Application of combination of SIRT2 inhibitor and immune checkpoint inhibitor in preparation of colorectal cancer drugs

Abstract

The invention belongs to the field of biological medicine, and relates to application of an SIRT2 inhibitor in preparation of a colorectal cancer medicine combined with an immunotherapeutic agent and application of the immunotherapeutic agent in preparation of the colorectal cancer medicine combined with the SIRT2 inhibitor. The research finds that the SIRT2 inhibitor AGK2 and the PD-1 antibody are used for jointly treating a colorectal cancer mouse, an obvious anti-tumor effect is achieved, and the lifetime of the colorectal cancer model mouse is prolonged. When the SIRT2 inhibitor is combined with the immunotherapeutic agent to treat colorectal cancer, a synergistic effect is achieved. The invention has a good clinical application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to the use of a SIRT2 inhibitor combined with an immune checkpoint inhibitor in the preparation of colorectal cancer drugs. Background Art

[0002] Colorectal cancer (CRC) is one of the most common malignant tumors worldwide. With the development of science and technology, the treatment of colorectal cancer has evolved from surgery, chemotherapy, and radiotherapy to current biological targeted therapy and immunotherapy. Although the treatment model for colorectal cancer is still a comprehensive treatment model centered on surgery, a variety of new treatment methods such as immunotherapy have gradually gained attention due to their good efficacy. In the field of colorectal cancer, immune checkpoint inhibitors have shown relatively good efficacy in patients with MSI-H / dMMR, from the second-line treatment to the first-line treatment of advanced disease.

[0003] Anti-programmed cell death protein 1 (PD-1) therapy is a promising treatment for colorectal cancer, and its effectiveness depends primarily on the status of the mismatch repair (MMR) system. The MMR system is primarily composed of the MutSα (MSH2-MSH6) and MutLα (MLH1-PMS2) complexes, which work together to recognize and repair base mismatches during DNA replication, thereby ensuring the accurate transmission of genetic information.

[0004] However, approximately 95% of CRCs are mismatch repair-proficient (pMMR) and do not respond to immunotherapy. Summary of the Invention

[0005] In some embodiments, the present invention provides the use of a SIRT2 inhibitor in the preparation of a colorectal cancer medicament for use in combination with an immunotherapeutic agent.

[0006] In some embodiments, the present invention provides the use of an immunotherapeutic agent in the preparation of a colorectal cancer medicament for use in combination with a SIRT2 inhibitor.

[0007] In some embodiments, the SIRT2 inhibitor is a substance that inhibits SIRT2 protein activity, a substance that degrades SIRT2 protein, or a genetic tool that reduces SIRT2 protein levels.

[0008] In some embodiments, the substance that inhibits SIRT2 protein activity is selected from AGK2, SirReal2, Tenovin-1, Tenovin-3, Tenovin-6, SIRT-IN-4 or TM.

[0009] In some embodiments, the substance that inhibits SIRT2 protein activity is selected from AGK2.

[0010] In some embodiments, the chemical structure of AGK2 is as shown in Formula I:

[0011]

[0012] In some embodiments, the substance that inhibits SIRT2 protein activity further includes a SIRT2 blocking antibody.

[0013] In some embodiments, the substance that degrades SIRT2 protein comprises a SIRT2 protein degradation targeting chimera.

[0014] In some embodiments, the genetic tool for reducing SIRT2 protein levels is RNA interference, microRNA, gene editing, or gene knockout material.

[0015] In some embodiments, the RNA interference comprises the use of shRNA or siRNA.

[0016] In some embodiments, the sequence of the shRNA is SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

[0017] In some embodiments, the immunotherapeutic agent is an immunotherapeutic drug.

[0018] In some embodiments, the immunotherapeutic agent comprises an immune checkpoint inhibitor.

[0019] In some embodiments, the immune checkpoint inhibitor is selected from a PD-1 antibody, a PD-L1 antibody, or a CTLA-4 antibody.

[0020] In some embodiments, the immune checkpoint inhibitor is selected from a PD-1 antibody.

[0021] In some embodiments, the PD-1 antibody is selected from pembrolizumab, tislelizumab, slulizumab, putalizumab, or nivolumab.

[0022] In some embodiments, the PD-L1 antibody is selected from Envolimab.

[0023] In some embodiments, the CTLA-4 antibody is selected from ipilimumab.

[0024] In some embodiments, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.01-100.

[0025] In some embodiments, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.1-10.

[0026] In some embodiments, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.5-5.

[0027] In some embodiments, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:1.

[0028] In some embodiments, the colorectal cancer is selected from pMMR colorectal cancer or dMMR colorectal cancer.

[0029] In some embodiments, the colorectal cancer is selected from pMMR type colorectal cancer.

[0030] In some embodiments, the present invention provides a pharmaceutical composition for treating colorectal cancer, comprising:

[0031] (a) SIRT2 inhibitors.

[0032] In some embodiments, the SIRT2 inhibitor is a substance that inhibits SIRT2 protein activity, a substance that degrades SIRT2 protein, or a genetic tool that reduces SIRT2 protein levels.

[0033] In some embodiments, the substance that inhibits SIRT2 protein activity is selected from AGK2, SirReal2, Tenovin-1, Tenovin-3, Tenovin-6, SIRT-IN-4 or TM.

[0034] In some embodiments, the substance that inhibits SIRT2 protein activity is selected from AGK2.

[0035] In some embodiments, the chemical structure of AGK2 is as shown in Formula I:

[0036]

[0037] In some embodiments, the substance that inhibits SIRT2 protein activity further includes a SIRT2 blocking antibody.

[0038] In some embodiments, the substance that degrades SIRT2 protein comprises a SIRT2 protein degradation targeting chimera.

[0039] In some embodiments, the genetic tool for reducing SIRT2 protein levels is RNA interference, microRNA, gene editing, or gene knockout material.

[0040] In some embodiments, the RNA interference comprises the use of shRNA or siRNA.

[0041] In some embodiments, the sequence of the shRNA is SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

[0042] (b) Immunotherapeutic agents.

[0043] In some embodiments, the immunotherapeutic agent is an immunotherapeutic drug.

[0044] In some embodiments, the immunotherapeutic agent comprises an immune checkpoint inhibitor.

[0045] In some embodiments, the immune checkpoint inhibitor is selected from a PD-1 antibody, a PD-L1 antibody, or a CTLA-4 antibody.

[0046] In some embodiments, the immune checkpoint inhibitor is selected from a PD-1 antibody.

[0047] In some embodiments, the PD-1 antibody is selected from pembrolizumab, tislelizumab, slulizumab, putalizumab, or nivolumab.

[0048] In some embodiments, the PD-L1 antibody is selected from Envolimab.

[0049] In some embodiments, the CTLA-4 antibody is selected from ipilimumab.

[0050] In some embodiments, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.01-100.

[0051] In some embodiments, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.1-10.

[0052] In some embodiments, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.5-5.

[0053] In some embodiments, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:1.

[0054] In some embodiments, the colorectal cancer is selected from pMMR colorectal cancer or dMMR colorectal cancer.

[0055] In some embodiments, the colorectal cancer is selected from pMMR type colorectal cancer.

[0056] In some embodiments, the present invention provides a pharmaceutical kit comprising:

[0057] (a) SIRT2 inhibitors.

[0058] In some embodiments, the SIRT2 inhibitor is a substance that inhibits SIRT2 protein activity, a substance that degrades SIRT2 protein, or a genetic tool that reduces SIRT2 protein levels.

[0059] In some embodiments, the substance that inhibits SIRT2 protein activity is selected from AGK2, SirReal2, Tenovin-1, Tenovin-3, Tenovin-6, SIRT-IN-4 or TM.

[0060] In some embodiments, the substance that inhibits SIRT2 protein activity is selected from AGK2.

[0061] In some embodiments, the chemical structure of AGK2 is as shown in Formula I:

[0062]

[0063] In some embodiments, the substance that inhibits SIRT2 protein activity further includes a SIRT2 blocking antibody.

[0064] In some embodiments, the substance that degrades SIRT2 protein comprises a SIRT2 protein degradation targeting chimera.

[0065] In some embodiments, the genetic tool for reducing SIRT2 protein levels is RNA interference, microRNA, gene editing, or gene knockout material.

[0066] In some embodiments, the RNA interference comprises the use of shRNA or siRNA.

[0067] In some embodiments, the sequence of the shRNA is SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

[0068] (b) Immunotherapeutic agents.

[0069] In some embodiments, the immunotherapeutic agent is an immunotherapeutic drug.

[0070] In some embodiments, the immunotherapeutic agent comprises an immune checkpoint inhibitor.

[0071] In some embodiments, the immune checkpoint inhibitor is selected from a PD-1 antibody, a PD-L1 antibody, or a CTLA-4 antibody.

