as follows: Figure 5 The results showed that after immunization, the mice's weight only decreased slightly and then quickly returned to normal, indicating that the vaccine pre-GPC has a certain degree of safety and does not cause a significant decrease in the mice's weight; Monitor weight changes after vaccination, and the specific results are as follows: Figure 5 As shown, the vaccine is basically safe.

[0025] The immunogenicity of the vaccine was evaluated by detecting specific IgG binding antibodies to the GPC protein in the serum. Neutralizing antibodies were detected in the sera of mice at the immunization endpoint. Neutralizing antibodies were detected using the CPE method using LASV virus in Vero cells: Bound Antibody: Recombinant GPC protein (Antibodysystem, #YVV04302, 1 μg / mL) was adsorbed for 16 hours at 4°C and then immobilized in a 96-well microplate (Thermo Fisher Scientific, #442404). Serum samples were serially diluted 1:100 in detection buffer (0.05% BSA / PBST) and then incubated for a primary incubation (37°C, 60 minutes). The wash step was repeated before horseradish peroxidase-conjugated polyclonal goat anti-mouse IgG (Invitrogen, #A-10668) was applied at a 1:30,000 dilution in sample diluent (100 μL / well). A secondary incubation (37°C, 60 minutes) with 3,3',5,5'-tetramethylbenzidine (TMB) substrate (Thermo Fisher Scientific, 100 μL / well) was performed under ambient conditions (15 minutes) and followed by washing for color development. The enzymatic reaction was quenched with an acidic stop solution (SolarBio, #C1058), and dual-wavelength optical density measurements were recorded at 450 nm (primary wavelength) and 630 nm (reference wavelength). Negative control wells were filled with assay buffer instead of serum specimens to define the baseline value, while the seropositivity threshold was determined to be 2.1-fold higher than that of the positive control wells. The geometric mean titer (GMT) of antigen-specific IgG was calculated as the reciprocal dilution absorbance value that reached the threshold.

[0026] Neutralizing Antibodies: To quantify the neutralizing activity of serum against LASV, a live virus microneutralization assay was performed under a biosafety level 4 isolation protocol. Mouse sera were heat-inactivated (56°C, 30 minutes) before being serially diluted two-fold in Dulbecco's Modified Eagle Medium (DMEM) in a 96-well microplate. In each experimental replicate, 50 μL of the titrated serum dilution was dispensed into designated wells. Virus working stocks in DMEM were normalized to 2 × 10 3 The target concentration of plaque forming units (PFU) / mL was determined. Equimolar amounts (50 μL) of virus inoculum and serially diluted serum samples were incubated in parallel (37°C, 1 hour) to promote the formation of antibody-virus complexes. After incubation, 100 μL of Vero cell suspension (1.5×10 4 Cells (100 cells / well, complete medium) were inoculated into each virus-serum reaction well and incubated under standard conditions (37°C, 5% CO2) for 5-7 days. Neutralization efficacy was determined by quantitative microscopic analysis of the progression of virus-induced cytopathic effect (CPE). Serum neutralization titers were calculated as the reciprocal endpoint dilution that achieved ≥50% inhibition of CPE relative to virus control wells and expressed as the 50% neutralization titer (NT50).

[0027] Specific results such as Figure 6 As shown, the mRNA-PreGPC vaccine was used to immunize c57 mice on 0d and 21d, and blood was collected on 14d, 21d, 35d, and 42d ( Figure 6 ), the binding antibody titer against GPC in the serum was detected, and the neutralizing antibody was detected at the end of the immunization (42dpi); the results showed that the binding antibody titer in the serum of mice increased significantly after immunization ( Figure 7 ), but did not induce effective neutralizing antibodies ( Figure 8 ).

[0028] To test whether the mRNA-PreGPC vaccine produces a memory cellular immune effect after immunization, the ElisPot method was used to detect the positive cells of INF-γ in the spleen immune cells after antigen stimulation to evaluate the level of cellular immunity: Elispot experiment specific steps: Enzyme-linked immunospot (ELISpot) assays were performed according to the manufacturer's standard protocol (Mabtech®). Mouse spleen tissue was aseptically dissected, and peripheral blood mononuclear cells (PBMCs) were isolated using a commercial lymphocyte isolation kit (SolarBio®, #P8860). Antigen-specific stimulation was achieved by incubation with inactivated LASV virus (1 × 10^7 / 50 μL per well). Experimental controls were established as follows: unstimulated cells (negative control in each experimental replicate) were used to assess baseline reactivity, while cells activated with phytohemagglutinin (PHA) served as a positive process control. Subsequent procedural stages included equilibration (37°C, 5% CO2), an automated wash cycle, and seeding of cells into pre-coated 96-well ELISpot plates (Mabtech®; #3321-4APT-10 membrane plates, #3441-4APW-10 plate covers). Final spot quantification and high-resolution image acquisition were performed using the IRIS™ automated ELISpot reader system (Mabtech®), and data were normalized to every 10 6 Spot-forming units (SFU) of cells.

