A method for reducing acidity in berry wine

By combining blueberry and dragon fruit pulp to increase the initial pH value and using specific non-brewing yeast strains for bio-fermentation, the problem of excessive acidity in blueberry wine was solved, achieving the effect of reducing acidity and preserving flavor.

CN120699727BActive Publication Date: 2025-11-14HANGZHOU ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510820228.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2025-02-11
Filing Date
2025-06-19
Publication Date
2025-11-14
Estimated Expiration
2045-06-19

AI Technical Summary

Technical Problem

Blueberry wine has a sharp and rough taste due to its high organic acid content. Existing deacidification methods either affect the quality of the wine or are costly and ineffective, making it difficult to achieve efficient acid reduction and flavor preservation.

Method used

The initial pH value was increased by using a combination of blueberry and dragon fruit pulp, and non-sacchariculture yeast strains with the function of degrading organic acids, such as Pichia pastoris, Pichia terrestrialis, Pichia brunneoincarnata, and Pichia saccharizoi, were added to the grape juice for bio-fermentation to reduce acidity.

Benefits of technology

It effectively reduces the acidity of fruit wine, maintains its flavor and taste quality, avoids the negative impact of existing methods on the quality of fruit wine, and has a significant acid-reducing effect without increasing costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120699727B_ABST
    Figure CN120699727B_ABST
Patent Text Reader

Abstract

This solution provides a method for reducing the acidity of berry wine, including the following steps: preparing a compound fruit pulp by blending blueberry pulp and dragon fruit pulp in a set ratio; inoculating the compound fruit pulp with non-brewing yeast and brewing yeast together for fruit wine fermentation to obtain berry wine. The non-brewing yeast is a special microbial strain with the function of reducing organic acids, screened from blueberry fruit raw materials. By increasing the initial pH value of the berry fermentation raw materials and adding a special microbial strain with the function of degrading organic acids, the acidity of the berry wine is reduced. This not only effectively reduces the acidity of the berry wine product but also ensures the flavor and taste quality of the berry wine product.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for reducing the acidity of berry wine. Background Technology

[0002] blueberry( Vaccinium Spp Blueberries, belonging to the genus *Vaccinium* of the Ericaceae family, are small berries in horticulture and are among the fruits with the highest anthocyanin content. However, due to their perishable nature and significant differences in acidity and sugar content among different varieties, a large surplus of blueberries remains after fresh sales, requiring processing. Because of their high sugar content, rich organic acid content, and high anthocyanin content, blueberries are ideally suited for fermentation into functional fruit wines; therefore, fermented fruit wine is currently one of the main processed blueberry products.

[0003] Because some varieties and origins of blueberries have excessively high levels of organic acids, fermented fruit wines often tend to be too acidic, resulting in a sharp, rough, and unbalanced taste and poor quality. A balanced acidity is crucial for the quality of fruit wine. A suitable amount of organic acids can give blueberry wine a mellow taste, inhibit the growth of some harmful microorganisms, and balance the bitterness of the wine itself. However, too much organic acid will cause the wine to taste sour and astringent, with a rough flavor and an unbalanced body, directly affecting the taste and quality of the fruit wine. Therefore, acid reduction treatment is necessary when processing blueberry berries into fruit wine.

[0004] The main reason for the acidity of blueberry wine is the excessive organic acids in the raw materials and those produced during fermentation. Currently, the following methods exist for deacidification: 1. Raw material-side deacidification: Alkali is added before fermentation to neutralize the raw materials or after fermentation to neutralize and deacidify the product. However, this method severely affects the taste of the final wine. 2. Shortening fermentation time for deacidification: While this can reduce acidity to some extent, the sugar content of the raw materials is not fully utilized, resulting in excessively high sugar content, low alcohol content, insufficient flavor compounds, and a poor taste, making it unsuitable for dry red wines. 3. Adsorbent deacidification: After fermentation, the product undergoes deacidification using processes such as bentonite clarification and adsorption. However, this process also adsorbs and removes large amounts of anthocyanins, phenols, and other functional substances, affecting both taste and nutritional value. 4. Low-temperature fermentation deacidification: This is currently the most widely used method, but it requires a large number of refrigerated storage tanks, leading to high refrigeration and insulation costs, a long deacidification time (generally over one year), and limited effectiveness. Therefore, developing an effective deacidification method for blueberry wine has become a technical challenge in blueberry berry fermentation wine production. Summary of the Invention

[0005] The purpose of this invention is to provide a method for reducing the acidity of berry wine. By increasing the initial pH value of the berry fermentation raw materials and adding special microbial strains with the function of degrading organic acids, the acidity of berry wine can be reduced. This method can not only effectively reduce the acidity of berry wine products, but also ensure the flavor and taste quality of berry wine products.

[0006] To achieve the above objectives, this technical solution provides a method for reducing the acidity of berry wine, comprising the following steps:

[0007] A compound fruit pulp was prepared by mixing blueberry pulp and dragon fruit pulp in a set ratio.