[0072] In some embodiments, the immune checkpoint inhibitor is selected from a PD-1 antibody.

[0073] In some embodiments, the PD-1 antibody is selected from pembrolizumab, tislelizumab, slulizumab, putalizumab, or nivolumab.

[0074] In some embodiments, the PD-L1 antibody is selected from Envolimab.

[0075] In some embodiments, the CTLA-4 antibody is selected from ipilimumab.

[0076] In some embodiments, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.01-100.

[0077] In some embodiments, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.1-10.

[0078] In some embodiments, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.5-5.

[0079] In some embodiments, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:1.

[0080] In some embodiments, the SIRT2 inhibitor and the immunotherapeutic agent are packaged separately in the pharmaceutical set.

[0081] In some embodiments, the pharmaceutical set is for treating colorectal cancer.

[0082] In some embodiments, the colorectal cancer is selected from pMMR colorectal cancer or dMMR colorectal cancer.

[0083] In some embodiments, the colorectal cancer is selected from pMMR type colorectal cancer.

[0084] In some embodiments, the pharmaceutical composition or the pharmaceutical set further comprises a pharmaceutically acceptable carrier.

[0085] In some embodiments, the present invention provides a use of a detection reagent for a neoantigen in the preparation of a kit for predicting or judging the therapeutic effect of colorectal cancer, wherein the amino acid sequence of the neoantigen is LYCTGKSYL.

[0086] In some embodiments, the colorectal cancer is selected from pMMR colorectal cancer or dMMR colorectal cancer.

[0087] In some embodiments, the colorectal cancer is selected from pMMR type colorectal cancer.

[0088] In some embodiments, the drug for treating colorectal cancer includes a SIRT2 inhibitor.

[0089] In some embodiments, the treatment comprises immunotherapy.

[0090] In some embodiments, the colorectal cancer treatment drug includes a SIRT2 inhibitor and an immunotherapeutic agent.

[0091] In some embodiments, the SIRT2 inhibitor is a substance that inhibits SIRT2 protein activity, a substance that degrades SIRT2 protein, or a genetic tool that reduces SIRT2 protein levels.

[0092] In some embodiments, the substance that inhibits SIRT2 protein activity is selected from AGK2, SirReal2, Tenovin-1, Tenovin-3, Tenovin-6, SIRT-IN-4 or TM.

[0093] In some embodiments, the substance that inhibits SIRT2 protein activity is selected from AGK2.

[0094] In some embodiments, the chemical structure of AGK2 is as shown in Formula I:

[0095]

[0096] In some embodiments, the substance that inhibits SIRT2 protein activity further includes a SIRT2 blocking antibody.

[0097] In some embodiments, the substance that degrades SIRT2 protein comprises a SIRT2 protein degradation targeting chimera.

[0098] In some embodiments, the genetic tool for reducing SIRT2 protein levels is RNA interference, microRNA, gene editing, or gene knockout material.

[0099] In some embodiments, the RNA interference comprises the use of shRNA or siRNA.

[0100] In some embodiments, the sequence of the shRNA is SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.

[0101] In some embodiments, the immunotherapeutic agent is an immunotherapeutic drug.

[0102] In some embodiments, the immunotherapeutic agent comprises an immune checkpoint inhibitor.

[0103] In some embodiments, the immune checkpoint inhibitor is selected from a PD-1 antibody, a PD-L1 antibody, or a CTLA-4 antibody.

[0104] In some embodiments, the immune checkpoint inhibitor is selected from a PD-1 antibody.

[0105] In some embodiments, the PD-1 antibody is selected from pembrolizumab, tislelizumab, slulizumab, putalizumab, or nivolumab.

[0106] In some embodiments, the PD-L1 antibody is selected from Envolimab.

[0107] In some embodiments, the CTLA-4 antibody is selected from ipilimumab.

[0108] In some embodiments, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.01-100.

[0109] In some embodiments, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.1-10.

[0110] In some embodiments, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.5-5.

[0111] In some embodiments, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:1.

[0112] In some embodiments, the neoantigen is derived from a GBP7 mutation.

[0113] In some embodiments, the neoantigen is derived from the GBP7 c.142C>T mutation.

[0114] In some embodiments, the detection reagent is an antibody, a functional fragment of an antibody, or a conjugated antibody that detects a neoantigen.

[0115] In some embodiments, the conjugated antibody is a fluorescein-conjugated antibody or a biological enzyme-conjugated antibody.

[0116] In some embodiments, the detection method is immunohistochemistry, immunofluorescence, liquid chromatography, mass spectrometry, protein immunoblotting, or enzyme-linked immunosorbent assay.

[0117] In some embodiments, the kit is a kit for enzyme-linked immunosorbent assay, protein / peptide chip detection, liquid chromatography, mass spectrometry, immunoblotting, microbead immunoassay, or microfluidic immunoassay.

[0118] In some embodiments, mice bearing colorectal cancer were treated with AGK2, and the neoantigen LYCTGKSYL was detected in the mouse tumors, suggesting that inhibiting SIRT2 may enhance the response of colorectal cancer to immunotherapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0119] Figures 1A-1H SIRT2 or AGK2 knockdown in colorectal cancer cells promoted CD8 + T cell migration, activation and killing ability. (1A) is the extracted mouse CD8 + Purity of T cells; (1B) is the image of control or treated colorectal cancer cells and CD8 + Images of T cells directly co-cultured for 6 hours; (1C) is CD8 + The ratio of T cells that were chemotactic from the upper chamber to the lower chamber by the culture supernatant of control or treated colorectal cancer cells or organoids; (1D) is CD8 + The proliferation index of T cells and control or treated colorectal cancer cells after 48 hours of co-culture; (1E) is the CD8 + Apoptosis rate of T cells and control or treated colorectal cancer cells or organoids after 48 hours of co-culture; (1F) is CD8 + The proportion of T cells expressing GZMB, IFNγ, and PD-1 after 48 hours of co-culture with control or treated colorectal cancer cells or organoids; (1G) is CD8 + The survival rate of colorectal cancer cells after 48 hours of co-culture of T cells with control or treated colorectal cancer cells; (1H) is the CD8 + Organoid death after 48 hours of co-culture of T cells with control or treated colorectal cancer organoids.

[0120] Figures 2A-2H SIRT2 inhibition or AGK2 treatment inhibits colorectal cancer growth, activates the immune microenvironment, and produces new antigens. (2A) shows the weight and volume of colorectal tumors in mice when SIRT2 is knocked down or inhibited; (2B) shows the expression of GZMB and IFNγ in colorectal tumors in mice when SIRT2 is knocked down or inhibited; (2C) shows the immunohistochemical detection of CD45 in colorectal tumors in mice when SIRT2 is knocked down or inhibited + 、CD8 + 、GZMB + (2D) Multiple immunofluorescence detection of CD45 in mouse colorectal tumors when SIRT2 was knocked down or inhibited + 、CD45 + CD8 + 、CD45 + CD8 + GZMB + 、CD45 + CD8 + PD-1 + (2E) is a flow chart for detecting new antigens in mouse colorectal tumors after SIRT2 inhibitor treatment; (2F) is a flow chart for mouse CD8+ The proliferation index of T cells after being stimulated by tumor neoantigens for 48 hours; (2G) is the proliferation index of mouse CD8 + The proportion of T cells expressing GZMB, IFNγ, and PD-1 48 hours after being stimulated by tumor neoantigens; (2H) is the percentage of mouse CD8 + T cells were stimulated with tumor neoantigens for 48 hours and then co-cultured with colorectal cancer cells for 48 hours to determine the survival rate of colorectal cancer cells.

[0121] Figures 3A-3H The results showed that the combined use of AGK2 and PD-1 antibodies significantly inhibited the growth of colorectal cancer and prolonged the survival of mice. (3A) The size of the colorectal tumor volume of mice after treatment with different treatment regimens; (3B) The changes and comparison of the colorectal tumor volume of mice under different treatment regimens; (3C) The changes in the tumor volume of the other three groups compared with the tumor volume of the Vehicle+αlgG group, where each column represents an individual mouse; (3D) The effect of different treatment regimens on the survival rate of mice with colorectal cancer; (3E) The effect of different treatment regimens on the body weight of mice with colorectal cancer; (3F) The effect of different treatment regimens on the liver, kidney and spleen of mice with colorectal cancer; (3G) The effect of different treatment regimens on the expression of CD45 in the colorectal tumor site of mice. + Immune cells and CD8 + Effects of different treatment regimens on T cell infiltration; (3H) Effects of different treatment regimens on CD45 in colorectal tumor sites in mice + Immune cells, CD45 + CD8 + cells, CD45 + CD8 + GZMB + cells and CD45 + CD8 + PD-1 + Effect of cell infiltration; (3I) colorectal cancer organoids and autologous CD8 + After 14 days of co-culture of T cells, CD8 + The proportion of T cells expressing GZMB and IFNγ.