[0029] Specific results such as Figure 9 As shown, mRNA-PreGPC vaccine triggered strong T cell immunity in mice after immunization and induced the production of strong IFN-γ levels.

[0030] LASV challenge protection experiment: Blood samples were collected at different time points after challenge and viral load was measured using RT-qPCR to monitor the dynamic changes in viremia. Five days after challenge, mice in each group were dissected and viral loads in various tissues and organs were measured using RT-qPCR to determine whether the vaccine effectively inhibited viral replication. Pathological damage in various tissues and organs was also detected using HE staining, and the corresponding pathological scores were used for relative quantitative statistical analysis of the extent of pathological damage. The mice were challenged intranasally with 1×10 4 In LASV-challenged mice, body temperature and body weight were monitored every other day, and blood and throat swab samples were collected. All animals survived until day 5 post-challenge and were then euthanized. Heart, liver, spleen, lung, kidney, brain, duodenum, and rectum tissues were collected for viral load quantification and histopathological analysis.

[0031] Specific results can be found in Figure 10-14 shown.

[0032] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A Lassa virus mRNA vaccine targeting the prefusion conformation GPC, characterized in that: The amino acid sequence of the vaccine is shown in SEQ ID NO.1, and the nucleic acid sequence is shown in SEQ ID NO.

2.

2. A method for preparing the mRNA vaccine according to claim 1, characterized in that: The preparation method comprises the following steps: S1. Search the GPC amino acid sequences of different subtypes of LASV in NCBI and obtain the conserved GPC amino acid sequence as shown in SEQ ID NO.

5. S2. forming a stable pre-fusion conformation of GPC, and obtaining an amino acid sequence encoding the pre-fusion conformation of GPC as shown in SEQ ID NO.1; S3. The amino acid sequence encoding the pre-fusion conformation of GPC was codon-optimized according to human codon preference to obtain the DNA sequence shown in SEQ ID NO.

2. The DNA sequence was then constructed into the plasmid PUC57 containing a T7 promoter, 5'UTR, 3'UTR, and 100 PolyA residues to complete the plasmid construction; S4, amplifying and transcribing the successfully constructed plasmid to obtain mRNA; S5. The mRNA obtained above is prepared into lipid nanoparticles LNP by a microfluidic method.

3. The preparation method according to claim 2, wherein: The nucleotide sequence of the 5'UTR in step S3 is shown as SEQ ID NO.3, and the nucleotide sequence of the 3'UTR is shown as SEQ ID NO.

4.

4. The preparation method according to claim 2, wherein: The specific operation of transcription in step S4 is to use a commercial transcription kit vazyme#DD4203 for transcription, and to purify with RNA magnetic beads to obtain pure RNA.

5. The preparation method according to claim 2, characterized in that The specific method for preparing lipid nanoparticles LNP in step S5 includes the following steps: S5-1. Dissolve the mRNA in 50 mM citric acid buffer at pH 4, using a ratio of 1:8 between the phosphorus content of the mRNA and the nitrogen content of SM102 to obtain a final concentration of 108 ng / μL mRNA-citric acid solution. S5-2, prepare an anhydrous ethanol solution with a SM102 mass concentration of 50%, a DMG-PEG2000 mass concentration of 1.5%, a DSPC mass concentration of 10%, and a cholesterol mass concentration of 38.5% to obtain a lipid mixed solution; S5-3. The lipid mixed solution and the mRNA-citric acid solution were filtered through a 0.22 μm microporous filter membrane respectively, and mixed using a microfluidic instrument to obtain lipid nanoparticles LNP.

6. The preparation method according to claim 5, characterized in that: In step S5-3, the flow rate ratio of the mixing performed by the microfluidic instrument is 15 mL / min: 5 mL / min for the mRNA-citric acid solution: the lipid mixed solution.

Citation Information

Patent Citations

  • Chikungunya virus mRNA vaccine taking envelope protein as target and preparation method of chikungunya virus mRNA vaccine

    CN117771353A

  • Lassa virus envelope glycoprotein GP mutant and application thereof in preparation of Lassa vaccine

    CN118909054A

  • Lassa virus GPC protein pre-fusion conformation mutant and application thereof

    CN119552226A

  • Prefusion-stabilized lassa virus glycoprotein complex and its use

    US20240228549A1

  • Prefusion-stabilized lassa virus glycoprotein complex and its use

    WO2022232648A1