[0008] Non-brewing yeast is inoculated together with brewing yeast into a compound fruit pulp for fruit wine fermentation to obtain berry wine. The non-brewing yeast is a special microbial strain with the function of reducing organic acids, which is selected from blueberry fruit raw materials.

[0009] In some embodiments, the weight ratio of dragon fruit pulp to blueberry pulp is 2:8 to 3:7. This solution increases the pH value of the composite fruit pulp by combining dragon fruit pulp and blueberry pulp, thereby reducing the initial acidity of the composite fruit pulp.

[0010] In some embodiments, blueberry pulp is obtained by crushing blueberry fruit raw materials, and dragon fruit pulp is obtained by crushing dragon fruit raw materials.

[0011] In some embodiments, the brewing yeast is selected as conventional brewing yeast.

[0012] In some embodiments, the non-Saccharomyces cerevisiae yeast is selected from *Hansenula polymorpha* (species *Hansenula polymorpha*). Hanseniaspora uvarum ), Terrestrial Pichia pastoris ( Pichia terricola ), Bruneripicura ( Pichia bruneiensis ) and Saito Saturnia ( Saturnispora diversa (One or any combination of)

[0013] Preferably, the non-Saccharomyces cerevisiae yeast is selected from grape juice Hansenula polymorpha ( Hanseniaspora uvarum ), Terrestrial Pichia pastoris ( Pichia terricola ), Bruneripicura ( Pichia bruneiensis ) and Saito Saturnia ( Saturnispora diversa One or any combination of two of them.

[0014] The grape juice obtained by this screening method contained Hansenula polymorpha ( Hanseniaspora uvarum This strain was obtained from blueberries (Blue Beauty No. 1 variety) collected in June 2022 from the blueberry planting base of Daigaole Family Farm in Baijiang Town, Hangzhou City, Zhejiang Province. It was deposited on November 8, 2023, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 28901.

[0015] The terrestrial Pichia pastoris strains obtained by this screening method ( Pichia terricolaThis strain was obtained from blueberries (Lexie variety) collected in June 2022 from the blueberry planting base of Gaofeng Blueberry Planting Co., Ltd. in Hangzhou, Zhejiang Province. It was deposited on November 8, 2023, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 28903.

[0016] The Bruinopsic yeast strain obtained by this screening method ( Pichia bruneiensis This strain was obtained from blueberries (O'Neill variety) collected in June 2022 from the blueberry planting base of Daigole Family Farm in Baijiang Town, Hangzhou City, Zhejiang Province. It was deposited on November 8, 2023, at the China General Microbiological Culture Collection Center, with the deposit address at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, and the accession number CGMCC No. 28904.

[0017] The Saito Saturnella stolonifera strain obtained by this screening method ( Saturnispora diversa This strain was obtained from blueberries (rabbiteye variety) collected in June 2022 from the blueberry planting base of Gaofeng Blueberry Planting Co., Ltd. in Hangzhou, Zhejiang Province. It was deposited on November 8, 2023, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 28902.

[0018] In some embodiments, the process of inoculating non-saccharifying yeast together with saccharifying yeast into a compound fruit pulp for fruit wine fermentation includes the following steps:

[0019] S1: Prepare a seed culture suspension from non-Saccharomyces cerevisiae;

[0020] S2: Adjust the sugar content of the compound fruit pulp to 20%~24% to obtain the sugar-adjusted compound fruit pulp;

[0021] S3: Inoculate the seed culture suspension and brewer's yeast together into the sugar-adjusting compound fruit pulp for fermentation to obtain berry wine.

[0022] In some embodiments, the concentration of the seed bacterial suspension in step S1 is 10. 6 -10 9 CFU / mL.

[0023] In some embodiments, the inoculation amount of seed bacterial suspension in step S3 is 3% to 5% of the weight of the sugar-adjusting compound fruit pulp.

[0024] In some embodiments, in step S3, the seed culture suspension and brewing yeast are inoculated together into the sugar-adjusting compound fruit pulp and fermented at 25-30°C for 20-25 days to obtain berry wine.

[0025] Compared with existing technologies, this technical solution has the following characteristics and beneficial effects:

[0026] This method employs a dual approach to reduce acidity in berry wine:

[0027] Firstly, the initial pH value of the berry fermentation raw materials is increased to reduce the initial acidity. This invention optimizes and screens a scheme to reduce the initial acidity of blueberry raw materials by combining dragon fruit. Both dragon fruit and blueberry are berries, rich in anthocyanins and sugars, and are suitable for fermenting fruit wine. Dragon fruit has a lower acidity than blueberry, so the initial pH value of the berry fermentation raw materials can be increased by combining them in a certain proportion.