[0122] Figures 4A-4B The SIRT2 level in clinical colorectal cancer samples is correlated with CD8 + T cell infiltration was significantly negatively correlated. (4A) shows the different SIRT2 expression levels and CD8 + The effect of cell infiltration on metastasis-free survival of patients with colorectal cancer; (4B) shows the effect of different SIRT2 expression levels on CD8 + cells, CD8 + GZMB + cells and CD8+ PD-1 + The influence of cell infiltration. DETAILED DESCRIPTION

[0123] The following is a detailed description of the technical solution of the present invention, which does not limit the scope of protection of the present invention. Non-essential modifications and adjustments made by others based on the concept of the present invention still fall within the scope of protection of the present invention.

[0124] In this article, the professional terms in this field are explained as follows:

[0125] Mismatch repair (MMR): A repair method that restores the nucleotide sequence to normal in DNA molecules containing mismatched bases. The MMR system can involve multiple mismatch repair proteins when participating in DNA repair, including two major families: MutS (MSH2, MSH3, and MSH6, etc.) and MutL (MLH1, MLH3, PMS1, and PMS2). Among them, MLH1, MSH2, MSH6, and PMS2 are the dominant proteins of MMR. The lack of expression of ≥1 of these four major MMR proteins is considered mismatch repair gene deficiency (dMMR), while all positive are considered mismatch repair gene integrity (pMMR).

[0126] Organoids: Organoids derived from the body's own tissue or stem cells, formed through three-dimensional in vitro culture to form tissue analogs with a defined spatial structure. Patient-derived organoids (PDOs) are obtained by culturing tissue from a biopsy, biopsy, or surgical resection in Matrigel for several weeks.

[0127] Neoantigens are mutated peptides derived from genetic alterations in the tumor genome that are specifically expressed in tumor cells and absent in normal tissues.

[0128] Clean reads: high-quality sequencing data after filtering, which includes removing sequences with adapters and removing low-quality sequences.

[0129] Mapping: Mapping is the process of matching the short sequences (reads) obtained by sequencing with known sequences in a reference genome or transcriptome. The purpose of this process is to determine the position of each read in the reference sequence.

[0130] Bone marrow-derived dendritic cells (BMDs): A population of cells derived from bone marrow progenitor cells and immature myeloid cells. They are the body's most powerful professional antigen-presenting cells, efficiently taking up, processing, and presenting antigens, activating naive T cells and initiating and regulating immune responses. Mature BMDs have pseudopodia or dendritic processes on their surface.

[0131] Infiltration: The phenomenon of other cell types entering tumor tissue. The infiltration of immune cells into the tumor is called tumor immune infiltration.

[0132] Tissue chip: A tissue slice made by arranging dozens to thousands of small tissue specimens in a regular array on the same carrier.

[0133] Distant Metastasis Free Survival (DMFS): refers to the time from disease diagnosis to tumor metastasis or death, whichever occurs first (for patients lost to follow-up, the last follow-up time is used; for patients without metastasis at the end of the study, the end of follow-up time is used).

[0134] Experimental instruments and materials:

[0135] Kits: EasySep Mouse CD8a Positive Selection Kit II (Cat. No. 18953), EasySep Human CD8 Positive Selection Kit II (Cat. No. 17853), Celltrace violet cell proliferation kit (Cat. No. C34571) from Thermo Fisher Scientific; Annexin V-FITC apoptosis kit (Cat. No. AP101-100-AVF) from Lianke Bio; Fixable Viability Stain 700 (dilution ratio 1:1,000, Cat. No. 564997), Cytofix / Cytoperm TM Fixation / Permeabilization Kit (Cat. No. 554714) and Propidium Iodide (Cat. No. 556463) were from BD Pharmingen; Multiplex Fluorescent Immunohistochemistry Staining Kit (Cat. No. TGT7C100) was from TissueGnostics.

[0136] Antibody:

[0137] Flow cytometry antibodies: mouse CD45 flow cytometry antibody (catalog number 103155), mouse CD8 flow cytometry antibody (catalog number 100734), mouse PD-1 flow cytometry antibody (catalog number 551892), and mouse IFNγ flow cytometry antibody (catalog number 505810) were from BD Pharmingen, with a dilution ratio of 1:100; human CD8 flow cytometry antibody (catalog number 301008), human PD-1 flow cytometry antibody (catalog number 329950), human IFNγ flow cytometry antibody (catalog number 506542), and human or mouse GZMB flow cytometry antibody (catalog number 372214) were from BioLegend, with a dilution ratio of 1:100.

[0138] Immunohistochemistry or multiplex fluorescent immunohistochemistry antibodies: CD45 antibody (catalog number DF6839) and CD8 antibody (catalog number AF5126) were from Affinity Biosciences, diluted at a ratio of 1:1,000; PD-1 antibody (catalog number SAB3500123) was from Sigma-Aldrich, diluted at a ratio of 1:400; CD8 antibody (catalog number 217344) and SIRT2 antibody (catalog number ab211033) were from Abcam, diluted at a ratio of 1:1,000; GZMB antibody (catalog number 46890, diluted at a ratio of 1:200) was from Cell Signaling Technology; CK19 antibody (catalog number ZA-0074, diluted at a ratio of 1:400) was from Zhongshan Jinqiao.

[0139] Other antibodies: Mouse CD3 antibody (Cat. No. 05112-25-500) and CD28 antibody (Cat. No. 10312-25-500) were from PeproTech; mouse PD-1 antibody (Cat. No. BE0146) and isotype IgG antibody (Cat. No. BE0089) were from BioXCell; human PD-1 antibody (Cat. No. A2002) and isotype IgG antibody (Cat. No. A2052) were from Selleck.

[0140] Other reagents and materials: ImmunoCult-XF T cell expansion medium (Cat. No. 10981), SepMate centrifuge tubes (Cat. No. 85450), human T cell activator (Cat. No. 10970), and human IL-2 (Cat. No. 78036) were from STEMCELL Technologies; mouse IL-2 (Cat. No. 212-12-5), mouse IL-4 (Cat. No. 214-14-20), and mouse granulocyte-macrophage colony-stimulating factor (Cat. No. 315-03-20) were from Peprotech; human peripheral blood lymphocyte separation medium (Cat. No. 100-306) was from GOONIE; tumor tissue digestion medium (Cat. No. R6001) and human colorectal cancer organoid culture medium (Cat. No. M20025) were from Mingao; Matrigel (Cat. No. 356231) and Transwell 24-well cell culture inserts (Cat. No. 3521) were from Corning; 70 μm and 100 μm filters were from Biosharp; myristoyl phorbol ethyl ester (Cat. No. sc-3576) and ionomycin (Cat. No. 56092-82-1) were from Meilunbio; brefeldin A (Cat. No. M2294) was from Abmole; ReverTra qRT-PCR RT Master Mix (Product No. FSQ-301) was from TOYOBO; FastStart Essential DNA Green Masterkit (Product No. 06924204001) was from Roche; lipopolysaccharide (Product No. S1732) was from Beyotime; AGK2 (Product No. S7577) and PEG300 (Product No. S6704) were from Selleck.

[0141] BALB / cJGpt female mice were obtained from Guangdong Yaokang Biotechnology Co., Ltd.

[0142] CT26 cells were obtained from ATCC (American Type Culture Collection, catalog number CRL-2639).

[0143] In the following examples herein, the gene tool used for knockdown of SIRT2 in CT26 cells is shRNA, and the sequences of the gene tool shSIRT2 are GAGCAGTGTCAGAGTGTGGTA (SEQ ID NO: 1), AACCATCTGCCACTACTTCAT (SEQ ID NO: 2), and GGGCCTATGGCTAAATCAAAT (SEQ ID NO: 3).

[0144] In the examples herein, the shSIRT2 used is GAGCAGTGTCAGAGTGTGGTA (SEQ ID NO: 1).

[0145] In the examples herein, the GFP-tagged GV248 empty plasmid and the GFP-tagged GV248 plasmid with the shSIRT2 (SEQ ID NO: 1) sequence inserted were from Shanghai GeneCare Gene. The transfection reagent used was Lipofectamine 3000 (Invitrogen, Cat. No. L3000015). For specific steps, please refer to the product manual.

[0146] In the examples herein, the sequences of shRNA and primers are 5'→3' from left to right.

[0147] In the examples herein, the sequence of the neoantigen peptide is LYCTGKSYL (SEQ ID NO: 4), and the sequence of the wild-type peptide is LYRTGKSYL (SEQ ID NO: 5), both of which are derived from Shanghai Sangon Biotechnology.

[0148] In the examples herein, PD-1 antibodies can be used interchangeably with αPD-1; IgG antibodies can be used interchangeably with αIgG.

[0149] In the examples herein, the migration experiments of mouse CT26 and human colorectal cancer organoids were performed by indirect co-culture. The upper chambers were replaced with serum-free 1640 medium, and the lower chambers used the culture supernatants of mouse CT26 (1640 medium containing 20 ng / mL mouse IL-2 and 10% FBS) and human colorectal cancer organoids (complete human colorectal cancer organoid medium) cultured for 48 hours, respectively.

[0150] In the other direct co-culture experiments in the examples herein, mouse CT26-CD8 + T cells were cultured in 1640 medium supplemented with 20 ng / mL murine IL-2 and 10% FBS; human colorectal cancer organoids - CD8 + T cells were grown in a 1:1 (v / v) mixture of complete human colorectal cancer organoid culture medium and ImmunoCult-XF T Cell Expansion Medium.

[0151] In the examples herein, the colorectal cancer type of the CT26 cells and organoids described in Examples 1-3 is pMMR.

[0152] In the examples herein, clinical colorectal cancer tissue chip samples were obtained from the Sixth Affiliated Hospital of Sun Yat-sen University.

[0153] All animal experimental protocols in the examples herein were approved by the Experimental Animal Ethics Committee of the Sixth Affiliated Hospital of Sun Yat-sen University.

[0154] In the examples herein, AGK2 was dissolved in equal doses of DMSO, which was the same DMSO concentration as that used in the AGK2 group (i.e., when AGK2 was 40 μM, DMSO was also 40 μM; when AGK2 was 0.7 μM, DMSO was also 0.7 μM). In in vivo experiments, the DMSO used was an undiluted DMSO stock solution.

[0155] Example 1: Tumor-promoting CD8 Tumours Treated by Knockdown of SIRT2 or AGK2 + T cell migration, activation and killing ability

[0156] 1. Experimental methods

[0157] (1) Mouse CD8 + T cell extraction and activation

[0158] BALB / cJGpt female mice (6 to 8 weeks old) were purchased, spleens were isolated, ground and filtered through a 70 μm filter, and CD8 was extracted using the EasySepMouse CD8aPositive Selection Kit II. + T cells, the steps are as follows: 1×10 8 Add 100 cells / mL to a 5mL flow tube, add FcR blocker (10 μL / mL), add Selection Cocktail at a ratio of 50 μL / mL, mix well and incubate at room temperature for 3 minutes; add RapidSpheres (40 μL / mL), mix well and incubate at room temperature for 3 minutes, use PBS + 2% fetal bovine serum to make up the sample system to 2.5mL, and use a rinsed pipette to gently mix; place the flow tube (without the lid) in a magnet and incubate at room temperature for 3 minutes, keeping the flow Insert the flow tube into the magnet, tilt the entire magnet and flow tube, discard the supernatant, and keep the target cells in the flow tube. Keep the tilted posture for 1-2 seconds and let it flow down naturally; remove the flow tube from the magnet, repeat three times to replenish PBS + 2% fetal bovine serum and subsequent steps, resuspend the extracted cells in RPMI-1640 medium containing 10% fetal bovine serum and 20ng / mL mouse IL-2, take a small amount of cells and use specific primary antibodies CD45 and CD8 to stain for 30 minutes, and use Beckman flow cytometer to detect CD8 + T cell purity. Six-well plates were pre-incubated with 3 mL of PBS containing 5 μg / mL CD3 and 2 μg / mL CD28 mouse antibodies at 4°C overnight. Mouse CD8 + T cells, a large number of activated mouse CD8 + T cells.

[0159] (2) Human CD8+ T cell extraction and activation

[0160] Peripheral blood mononuclear cells (PBMCs) were isolated from human peripheral blood using SepMate centrifuge tubes and human peripheral blood lymphocyte separation medium. The steps are as follows: Pipette 15 mL of human peripheral blood lymphocyte separation medium and carefully add it to a 50 mL test tube through the central hole of the SepMale plug-in. Pour 10 mL of blood into a 50 mL centrifuge tube, and dilute the blood sample with an equal volume of PBS + 2% fetal bovine serum. The SepMate test tube was vertical, and the pipette was tilted 45° to add the diluted blood sample along the wall of the test tube, and centrifuged at 1200 g for 10 minutes. Quickly pour out the upper layer of liquid into a new 50 mL test tube, wash it once with an equal amount of PBS + 2% fetal bovine serum, and centrifuge at 300 g at room temperature for 8 minutes to obtain PBMCs. CD8 was extracted using the EasySep Human CD8 Positive Selection Kit II. + T cells. PBMC were cultured at 1×10 8 Resuspend the cells at a concentration of 1 mL / mL in PBS + 2% fetal bovine serum (FBS) and transfer to a flow cytometer. Add 100 μL / mL of the Selection Cocktail antibody cocktail, mix, and incubate at room temperature for 3 minutes. Add 100 μL / mL of RapidSpheres magnetic beads, mix, and incubate at room temperature for 3 minutes. Bring the volume to 2.5 mL with PBS + 2% FBS. Gently pipette up and down 2-3 times. Place the tube in a magnet and incubate at room temperature for 10 minutes. Carefully aspirate and discard the supernatant. Repeat this step three times. Harvest the cells from the tube walls and resuspend them in ImmunoCult-XF T Cell Expansion Medium supplemented with 10 ng / mL human IL-2 and 25 μL / mL human T cell activator.

[0161] (3) Extraction of human colorectal cancer organoids

[0162] Human colorectal cancer tissue was washed with PBS containing 3% double-antibody, minced, and transferred to a 15mL centrifuge tube. 3mL of tumor tissue digestion solution was added and incubated in a water bath for 30 minutes. The tissue was then terminated with 3mL of DMEM medium containing 10% serum and mixed thoroughly. The tissue was then centrifuged at 300g for 4 minutes. The tissue was resuspended in 5mL of PBS, mixed thoroughly, filtered through a 100μm filter, transferred to a new 15mL centrifuge tube, and centrifuged at 300g for 4 minutes. The supernatant was discarded, and the cell pellet was resuspended in 3 volumes of Matrigel. 30μL / well of the cell suspension was plated in a 24-well plate and incubated in a humidified incubator for 20 minutes. After the gel solidified, 2.5mL of complete human colorectal cancer organoid medium was added and cultured for several days to obtain human colorectal cancer organoids.

[0163] (4) Experimental groups

[0164] Ctrl group: CT26 cells stably transfected with GFP-tagged GV248 empty plasmid;

[0165] Sirt KD Group: CT26 cells stably transfected with the GV248 plasmid inserted with the shSIRT2 (SEQ ID NO: 1) sequence and tagged with GFP;

[0166] Vehicle group: CT26 cells / organoids were treated with solvent DMSO for 24 hours;

[0167] AGK2 group: CT26 cells were treated with 40 μM AGK2 for 24 h or organoids were treated with 0.7 μM AGK2 for 24 h.

[0168] Among them, the CT26 cells in the Vehicle group and the AGK2 group were stably transfected with the GFP-labeled GV248 empty plasmid.

[0169] (5)CD8 + T cell migration assay

[0170] CT26 cells (GFP, green light) treated with different treatments (see experimental groups for treatment methods) were directly + T cells (Celltrace violet, staining procedures see product instructions, blue light) were co-cultured at a ratio of 1:10 for 6 hours, and the co-culture was observed using a PerkinElmer high-content instrument.

[0171] For migration rate assay, 20,000 CT26 cells or organoids were seeded in 12-well plates, and after culturing for 24 hours, equal doses of DMSO or AGK2 (40 μM AGK2 for CT26, 0.7 μM AGK2 for organoids) were added, and named as Vehicle group and AGK2 group, respectively; or control or SIRT2 knockdown stable CT26 cells were directly seeded, and named as Ctrl group and Sirt group. KD After 24 hours, the supernatant was collected and added to the lower chamber of a 5 μm pore size Transwell 24-well cell culture chamber (700 μL / well), and 2×10 5 The activated homologous CD8 obtained by step (1) or (2) + T cells (100 μL serum-free RPMI-1640 medium / well), after 6 hours, the culture medium of the upper and lower chambers was collected, centrifuged at 300 g for 5 minutes, and counted using a Nexcelom cell counting chamber. + The T cell migration rate was calculated by dividing the number of cells in the lower chamber by the sum of the number of cells in the upper and lower chambers.

[0172] (6)CD8 + T cell proliferation assay

[0173] CT26 cells treated with equal doses of DMSO or 40 μM AGK2, control cells, or stable CT26 cells with SIRT2 knockdown were seeded in 12-well plates. After 24 hours, mouse CD8 + T cells were co-incubated at a ratio of T cells to tumor cells = 10 or 5:1, and the cells were recovered for 48 hours. Mouse CD8 + T cells were stained with Celltrace violet and the proliferation index was analyzed.