[0028] Secondly, in the initial stage of berry wine fermentation, non-brewing yeast with acid-reducing function is added. The non-brewing yeast is inoculated together with traditional brewing yeast into the complex fruit pulp for fermentation, reducing the acidity of the berry wine through biological fermentation. This invention screens a specific microbial strain with organic acid-degrading function from blueberries grown locally in Hangzhou, Zhejiang Province: *Hansenula polymorpha* (grape juice spores). Hanseniaspora uvarum ), Terrestrial Pichia pastoris ( Pichia terricola ), Bruneripicura ( Pichia bruneiensis ) and Saito Saturnia ( Saturnispora diversa This special microbial strain is inoculated together with traditional brewing yeast into the fermentation process of blueberries for biological deacidification. This process avoids introducing foreign impurities that affect the quality of fruit wine from other deacidification processes, and can produce high-quality functional fruit wine with harmonious aroma, taste and mouthfeel. Attached Figure Description

[0029] Figure 1 This is a schematic diagram of the colony of *Hansenula polymorpha* strain HZNK188 on YPD agar.

[0030] Figure 2 This is a schematic diagram of the cells of *Hansenula polymorpha* HZNK188 in grape juice under a microscope.

[0031] Figure 3 This is a schematic diagram of the colony of the terrestrial Pichia pastoris strain HZNK662 on YPD agar.

[0032] Figure 4 This is a schematic diagram of the terrestrial Pichia pastoris strain HZNK662 under a microscope.

[0033] Figure 5 This is a schematic diagram of the colony of Brussels sprouts strain HZNK1268 on YPD agar.

[0034] Figure 6This is a schematic diagram of the cells of *Hansenula polymorpha* HZNK188 in grape juice under a microscope.

[0035] Figure 7 This is a color evaluation chart of the berry wine from the experimental and control groups in Example 7.

[0036] Figure 8 This is the GC-IMS differential spectrum of volatile components in the sample of Example 7.

[0037] Figure 9 This is the fingerprint spectrum of volatile components in the sample of Example 7.

[0038] Figure 10 This is a PCA score chart of the volatile components of the sample from Example 7.

[0039] Figure 11 This is a color evaluation chart of the berry wine from the experimental and control groups in Example 8.

[0040] Figure 12 This is a GC-IMS differential spectrum of volatile components in the sample of Example 8.

[0041] Figure 13 This is the fingerprint spectrum of volatile components in the sample of Example 8.

[0042] Figure 14 This is a PCA score chart of the volatile components of the sample from Example 8. Detailed Implementation

[0043] The team in this application designed the following embodiments:

[0044] Example 1: Blueberry pulp and dragon fruit pulp in different proportions

[0045] Blueberries and dragon fruit from the same batch were crushed and blended in different weight ratios to obtain corresponding composite fruit pulps. The pH values ​​of the composite fruit pulps were tested, and the results are shown in Table 1 below.

[0046] Table 1. pH values ​​of compound fruit pulps with different proportions.

[0047]

[0048] Table 1 shows that the pH of pure blueberry pulp is 2.80, while that of pure dragon fruit pulp is 4.64. Blueberries are significantly more acidic than dragon fruit. The initial pH of the fermentation raw material pulp can be adjusted by adding a certain amount of dragon fruit. As the proportion of dragon fruit increases, the pH of the mixed fruit pulp also rises. However, when the dragon fruit content exceeds 40%, the pulp begins to exhibit an off-flavor similar to grass. Considering both acidity and the flavor of the mixed fruit pulp, and combining this with the flavor evaluation of the fermented fruit wine, a suitable weight ratio of dragon fruit to blueberry pulp is selected as 2:8 to 3:7.

[0049] Example 2: Grape juice contained Hansenula polymorpha ( Hanseniaspora uvarum Strain screening and identification

[0050] 1. The grape juice obtained by our team contained Hansenula polymorpha ( ) Hanseniaspora uvarum The strain has been deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 28901.

[0051] 2. This strain was obtained from blueberries (Blue Beauty No. 1 variety) collected in June 2022 from the blueberry planting base of Daigaole Family Farm in Baijiang Town, Hangzhou City, Zhejiang Province. The screening method is as follows:

[0052] (1) Separation

[0053] After crushing the blueberries, add them to a sterile 500mL Erlenmeyer flask and incubate naturally at 28℃ with shaking for 7 days. Take 10mL samples daily and dilute them 10-fold with sterile physiological saline. Select 10... -2 10 -3 10 -4 10 -5 Four suitable dilutions were spread onto Red Bengal Agar (RBA) to ensure the colonies were separated. The plates were incubated at 28°C for 2-3 days, and typical colonies exhibiting yeast characteristics were selected. The Red Bengal Agar (RBA) formulation (g / L) was: peptone 5.0, glucose 10.0, potassium dihydrogen phosphate 1.0, anhydrous magnesium sulfate 0.5, Red Bengal 0.033, chloramphenicol 0.1, and agar 20.0. The Red Bengal Agar (RBA) was prepared as follows: 36.6 g of the culture medium powder was weighed into 1 L of distilled water, heated to boiling until completely dissolved, autoclaved at 121°C for 15 min, and cooled to approximately 50°C for later use.