[0174] (7)CD8 + T cell apoptosis assay

[0175] CT26 cells or organoids treated with equal doses of DMSO or AGK2 (40 μM AGK2 for CT26, 0.7 μM AGK2 for organoids), control or SIRT2 knockdown stable CT26 cells were seeded in 12-well plates, and syngeneic CD8 + T cells were co-incubated at a ratio of T cells to tumor cells of 10:1 for 48 hours, and the cells were recovered and stained using the Annexin V-FITC apoptosis kit. CD8 + T cell staining, the proportion of APC-positive cells is the apoptosis rate.

[0176] (8)CD8 + T cell activation assay

[0177] CT26 cells or organoids treated with equal doses of DMSO or AGK2 (40 μM AGK2 for CT26, 0.7 μM AGK2 for organoids), control or SIRT2 knockdown stable CT26 cells were seeded in 12-well plates, and syngeneic CD8 + T cells were co-incubated at a ratio of T cells to tumor cells of 10:1 for 48 hours and then recovered. 6 hours before recovery, 50 ng / mL myristoylphorbol ethyl ester, 1 μg / mL ionomycin, and 5 μg / mL brefeldin A were added to the culture medium. After recovery, the cells were washed once with DPBS and stained with Fixable Viability Stain 700 for 15 minutes. After washing once with DPBS, CD8 and PD-1 antibodies were added for 30 minutes. After washing once with DPBS, 250 μL Cytofix / Cytoperm TMThe membrane was fixed and permeabilized with the fixative in the Fixation / Permeabilization Kit for 20 minutes, washed once with the Washing buffer in the kit, and then stained with GZMB and IFNγ antibodies for 30 minutes. The membrane was then washed once with 500 μL of Washing buffer and resuspended in 500 μL of Washing buffer. CD8 was detected using a Beckman flow cytometer. + Staining of various T cell indicators.

[0178] (9) Tumor cell survival rate detection

[0179] CT26 cells treated with equal doses of DMSO or 40 μM AGK2, control cells, or stable CT26 cells with SIRT2 knockdown were seeded in 12-well plates, and mouse CD8 + T cells were co-incubated at a ratio of T cells to tumor cells of 10:1. After 48 hours, the supernatant was removed, and cell debris was washed with PBS. The survival of tumor cells was imaged using the Incucyte system (Essen Bioscience), and the growth area was calculated. The vehicle group was defined as having a 100% survival rate.

[0180] (10) Organoid mortality detection

[0181] Organoids treated with equal doses of DMSO or 0.7 μM AGK2 were seeded in 12-well plates, and human CD8 + T cells were co-incubated at a ratio of T cells to tumor cells = 10:1. + Organoids pretreated with an equal dose of DMSO or 0.7 μM AGK2 for 24 hours with T cells served as the control group. 5 μL / mL Propidium Iodide dye was added to the culture medium, and the co-culture status was imaged using a PerkinElmer high-content instrument.

[0182] 2. Experimental results

[0183] Extraction of mouse CD8 + The purity of T cells was Figure 1A First, the Transwell assay revealed that after co-culture with SIRT2 knockdown or AGK2 treated tumor supernatants, CD8 + The migration ability of T cells was significantly enhanced ( Figures 1B-1C Using Celltrace violet dye, we demonstrated that SIRT2 knockdown or AGK2-treated tumors significantly enhanced CD8 + T cell proliferation capacity ( Figure 1D), Annexin V-FITC apoptosis kit and cytokine staining experiments demonstrated that SIRT2 knockdown or AGK2-treated tumors significantly upregulated CD8 + T cell apoptosis ( Figure 1E ) and activity ( Figure 1F ), CD8 + The upregulation of T cell activity is mainly reflected in the increased secretion of GZMB, IFNγ, PD-1 and other molecules. It is speculated that CD8 + T cells increased their own apoptosis and early exhaustion levels due to their anti-tumor activity. By photographing tumor survival, it was verified that SIRT2 knockdown or AGK2-treated tumor cells activated CD8 + T cells cause a decrease in their own survival ( Figure 1G ). Propidium Iodide staining further demonstrated that and CD8 + When co-cultured with T cells, AGK2-treated organoids showed increased death ( Figure 1H ).

[0184] Example 2 SIRT2 knockdown or AGK2 treatment inhibits colorectal cancer growth and produces tumor neoantigens

[0185] 1. Experimental methods

[0186] (1) Mouse colorectal cancer subcutaneous tumor model

[0187] 2×10 5 SIRT2 knockdown CT26 cells and wild-type CT26 cells were injected subcutaneously into the right flank of 6- to 8-week-old BALB / cJGpt female mice (8 mice / group). KD group and Ctrl group for observation.

[0188] 2×10 5 Wild-type CT26 colorectal cancer cells were injected into the right flank of 6- to 8-week-old BALB / cJGpt female mice. After 7 days, the tumors grew to 100 mm. 3 The rats were equally divided into two groups (Vehicle and AGK2) (6 rats / group), and Vehicle or AGK2 was intraperitoneally administered every day.

[0189] The administration method was as follows: Vehicle or DMSO group: 200 μL of the volume ratio formula of 8% DMSO + 30% PEG300 + 62% ddH2O was injected daily; AGK2 group: 10 mg / kg AGK2 was injected intraperitoneally daily according to the average weight of the mice, AGK2 was dissolved in DMSO to prepare AGK2 DMSO solution, and the solution was injected with the volume ratio formula of 8% AGK2 DMSO solution + 30% PEG300 + 62% ddH2O, with a total injection volume of 200 μL.

[0190] The weight of the mice and the length and width of the tumor were measured every two days, and the tumor volume was calculated as (length × width × width) × 0.5. The tumor length or width reached 2 cm, and the tumor volume reached 2,000 mm. 3 Tumors were recovered upon rupture or tumor rupture for weighing, volume measurement, and subsequent experiments. All mice were housed and maintained under specific pathogen-free conditions.

[0191] (2) Real-time fluorescence quantitative PCR

[0192] Take Ctrl group, Sirt2 KD 100 mg of tumor tissue from mice in the control, vehicle, and AGK2 groups was homogenized with 1 mL of TRizol for 2 minutes and allowed to stand at room temperature for 5 minutes. The homogenate was centrifuged at 12,000 g for 5 minutes at 2-8°C. The clarified homogenate was then added with 0.2 mL of chloroform, vortexed at high speed for 30 seconds, and allowed to stand at room temperature for 10 minutes. The homogenate was centrifuged at 12,000 g for 15 minutes at 2-8°C. The colorless aqueous phase (RNA) was transferred to a new 1.5 mL EP tube, 0.5 mL of isopropanol was added, the tube was shaken, and allowed to stand at room temperature for 10 minutes. After centrifugation at 12,000 g for 10 minutes at 2-8°C, the supernatant was discarded, leaving the gelatinous precipitate at the bottom of the tube and washed thoroughly with 1 mL of 75% ethanol. Centrifuge at 2-8°C, 12,000 g for 5 minutes, discard the supernatant, open the EP tube cap and ventilate for at least 20 minutes to evaporate the residual liquid, until the precipitate becomes translucent, add 20 μL of DEPC water to dissolve it, and quantify it. Take 1 μg for reverse transcription. For detailed reverse transcription steps, see ReverTra qRT-PCR RTMaster Mix instructions. Prepare the PCR reaction system according to the instructions of FastStart Essential DNA Green Master kit. PCR reaction was performed using 96SW 1.1. instrument (Roche). GAPDH was set as internal reference and the Ct value (2 -ΔΔCt ) Relative quantification of mRNA expression.

[0193] The upstream primer for GAPDH is CCTCTGGAAAGCTGTGGCGTG (SEQ ID NO: 6), and the downstream primer is GCCAGTGAGCTTCCCGTTCAG (SEQ ID NO: 7). The upstream primer for GZMB is GACAACACTCTTGACGCTG (SEQ ID NO: 8), and the downstream primer is GATGATCTCCCCTGCCTTTG (SEQ ID NO: 9). The upstream primer for IFNγ is ATGAACGCTACACACTGCATC (SEQ ID NO: 10), and the downstream primer is CCATCCTTTTGCCAGTTCCTC (SEQ ID NO: 11).

[0194] (3) Immunohistochemistry

[0195] Tumor tissue was sent to Sevier Biosciences for sectioning. After baking at 60°C for 16–18 hours, the sections were dewaxed three times with xylene (15 minutes each) and then rehydrated with a gradient of alcohols: 15 minutes in absolute ethanol, 5 minutes in 95% ethanol, 5 minutes in 75% ethanol, and two 5-minute washes in PBS. Sodium citrate fixative (pH 8.0) was pre-boiled and placed on the sections. Microwaved on high for 5 minutes until boiling, then lowered to low for 10 minutes. The sections were then cooled naturally for 0.5–1 hour until completely cold. The sections were then washed twice with PBS (5 minutes each). The sections were then dried and circled with a dedicated IHC marker pen. The sections were then soaked in 3% hydrogen peroxide for 10 minutes and then washed twice with distilled water (5 minutes each). Goat serum was diluted 20-fold with PBS and applied dropwise to the sections for blocking at room temperature for 1 hour. The sections were then dried and 30 μL of a mixture of CD45, CD8, and GZMB antibodies diluted in antibody diluent was added dropwise. The sections were incubated overnight at 4°C in a humidified chamber. The next day, the wet box was removed, rewarmed at room temperature for 30 minutes, and washed twice with PBS (5 minutes / time). Secondary antibody was added, incubated at room temperature for 15 minutes, and washed twice with PBS (5 minutes / time). The DAB reagent was diluted 20 times with staining buffer, added dropwise and covered on the slices, color developed for 30-60 seconds, and washed twice with PBS (5 minutes / time). Soak in hematoxylin for 1 minute, then rinse slowly with tap water for 10 minutes. After differentiation with 1% hydrochloric acid alcohol for 1s, soak in PBS for 5 minutes, rinse slowly with tap water for 10 minutes, and then air dry in a fume hood. Seal the slices with neutral resin, and after drying, scan the slices with a slide scanner (Shenzhen Shengqiang Company) and save them.

[0196] (4) Multiplex fluorescent immunohistochemistry (mIHC)

[0197] Mouse subcutaneous tumor samples were examined using a multiplex fluorescent immunohistochemical staining kit. Mouse samples were stained with antibodies to CD45, CD8, GZMB, and PD-1, as described in the manufacturer's instructions. Images (20x magnification) were acquired using TissueFAXS (TissueGnostics) and a Zeiss AxioImager Z2 microscope system. Cell density within designated stained areas within each region of interest (ROI, 1 mm × 1 mm) was quantified using StrataQuest software (TissueGnostics).

[0198] (5) Prediction of mouse tumor neoantigens

[0199] Whole-exome and transcriptome sequencing was performed on subcutaneous tumor tissue from six mice treated with either Vehicle or AGK2. The sequencing results were filtered, and the resulting clean reads were stored in FASTQ format and mapped to the reference genome. Sequences that differed between the AGK2 group and the Vehicle group were identified as mutation sites, and the TruNeo prediction algorithm was used based on these differences. TM Predicting tumor neoantigens (TruNeo Source: Tang, Y., Wang, Y., Wang, J. et al. TruNeo: an integrated pipeline improves personalized true tumor neoantigen identification. BMC Bioinformatics 21, 532(2020). https: / / doi.org / 10.1186 / s12859-020-03869-9). Neoantigens are scored and ranked based on a comprehensive approach that considers factors such as peptide splicing, TAP transport, MHC-I / II binding, and mutant peptide expression levels. A higher prediction score indicates a greater likelihood of MHC-I presentation. Finally, the highest-scoring neoantigen peptides are selected.

[0200] (6) Tumor neoantigen stimulation experiment

[0201] Synthesize neoantigen peptides or wild-type peptides with a purity of ≥95% and dissolve them in sterile ddH2O to prepare peptide solutions of equal concentration. Purchase 6- to 8-week-old BALB / cJGpt female mice, isolate the spleen, femur, and tibia, and isolate CD8 +The T cell method is described in Example 1, Experimental Method (1). Bone marrow cells were isolated from the femur and tibia and cultured for 7 days in RPMI-1640 medium containing 10% fetal bovine serum, 20 ng / mL mouse granulocyte-macrophage colony-stimulating factor, and 10 ng / mL IL-4 to generate immature bone marrow-derived dendritic cells. Non-adherent cells were recovered and cultured for 16 hours in RPMI-1640 medium containing 10% fetal bovine serum, 1 μg / ml lipopolysaccharide, and 10 μM tumor neoantigen peptide (nAG group, a certain volume of neoantigen peptide solution was added to make the final concentration 10 μM) or 10 μM wild-type peptide (WT group, an equal volume of wild-type peptide solution was added to make the final concentration 10 μM) or no peptide (Vehicle group, an equal volume of sterile ddH2O was added) to generate mature bone marrow-derived dendritic cells.

[0202] Mature bone marrow-derived dendritic cells were mixed with Celltrace violet-stained mouse CD8 + T cells were co-cultured in RPMI-1640 medium containing 10% fetal bovine serum and 20 ng / mL mouse IL-2 at a ratio of 1:4, and mouse CD8 + T cell Celltrace violet staining and analysis of proliferation index, and detection of mouse CD8 + T cell activation indicators (GZMB, IFNγ and PD-1), the specific steps are shown in the experimental method (8) of Example 1. In addition, mouse CD8 + After being stimulated with mature bone marrow-derived dendritic cells loaded with tumor neoantigen peptides, wild-type peptides, or no peptides for 48 hours, T cells were co-incubated with CT26 tumor cells at a ratio of 10:1. After 48 hours, the supernatant was removed, and cell debris was washed with PBS. The Incucyte system was used to image tumor cell survival and calculate the growth area. The vehicle group was defined as having a 100% survival rate.

[0203] 2. Experimental results

[0204] To verify the function of SIRT2 in vivo, we subcutaneously injected wild-type CT26 cells or SIRT2-knockdown CT26 cells into immunocompetent mice, or treated mice inoculated with wild-type CT26 cells with DMSO or AGK2. KD Tumors in the AGK2 group or group showed significantly slower growth ( Figure 2A ). Real-time fluorescence quantitative PCR results showed that knockdown of SIRT2 or AGK2 significantly upregulated the T cell killer factors GZMB and IFNγ in tumors ( Figure 2B IHC results revealed that knockdown of SIRT2 or AGK2 led to the recruitment of more CD45 in tumors. +Immune cells, CD8 + T cells and GzmB + cell( Figure 2C ). mIHC analysis showed that SIRT2 knockdown resulted in the expression of CD45 + 、CD45 + CD8 + 、CD45 + CD8 + GZMB + and CD45 + CD8 + PD-1 + Increased cell infiltration ( Figure 2D ), indicating that T cells are in an activated state. The above analysis collectively indicates that SIRT2 plays a role in limiting CD8 + Immunomodulatory role in T cell recruitment and activation.

[0205] Tumor neoantigens can provide new targets for personalized immunotherapy of tumors and serve as prospective predictors of tumor survival prognosis and immune checkpoint blockade response. Therefore, whether SIRT2 inhibition can trigger the generation of neoantigens was investigated. Whole exome and transcriptome sequencing of AGK2-treated subcutaneous tumors was performed to identify potential neoantigens. The specific mutations detected in AGK2-treated tumors compared with control tumors were used to predict and score the neoantigens that may be bound by MHC-I ( Figure 2E The highest-scoring neoantigen peptide was LYCTGKSYL (SEQ ID NO: 4), derived from the GBP7 c.142C>T mutation. Inhibition of SIRT2 resulted in the production of tumor-specific neoantigens, suggesting that tumors may enhance their response to immunotherapy. Mature bone marrow-derived dendritic cells loaded with neoantigen peptides were further used to stimulate mouse CD8 + After 48 hours, mouse CD8 + T cells showed significantly enhanced proliferation capacity ( Figure 2F ) and activity ( Figure 2G ), the activity upregulation is mainly reflected in the increased secretion of GZMB, IFNγ, PD-1 and other molecules. By filming the tumor survival, it was verified that the tumor neoantigen peptide stimulation enhanced the mouse CD8 + T cell tumor killing ability ( Figure 2H ).

[0206] Example 3: The combined use of AGK2 and PD-1 antibodies significantly inhibits colorectal cancer growth and prolongs mouse survival

[0207] 1. Experimental methods

[0208] (1) Mouse colorectal cancer immunotherapy model

[0209] 2×105 Mouse colorectal cancer CT26 cells were injected subcutaneously into the right side of 6-8 week old BALB / cJGpt female mice. Five days later, the tumor grew to 100 mm. 3 The mice were equally divided into four groups (6 mice / group): Vehicle+αIgG, AGK2+αIgG, Vehicle+αPD-1 and AGK2+αPD-1.