[0054] (2) Purification

[0055] Typical colonies were streaked onto yeast extract peptone glucose medium (YPD agar) and incubated at 28°C for 2 days for isolation and purification. Typical colonies were then picked from YPD agar and streaked again, incubated at 28°C for 2 days for a second purification. This process was repeated five times to obtain the purified strain. The YPD agar formulation (g / L) is: peptone 10.0g, glucose 20.0g, yeast extract 14.0g, and agar 14.0g. Preparation method: Weigh 50.0g into 1L of distilled water, heat to boiling until completely dissolved, autoclave at 121°C for 20 minutes, and cool to approximately 50°C for later use.

[0056] (3) Screening of acid reduction performance

[0057] Different colonies were selected from the purified strains and inoculated into YPD liquid medium containing 12 g / L citric acid. The cultures were incubated at 28°C and 150 r / min for 72 h in a shaking incubator. The total organic acid content was measured every 24 h using the acid-base titration method according to GB12456-2021. The results were repeated three times and the average value was taken. Strains with acid-reducing effects were screened by the acid reduction rate. A non-Saccharomyces cerevisiae strain with good acid-reducing effect was obtained and named HZNK188.

[0058] The acid-reducing effect of this strain on citric acid during 72h fermentation in YPD liquid medium is shown in Table 2. The YPD liquid medium formula (g / L) is: peptone 20.0, glucose 20.0, and yeast extract 10.0. Preparation method: Weigh 50.0g into 1L of distilled water, heat to boiling until completely dissolved, and autoclave at 121℃ for 20min for later use.

[0059] Table 2 shows the citric acid-lowering effect of strain HZNK188 during fermentation.

[0060]

[0061] Table 2 shows the acid-reducing effect of strain HZNK188 on citric acid during fermentation: 28.82% after 24 hours of fermentation; 86.02% after 48 hours; and 90.86% after 72 hours. Therefore, this strain can effectively reduce the organic acid content in the raw materials within 72 hours.

[0062] 3. Identification of strain HZNK188

[0063] (1) Morphological identification of strain HZNK188

[0064] The HZNK188 strain was cultured on YPD agar at 28°C for 72 hours, and the colonies formed by its reproduction and growth are as follows: Figure 1 As shown, by Figure 1The visible colonies are round, milky white, with a smooth surface and even edges; microscopic examination results are as follows. Figure 2 As shown, by Figure 2 It can be seen that it is spherical or ellipsoidal, with a cell size of (1.5-3.0)×(3.5-4.5)μm.

[0065] (2) Identification of the main physiological and biochemical reactions of strain HZNK188

[0066] The physiological and biochemical reactions of strain HZNK188 were identified using the VITEK 2 Compact fully automated microbial analysis system from bioMérieux. The results are shown in Table 3.

[0067] Table 3. Identification results of physiological and biochemical reactions of strain HZNK188

[0068]

[0069] (3) Analytical biological identification

[0070] DNA was extracted from strain HZNK188, primers were designed for PCR amplification of the ITS rRNA gene, and the amplified sequence was obtained as shown in SEQ ID NO.1. The specific sequence is as follows:

[0071] After comparing the above sequence with known sequences in GenBank, the fungal species was determined and classified into genus or species. The HZNK188 strain was identified as *Hansenula polymorpha*. Hanseniaspora uvarum ).

[0072] (4) Grape juice contains Hansenula polymorpha ( Hanseniaspora uvarum Preservation of HZNK188 strain

[0073] Grape juice containing Hansenula polysaccharide ( Hanseniaspora uvarum Inoculate strain HZNK188 onto YPD agar slant tubes, incubate at 28°C for 48-72 hours, then add glycerol and store at -80°C or freeze-dry under vacuum.

[0074] Example 3 Terrestrial Pichia pastoris ( Pichia terricola Screening and identification of bacterial strains

[0075] 1. A terrestrial Pichia pastoris strain ( Pichia terricola HZNK662, this strain has been deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No.28903.

[0076] 2. This strain was obtained from blueberries (Lexie variety) collected in June 2022 from the blueberry planting base of Gaofeng Blueberry Planting Co., Ltd. in Hangzhou City, Zhejiang Province. The screening method is as follows:

[0077] (1) Separation, the method and steps are the same as in Example 2.

[0078] (2) Purification, the method and steps are the same as in Example 2.

[0079] (3) Screening of acid reduction performance

[0080] Different colonies were selected from the purified strains above, and a non-Saccharomyces cerevisiae strain with good acid-reducing effect was obtained by screening for acid reduction rate according to the method in Example 2, named HZNK662. The acid-reducing effect of this strain on citric acid during 72h fermentation in citric acid YPD liquid medium is shown in Table 4.