[0210] Experimental groups and drug administration:

[0211] Vehicle+αIgG or DMSO+αIgG group: 8% DMSO+30% PEG300+62% ddH2O (volume ratio) was intraperitoneally injected at 200 μL daily, and 10 mg / kg αIgG was intraperitoneally injected on days 1, 4, 7, 10, 13, 16, and 19 according to the average weight of the mice;

[0212] AGK2+αIgG group: 10 mg / kg AGK2 (dissolved in DMSO to prepare AGK2 in DMSO solution calculated based on the average weight of mice) was intraperitoneally injected daily with a volume ratio of 8% AGK2 solution + 30% PEG300 + 62% ddH2O. The total injection volume was 200 μL. 10 mg / kg αIgG was intraperitoneally injected on days 1, 4, 7, 10, 13, 16, and 19, respectively, according to the average weight of mice.

[0213] Vehicle+αPD-1 or DMSO+αPD-1 group: 8% DMSO+30% PEG300+62% ddH2O (volume ratio) was intraperitoneally injected at 200 μL daily, and 10 mg / kg αPD-1 was intraperitoneally injected on days 1, 4, 7, 10, 13, 16, and 19 according to the average weight of the mice;

[0214] AGK2+αPD-1 group: 10 mg / kg AGK2 was intraperitoneally injected daily with a volume ratio of 8% AGK2 in DMSO solution + 30% PEG300 + 62% ddH2O (calculated based on the average weight of mice, dissolved in DMSO to prepare AGK2 in DMSO solution), with a total injection volume of 200 μL, and 10 mg / kg αPD-1 was intraperitoneally injected on days 1, 4, 7, 10, 13, 16, and 19 according to the average weight of mice.

[0215] Mouse PD-1 and isotype IgG antibodies were purchased from BioXCell. The dosage was calculated based on the average weight of mice and the molar mass of the antibody. The weight of mice and the length and width of tumors were measured every two days. The tumor volume was calculated as (length × width × width) × 0.5. On the 21st day of immunotherapy, the tumor length or width reached 2 cm, and the tumor volume reached 2,000 mm. 3Tumors were recovered upon either rupture or rupture of the tumor for subsequent experiments. The mean tumor size in the Vehicle + αIgG group was used as a benchmark to calculate the proportional change in tumor volume for each mouse in the other three groups. The survival rate of each group was calculated based on the time it took to recover the tumor. Organs such as the spleen, kidney, and liver were collected and analyzed for H&E staining to detect pathological damage. All mice were housed and maintained under specific pathogen-free conditions.

[0216] (2) H&E staining

[0217] The tumor tissue was delivered to Sevier for sectioning. After baking at 60°C for 16-18 hours, the slides were dewaxed three times in xylene (15 minutes each time) and hydrated with gradient alcohol: soak in anhydrous ethanol for 15 minutes → soak in 95% ethanol for 5 minutes → soak in 75% ethanol for 5 minutes → soak in PBS twice (5 minutes each time). The water on the tissue slides was drained, stained with hematoxylin for 2-3 minutes, and rinsed with tap water for 5 minutes. The sections were placed in eosin stain for 2-3 minutes and rinsed with tap water for 5 minutes. Dehydrated with 95% alcohol and 100% alcohol for 10 seconds and soaked in xylene for 1 minute. The slides were sealed with neutral resin, and after drying, the sections were scanned using a slide scanner and saved.

[0218] (3) Immunohistochemistry

[0219] See Example 2 Experimental Method (3).

[0220] (4) Multiplex fluorescent immunohistochemistry

[0221] See Example 2 Experimental Method (4).

[0222] (5) Human colorectal cancer organoid immunotherapy model

[0223] Organoids were seeded in 24-well plates and treated with equal doses of DMSO or 0.7 μM AGK2 for 24 hours. After 24 hours, congenic CD8 + T cells were co-incubated with different drugs (administered only once, see experimental grouping and administration for details) at a ratio of T cells: tumor cells = 10:1, and ImmunoCult-XF T Cell Expansion Medium: Human Colorectal Cancer Organoid Complete Medium = 1:1 (v / v) for 14 days. Cells were then collected and CD8 + T cell activation indicators (GZMB and IFNγ), the specific steps are shown in Example 1 Experimental Method (8).

[0224] Experimental groups and drug administration:

[0225] Vehicle+αIgG group: 0.7μM DMSO+10μg / mLαIgG;

[0226] AGK2+αIgG group: 0.7 μM AGK2+10 μg / mL αIgG;

[0227] Vehicle+αPD-1 group: 0.7μM DMSO+10μg / mLαPD-1;

[0228] AGK2+αPD-1 group: 0.7 μM AGK2+10 μg / mL αPD-1;

[0229] Human PD-1 and isotype IgG antibodies were purchased from Selleck.

[0230] 2. Experimental results

[0231] We next investigated whether SIRT2 inhibition could sensitize colorectal cancer to PD-1 antibody treatment and found that the combination of AGK2 and PD-1 antibody produced the most pronounced anti-tumor effect in mice bearing CT26 tumors, with prolonged survival and no weight loss or toxicity. Figures 3A-3F Notably, IHC and single-cell mIHC analysis further confirmed the expression of CD45 in the combined treatment group. + Immune cells and CD45 + CD8 + T cell infiltration increased significantly, especially CD45 + CD8 + GZMB + and CD45 + CD8 + PD-1 + cell( Figures 3G-3H Human colorectal cancer organoids and autologous CD8 + After 14 days of co-culture of T cells, flow cytometry analysis showed that GZMB + and IFNγ + CD8 + T cells increased significantly ( Figure 3I ).

[0232] Example 4 SIRT2 levels and CD8 in clinical colorectal cancer samples + T cell infiltration was negatively correlated

[0233] 1. Experimental methods

[0234] (1) Tissue chip multiplex fluorescence immunohistochemistry

[0235] Tissue microarray samples were stained with antibodies to SIRT2, CK19, CD8, GZMB, and PD-1. The IF score for SIRT2 was based on the fluorescence intensity of stained tumor cells and the percentage of positive cells. Fluorescence intensity was divided into four equal parts: unstained, 0 points (0-369.40); weak staining, 1 point (369.41-1220.61); moderate staining, 2 points (1220.62-2273.07); strong staining, 3 points (2273.08-6707.24). The final score was obtained by multiplying the sum of the values ​​obtained by the percentage of positive cells corresponding to the fluorescence intensity by 100. The samples were divided into SIRT2 according to the final score. low group (score ≤ 49.70) and SIRT2 high group (score>49.70).

[0236] Specific grouping: SIRT2 low This is a clinical colorectal cancer sample group with low SIRT2 expression. high This is a clinical colorectal cancer sample group with high SIRT2 expression. low CD8 high Low expression of SIRT2 and CD8 + A clinical colorectal cancer sample group with high T cell infiltration, SIRT2 high CD8 low High expression of SIRT2 and CD8 + A cohort of clinical colorectal cancer samples with low T cell infiltration.

[0237] 2. Experimental results

[0238] Using a microarray consisting of 130 colorectal cancer tissues, multiplex fluorescence immunohistochemistry experiments confirmed that patients with low SIRT2 levels showed longer distant metastasis-free survival (DMFS), especially those with low SIRT2 levels and CD8 + Patients with higher cellular infiltration ( Figure 4A Furthermore, tumors with low SIRT2 levels showed significantly higher CD8 + 、CD8 + GZMB + 、CD8 + PD-1 + The infiltration ratio of cells ( Figure 4B ).

[0239] discuss

[0240] This study found that low SIRT2 expression in colorectal cancer patients is closely related to the immune-hot tumor microenvironment, especially CD8 +Increased T cell infiltration and activation and improved patient survival. Targeting SIRT2 combined with PD-1 therapy has the potential to overcome immune evasion and inhibit colorectal cancer progression.

[0241] The above embodiments are limited to further elaboration and illustration of the technical solution of the present invention, so that those skilled in the art can more accurately understand the inventive ideas and operating schemes of the present invention, and are not further limitations of the present invention. The non-prominent essential features and non-significant improvements made by those skilled in the art on this basis all fall within the scope of protection of the present invention.

Claims

1. Use of SIRT2 inhibitors in the preparation of colorectal cancer drugs for use in combination with immunotherapeutic agents.

2. Use of immunotherapeutic agents in the preparation of colorectal cancer drugs used in combination with SIRT2 inhibitors.

3. The use according to claim 1 or 2, characterized in that The SIRT2 inhibitor is a substance that inhibits SIRT2 protein activity, a substance that degrades SIRT2 protein, or a genetic tool that reduces SIRT2 protein levels; Preferably, the substance that inhibits SIRT2 protein activity is selected from AGK2, SirReal2, Tenovin-1, Tenovin-3, Tenovin-6, SIRT-IN-4 or TM; Preferably, the substance that inhibits SIRT2 protein activity is selected from AGK2; Preferably, the chemical structure of AGK2 is as shown in Formula I: Preferably, the substance that inhibits SIRT2 protein activity further includes a SIRT2 blocking antibody; Preferably, the substance that degrades SIRT2 protein includes a SIRT2 protein degradation targeting chimera; Preferably, the genetic tool for reducing SIRT2 protein levels is RNA interference, microRNA, gene editing or gene knockout material; Preferably, the RNA interference comprises the use of shRNA or siRNA; Preferably, the sequence of the shRNA is SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO:

3.