[0081] Table 4. Effect of HZNK662 strain on citric acid reduction during fermentation.

[0082]

[0083] Table 4 shows the acid-reducing effect of strain HZNK662 on citric acid during fermentation: 19.57% after 24 hours of fermentation; 52.15% after 48 hours; and 88.17% after 72 hours. Therefore, the acid-reducing effect of strain HZNK662 after 24 hours of fermentation is not ideal; fermentation for 48-72 hours is required to effectively reduce the organic acid content in the raw materials.

[0084] 3. Identification of strain HZNK662

[0085] (1) Morphological identification of strain HZNK662

[0086] The HZNK662 strain was cultured on YPD agar at 28°C for 72 hours, and the colonies formed by its reproduction and growth are as follows: Figure 3As shown, by Figure 3 The visible colonies are round, milky white, with a smooth surface and even edges. Microscopic examination results are as follows: Figure 4 As shown, by Figure 3 It can be seen that the bacteria are mainly ellipsoidal, with a small number being spherical, and the cell size is (1.5-3.0)×(4.0-4.5)μm.

[0087] (2) Identification of the main physiological and biochemical reactions of strain HZNK662

[0088] The physiological and biochemical reactions of strain HZNK662 were identified using the VITEK 2 Compact fully automated microbial analysis system from bioMérieux. The results are shown in Table 5.

[0089] Table 5. Identification results of physiological and biochemical reactions of strain HZNK662

[0090]

[0091] (3) Molecular biological identification

[0092] DNA was extracted from strain HZNK662, primers were designed for PCR amplification of the ITS rRNA gene, and sequencing was performed to obtain its sequence as shown in SEQ ID NO.2, which is as follows: GGCCATTAAAAGTGGCTAATCACACTGCGTGCGCGTAACAAACCCCTAAACATGAATAACCTAGTCAAGAATCCATAAGAATAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCGTTTCTATCTCACGCAAGTGGAGCTGGCCCGGCCTTGGCCCCGCCGAAAAGAAACGAGGGCGAAGCGAACTATGTTGTGCGCCGACCCCAGCTATCAAGCTCGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAGAGGAGGAACA

[0093] After comparing the above sequence with known sequences in GenBank, the fungal species was determined and classified into genus or species. Upon identification, strain HZNK662 was identified as *Pichia pastoris* (terrestrial species). Pichia terricola ).

[0094] Example 4: Bruinobichia pastoris ( Pichia bruneiensis Screening and identification of bacterial strains

[0095] 1. A strain of Bruinopsina ( Pichia bruneiensis HZNK1268, this strain has been deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No.28904.

[0096] 2. This strain was obtained from blueberries (O'Neill variety) collected in June 2022 from the blueberry planting base of Daigole Family Farm in Baijiang Town, Hangzhou City, Zhejiang Province. Screening method:

[0097] (1) Separation, the method and steps are the same as in Example 2.

[0098] (2) Purification, the method and steps are the same as in Example 2.

[0099] (3) Screening of acid reduction performance

[0100] Different colonies were selected from the purified strains, and a non-Saccharomyces cerevisiae strain with good acid-reducing effect was obtained by screening for acid reduction rate, following the method in Example 2. This strain was named HZNK1268. The acid-reducing effect of this strain on citric acid during 72h fermentation in citric acid YPD liquid medium is shown in Table 6.

[0101] Table 6. Effect of HZNK1268 strain on citric acid reduction during fermentation.

[0102]

[0103] Table 6 shows the acid-reducing effect of strain HZNK1268 on citric acid during fermentation: 12.99% after 24 hours of fermentation; 56.53% after 48 hours; and 90.61% after 72 hours. Therefore, strain HZNK1268 exhibits similar acid-reducing properties to HZNK662, requiring 72 hours of fermentation to effectively reduce the organic acid content in the raw materials.

[0104] 3. Identification of strain HZNK1268

[0105] (1) Morphological identification of strain HZNK662

[0106] The HZNK662 strain was cultured on YPD agar at 28°C for 72 hours, and the colonies formed by its reproduction and growth are as follows: Figure 5 As shown, by Figure 5 Visible colony characteristics: round, milky white, smooth surface, and even edges; microscopic examination shows... Figure 6 As shown, by Figure 6It can be seen that they are spherical or ellipsoidal, with ellipsoidal being the most common, and the cell size is (2.0-3.0)×(3.0-4.0)μm.

[0107] (2) Identification of the main physiological and biochemical reactions of strain HZNK1268

[0108] The physiological and biochemical reactions of strain HZNK1268 were identified using the VITEK 2 Compact fully automated microbial analysis system from bioMérieux. The results are shown in Table 7.

[0109] Table 7. Identification results of physiological and biochemical reactions of strain HZNK1268

[0110]

[0111] (3) Molecular biological identification

[0112] DNA was extracted from strain HZNK1268, primers were designed for PCR amplification of the ITS rRNA gene, and the amplified sequence was obtained as shown in SEQ ID NO.3. The specific sequence is as follows:

[0113] GGGCCGTCAGAGCTAAGATTCTCACACTGCGTGGGCGAAGCGAAACACCGAAACTGGCAGCGCGGCCGTCAAACACAAAAAATCCACAAAACTTTCAACAACGGATCTCTGGGTTCTCGCATCGATAAAAAGCGCAGCGAAAGGCAATACCTAGGGGGAATTGCACCCATCGGGAATCATCAAGTTCTTGAACGCACATGGCGCCCGCCGG CTTTCCGGGGGGCATGCCTGTCTGAGCGTCGTTTCCTTCTTGGGGCGAAGCTTCAAACCTGGGCGGGAAGGCGGGTTTTCCCCGGTTCAAAGCAAGGGCCGGCCTGCCCAAACTATGGGGGGCCCCCGGGCGGGCAGCAAACTTTACCGAGCTCGACCTCAGATCAGGCAGGAGTACCCGCTGAACTTAAGCATATCAATAACCGGAGGAAA

[0114] After comparing the above sequence with known sequences in GenBank, the fungal species was determined and classified into genus or species. Upon identification, strain HZNK1268 was identified as *Pichia pastoris*. Pichia bruneiensis ).

[0115] Example 5 Saito Saturnella ( Saturnispora diversa Screening and identification of bacterial strains

[0116] 1. Saito Saturna ( Saturnispora diversa The strain was deposited on November 8, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 28902.

[0117] 2. Following the method in Example 2, HZNK494 was obtained from blueberries (rabbiteye variety) collected in June 2022 from the blueberry planting base of Gaofeng Blueberry Planting Co., Ltd. in Hangzhou City, Zhejiang Province. It was identified as Saito Saturnella.

[0118] Example 6: Effects of Fermentation with Four Acid-Lowering Non-Saccharifying Yeasts on the Acidity of Different Blueberry Compound Pulp

[0119] Grape juice contains Hansenula polymorpha ( Hanseniaspora uvarum ), Terrestrial Pichia pastoris ( Pichia terricola ), Bruneripicura ( Pichia bruneiensis ) and Saito Saturnia ( Saturnispora diversa The results of the test on the acid-reducing effect of four non-saccharifying yeasts on the two groups of compound fruit pulps are shown in Tables 8 and 9. In Table 8, the weight ratio of dragon fruit pulp to blueberry pulp in the compound fruit pulp is 2:8, and in Table 9, the weight ratio of dragon fruit pulp to blueberry pulp in the compound fruit pulp is 3:7.

[0120] Table 8. Results of the acid-reducing effect of different non-saccharifying yeasts on compound fruit pulp (dragon fruit to blueberry weight ratio 2:8) (total acidity unit: g / L)

[0121]

[0122] Table 9. Results of the acid-reducing effect of different non-saccharifying yeasts on compound fruit pulp (dragon fruit to blueberry weight ratio 3:7) (total acidity unit: g / L)

[0123]

[0124] Tables 8 and 9 show that *Hansenula polysaccharide*, *Pichia pastoris*, *Pichia brunneoincarnata*, and *Sagittaria sagittifolia* all exhibited good acid-reducing effects during the fermentation of blueberry mixed fruit pulp using grape juice. Compared with the blank control, after 72 hours of fermentation, the acidity of blueberry mixed fruit pulp (dragon fruit pulp to blueberry pulp weight ratio 2:8) by these four strains decreased by 42.53%, 26.69%, 24.01%, and 31.55%, respectively; and after 72 hours of fermentation, the acidity of blueberry mixed fruit pulp (dragon fruit pulp to blueberry pulp weight ratio 3:7) decreased by 41.22%, 18.45%, 20.39%, and 11.45%, respectively. The ratio of dragon fruit pulp was increased from 2:8 to 3:7, and the initial acidity of the compound pulp was significantly reduced. Compared with the blank control of natural fermentation without added bacteria, the acidity reduction rate was lower, but the overall acid reduction performance was not significantly reduced.

[0125] Example 7

[0126] 1. Fermentation process

[0127] The berry wine of this embodiment is prepared through a deacidification fermentation process including the following steps:

[0128] (1) First, non-Saccharomyces cerevisiae was streaked onto YPD agar and incubated at 28°C for 48 h to activate it; after activation, it was inoculated into YPD liquid medium and incubated at 28°C for 48 h to prepare a seed culture suspension, wherein the concentration of the seed culture suspension was 10. 6 -10 9 CFU / mL seed bacterial suspension;

[0129] (2) Crush the blueberry fruit and dragon fruit raw materials separately to obtain blueberry pulp and dragon fruit pulp;

[0130] (3) Prepare blueberry compound fruit pulp by mixing dragon fruit pulp and blueberry pulp in a weight ratio of 3:7, and adjust the sugar content to 22% to obtain sugar-adjusted blueberry compound fruit pulp;

[0131] (4) Inoculate the seed culture suspension together with the traditional brewing yeast into the sugar-adjusting blueberry compound fruit pulp. The inoculation amount of the seed culture suspension is 3% to 5% of the weight of the sugar-adjusting blueberry compound fruit pulp. The traditional brewing yeast is a wine-specific yeast (produced by Angel Yeast Co., Ltd.), and the inoculation amount is added according to the product instructions.