4. The use according to claim 1 or 2, characterized in that The immunotherapeutic agent is an immunotherapeutic drug; Preferably, the immunotherapeutic agent comprises an immune checkpoint inhibitor; Preferably, the immune checkpoint inhibitor is selected from PD-1 antibody, PD-L1 antibody or CTLA-4 antibody; Preferably, the immune checkpoint inhibitor is selected from PD-1 antibodies; Preferably, the PD-1 antibody is selected from pembrolizumab, tislelizumab, slulizumab, putelizumab or nivolumab; Preferably, the PD-L1 antibody is selected from Envolizumab; Preferably, the CTLA-4 antibody is selected from ipilimumab; Preferably, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.01-100; Preferably, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.1-10; Preferably, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.5-5; Preferably, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:

1.

5. The use according to claim 1 or 2, characterized in that The colorectal cancer is selected from pMMR colorectal cancer or dMMR colorectal cancer; Preferably, the colorectal cancer is selected from pMMR type colorectal cancer.

6. A pharmaceutical composition for treating colorectal cancer, comprising: (a) SIRT2 inhibitors; Preferably, the SIRT2 inhibitor is a substance that inhibits SIRT2 protein activity, a substance that degrades SIRT2 protein, or a genetic tool that reduces SIRT2 protein levels; Preferably, the substance that inhibits SIRT2 protein activity is selected from AGK2, SirReal2, Tenovin-1, Tenovin-3, Tenovin-6, SIRT-IN-4 or TM; Preferably, the substance that inhibits SIRT2 protein activity is selected from AGK2; Preferably, the chemical structure of AGK2 is as shown in Formula I: Preferably, the substance that inhibits SIRT2 protein activity further includes a SIRT2 blocking antibody; Preferably, the substance that degrades SIRT2 protein includes a SIRT2 protein degradation targeting chimera; Preferably, the genetic tool for reducing SIRT2 protein levels is RNA interference, microRNA, gene editing or gene knockout material; Preferably, the RNA interference comprises the use of shRNA or siRNA; Preferably, the sequence of the shRNA is SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3; (b) an immunotherapeutic agent; preferably, the immunotherapeutic agent is an immunotherapeutic drug; Preferably, the immunotherapeutic agent comprises an immune checkpoint inhibitor; Preferably, the immune checkpoint inhibitor is selected from PD-1 antibody, PD-L1 antibody or CTLA-4 antibody; Preferably, the immune checkpoint inhibitor is selected from PD-1 antibodies; Preferably, the PD-1 antibody is selected from pembrolizumab, tislelizumab, slulizumab, putelizumab or nivolumab; Preferably, the PD-L1 antibody is selected from Envolizumab; Preferably, the CTLA-4 antibody is selected from ipilimumab; Preferably, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.01-100; Preferably, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.1-10; Preferably, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.5-5; Preferably, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:

1.

7. The pharmaceutical composition according to claim 6, wherein The colorectal cancer is selected from pMMR colorectal cancer or dMMR colorectal cancer; Preferably, the colorectal cancer is selected from pMMR type colorectal cancer.

8. A pharmaceutical kit comprising: (a) SIRT2 inhibitors; Preferably, the SIRT2 inhibitor is a substance that inhibits SIRT2 protein activity, a substance that degrades SIRT2 protein, or a genetic tool that reduces SIRT2 protein levels; Preferably, the substance that inhibits SIRT2 protein activity is selected from AGK2, SirReal2, Tenovin-1, Tenovin-3, Tenovin-6, SIRT-IN-4 or TM; Preferably, the substance that inhibits SIRT2 protein activity is selected from AGK2; Preferably, the chemical structure of AGK2 is as shown in Formula I: Preferably, the substance that inhibits SIRT2 protein activity further includes a SIRT2 blocking antibody; Preferably, the substance that degrades SIRT2 protein includes a SIRT2 protein degradation targeting chimera; Preferably, the genetic tool for reducing SIRT2 protein levels is RNA interference, microRNA, gene editing or gene knockout material; Preferably, the RNA interference comprises the use of shRNA or siRNA; Preferably, the sequence of the shRNA is SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3; (b) immunotherapeutic agents; Preferably, the immunotherapeutic agent is an immunotherapeutic drug; Preferably, the immunotherapeutic agent comprises an immune checkpoint inhibitor; Preferably, the immune checkpoint inhibitor is selected from PD-1 antibody, PD-L1 antibody or CTLA-4 antibody; Preferably, the immune checkpoint inhibitor is selected from PD-1 antibodies; Preferably, the PD-1 antibody is selected from pembrolizumab, tislelizumab, slulizumab, putelizumab or nivolumab; Preferably, the PD-L1 antibody is selected from Envolizumab; Preferably, the CTLA-4 antibody is selected from ipilimumab; Preferably, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.01-100; Preferably, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.1-10; Preferably, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.5-5; Preferably, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:1; Preferably, the SIRT2 inhibitor and the immunotherapeutic agent in the pharmaceutical set are packaged separately; Preferably, the pharmaceutical kit is used to treat colorectal cancer; Preferably, the colorectal cancer is selected from pMMR colorectal cancer or dMMR colorectal cancer; Preferably, the colorectal cancer is selected from pMMR type colorectal cancer.

9. The pharmaceutical composition according to any one of claims 6 to 7 or the pharmaceutical set according to claim 8, wherein: Also included is a pharmaceutically acceptable carrier.

10. Use of a neoantigen detection reagent in the preparation of a kit for predicting or judging the therapeutic effect of colorectal cancer, characterized in that: The amino acid sequence of the neoantigen is LYCTGKSYL; Preferably, the colorectal cancer is selected from pMMR colorectal cancer or dMMR colorectal cancer; Preferably, the colorectal cancer is selected from pMMR type colorectal cancer; Preferably, the drug for treating colorectal cancer includes a SIRT2 inhibitor; Preferably, the treatment comprises immunotherapy; Preferably, the drug for treating colorectal cancer includes a SIRT2 inhibitor and an immunotherapy agent; Preferably, the SIRT2 inhibitor is a substance that inhibits SIRT2 protein activity, a substance that degrades SIRT2 protein, or a genetic tool that reduces SIRT2 protein levels; Preferably, the substance that inhibits SIRT2 protein activity is selected from AGK2, SirReal2, Tenovin-1, Tenovin-3, Tenovin-6, SIRT-IN-4 or TM; Preferably, the substance that inhibits SIRT2 protein activity is selected from AGK2; Preferably, the chemical structure of AGK2 is as shown in Formula I: Preferably, the substance that inhibits SIRT2 protein activity further includes a SIRT2 blocking antibody; Preferably, the substance that degrades SIRT2 protein includes a SIRT2 protein degradation targeting chimera; Preferably, the genetic tool for reducing SIRT2 protein levels is RNA interference, microRNA, gene editing or gene knockout material; Preferably, the RNA interference comprises the use of shRNA or siRNA; Preferably, the sequence of the shRNA is SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3; Preferably, the immunotherapeutic agent is an immunotherapeutic drug; Preferably, the immunotherapeutic agent comprises an immune checkpoint inhibitor; Preferably, the immune checkpoint inhibitor is selected from PD-1 antibody, PD-L1 antibody or CTLA-4 antibody; Preferably, the immune checkpoint inhibitor is selected from PD-1 antibodies; Preferably, the PD-1 antibody is selected from pembrolizumab, tislelizumab, slulizumab, putelizumab or nivolumab; Preferably, the PD-L1 antibody is selected from Envolizumab; Preferably, the CTLA-4 antibody is selected from ipilimumab; Preferably, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.01-100; Preferably, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.1-10; Preferably, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:0.5-5; Preferably, the weight ratio of the SIRT2 inhibitor to the immunotherapeutic agent is 1:1; Preferably, the neoantigen is derived from a GBP7 mutation; Preferably, the neoantigen is derived from the GBP7 c.142C>T mutation; Preferably, the detection reagent is an antibody, a functional fragment of an antibody, or a conjugated antibody for detecting a neoantigen; Preferably, the conjugated antibody is a fluorescein-conjugated antibody or a biological enzyme-conjugated antibody; Preferably, the detection method is immunohistochemistry, immunofluorescence, liquid chromatography, mass spectrometry, protein immunoblotting or enzyme-linked immunosorbent assay; Preferably, the kit is a kit for enzyme-linked immunosorbent assay, protein / peptide chip detection, liquid chromatography, mass spectrometry, immunoblotting, microbead immunoassay or microfluidic immunoassay.

Images