[0132] (5) Ferment at 25-30℃ for 25 days to obtain the blueberry wine (BP2 group) of this embodiment.

[0133] 2. Fruit wine quality analysis

[0134] A single strain of traditional brewing yeast (a wine-specific yeast produced by Angel Yeast Co., Ltd.) was used as the fermentation strain. Berry wine was prepared using the same fermentation process as described above as a control group (BP1 group). The various properties of the two berry wines were tested and analyzed. In other words, the fermentation effects of different fermentation strains were compared using the same complex fruit pulp to evaluate the beneficial effects of adding acid-lowering non-brewing yeast.

[0135] (1) Acidity of fruit wine

[0136] The acidity of fruit wine prepared using an acid-lowering non-Saccharomyces cerevisiae strain (experimental group BP2) was 3.59 g / L, while the acidity of the control group (BP1) prepared without the acid-lowering non-Saccharomyces cerevisiae strain was 4.80 g / L. It can be seen that the use of acid-lowering non-Saccharomyces cerevisiae significantly reduced the acidity of the fruit wine (p < 0.05), with a reduction rate of 25.21%.

[0137] (2) Alcohol content of fruit wine

[0138] The fruit wine prepared using the acid-lowering non-Saccharomyces cerevisiae strain for fermentation (BP2 group) had an alcohol content of 11.5%, while the fruit wine prepared without the acid-lowering non-Saccharomyces cerevisiae strain for fermentation (BP1 group) had an alcohol content of 11.7%. There was no significant difference between the two groups (p>0.05). This indicates that using acid-lowering non-Saccharomyces cerevisiae in the production of fruit wine does not affect the final alcohol content of the fruit wine product.

[0139] (3) Color quality test of fruit wine

[0140] The color quality test results of the fruit wine are as follows: Figure 7 As shown, Figure 7 In the figure, BP1 represents the control group and BP2 represents the experimental group. Different lowercase letters in the figure indicate that there is a significant difference between the two groups. p <0.05), the same lowercase letter indicates that there is no significant difference between the two groups ( p >0.05). Figure 10 It can be seen that, compared with the fruit wine of the control group (BP1), there were no significant differences in the L value, a value, and b value of the fruit wine of the experimental group (BP2) (p>0.05), indicating that adding acid-lowering non-brewing yeast strains to the fermentation of compound fruit pulp to prepare fruit wine will not affect the color quality of the dry red fruit wine product.

[0141] (4) Evaluation of volatile flavor compounds

[0142] 1) Sample Collection: The differences in volatile flavor compounds between the experimental group (BP2) and the control group (BP1) fruit wine were compared and analyzed using gas phase ion mobility spectrometry (GC-IMS). For ease of analysis, the sample information of the two groups was first numbered, and the sample information table is shown in Table 10:

[0143] Table 10 Sample Information Table for Example 7

[0144]

[0145] 2) Comparative analysis of volatile component spectra

[0146] After obtaining the spectra of each sample, the spectrum of the pre-fermentation blueberry compound pulp sample BPO-S was used as a reference. The spectra of other samples were subtracted from the reference spectrum to obtain a comparison chart of the differences between the samples, as shown below. Figure 8 As shown. If the volatile organic compound (VOC) content in the target sample and the reference is the same, the subtracted background is white; red indicates that the concentration of the substance in the target sample is higher than that in the reference, and blue indicates that the concentration of the substance in the target sample is lower than that in the reference. From Figure 8 It can be clearly seen that the volatile organic compounds in the fermented berry wine increase significantly.

[0147] 3) Fingerprint analysis of volatile organic compounds

[0148] To further compare the types and contents of volatile organic compounds in each sample, fingerprint analysis was performed. The results are as follows: Figure 9 As shown, Figure 9 From left to right, the following are listed: 2-ethyl-1-hexanol, (Z)-3-hexenol, 1-hexanol, 1-penten-3-ol, 1-pentanol, 1-butanol, 2-propanol, 2-heptanone, 2-pentanone, 2-butanone, acetone, methyl 2-methylbutyrate, methyl 3-methylbutyrate, cis-3-hexenyl acetate, isopropyl butyrate, amyl acetate, hexanol, acetal, 2-methylpropanol, acetaldehyde, benzene, pinene, dimethyl sulfide, acetoin, 4-methyl-2-pentanone, nonanol. Heptanal, 3-methylbutanal, propanal, 2-propenal, linalool oxide, 2-methyl-1-propanol, 1-propanol, ethanol, methanol, ethyl octanoate, ethyl hexanoate, hexyl acetate, methyl hexanoate, methyl butyrate, isobutyl acetate, butyric acid, acetic acid, linalool, 1-heptanol, cis-2-penten-1-ol, butyl hexanoate, isobutyl isobutyrate, ethyl isobutyrate, propyl acetate, ethyl lactate, phenylacetaldehyde, (E)-2-pentenal, 3-methyl-1-butanol, ethyl 3-methylbutyrate, ethyl 2-methylbutyrate, isoamyl acetate, ethyl butyrate, ethyl acetate, methyl acetate, 2-methyl-3-heptanone.

[0149] Depend on Figure 9It can be seen that ① BPO-S contains high levels of substances such as 2-ethyl-1-hexanol, Z-3-hexenol, 1-hexanol, 1-penten-3-ol, 1-pentanol, 1-butanol, 2-propanol, 2-heptanone, 3-heptanone, 2-pentanone, 2-butanone, acetone, methyl 2-methylbutyrate, methyl 3-methylbutyrate, methyl acetate, isopropyl butyrate, amyl acetate, hexanal, acetal, 2-methylpropanol, acetaldehyde, benzene, β-pinene, and dimethyl sulfide.

[0150] ② BP1-M contained higher levels of acetoin, 4-methyl-2-pentanone, nonanal, heptanal, 3-methylbutanal, propional, 2-propenal, linalool oxide, 2-methyl-1-propanol, 1-propanol, ethanol, methanol, ethyl octanoate, ethyl hexanoate, hexyl acetate, methyl hexanoate, methyl butyrate, and isoamyl acetate; BP2-M ​​contained higher levels of ethyl propionate. This indicates that after 48 hours of fermentation, the volatile flavor compounds, such as esters, significantly increased. The BP2-M ​​group, with the addition of acid-lowering non-Saccharifying yeast, had lower methanol and higher ester content than the BP1-M group.

[0151] ③ BP1-E contained higher levels of butyric acid, acetic acid, linalool, 1-heptanol, Z-2-penten-1-ol, butyl hexanoate, isobutyl isobutyrate, ethyl isobutyrate, propyl acetate, ethyl lactate, phenylacetaldehyde, E-2-heptenal, and 3-methyl-2-butenal; while BP2-E contained higher levels of cyclopentanone, E-2-hexenal, 3-methyl-1-butanol, ethyl 3-methylbutyrate, ethyl 2-methylbutyrate, isobutyl acetate, ethyl butyrate, ethyl acetate, and methyl acetate. Therefore, compared to BP1-E, the addition of acid-reducing non-saccharifying yeast significantly increased the volatile ester content of fruit wine in the BP2-E group after fermentation, while significantly decreasing the levels of volatile organic acids such as butyric acid and acetic acid.

[0152] 4) Cluster analysis

[0153] To further compare the types of volatile organic compounds in each sample, cluster analysis of the volatile organic compounds was performed. The results are as follows: Figure 10 As shown. By Figure 10 It is evident that after 48 hours of fermentation, the fruit wine fermented with the acid-reducing non-Saccharomyces cerevisiae strain (BP2-M) had a lower total volatile organic compound (VOC) than the fruit wine fermented without the acid-reducing non-Saccharomyces cerevisiae strain (BP1-M), indicating that the acid-reducing non-Saccharomyces cerevisiae strain can degrade a lot of acidic substances during the first 48 hours of fermentation. After fermentation, there was no significant difference in the total VOC between the fruit wine fermented with the acid-reducing non-Saccharomyces cerevisiae strain (BP2-E) and the fruit wine fermented without the acid-reducing non-Saccharomyces cerevisiae strain (BP1-E).

[0154] Therefore, when using a compound fruit pulp fermented with acid-reducing non-saccharifying yeast strains to prepare berry wine, it will not have a negative impact on the total content of volatile organic compounds and can even produce beneficial effects: it can significantly increase the content of volatile esters and significantly reduce the content of volatile organic acids such as butyric acid and acetic acid.

[0155] Example 8

[0156] 1. Fermentation process

[0157] The berry wine in this embodiment is prepared through a deacidification fermentation process including the following steps:

[0158] (1) First, non-Saccharomyces cerevisiae was streaked onto YPD agar and incubated at 28°C for 48 h to activate it; after activation, it was inoculated into YPD liquid medium and incubated at 28°C for 48 h to prepare a seed culture suspension, wherein the concentration of the seed culture suspension was 10. 6 -10 9 CFU / mL seed bacterial suspension;

[0159] (2) Crush the blueberry raw materials to obtain blueberry pulp;

[0160] (3) Adjust the sugar content of the blueberry pulp to 22% to obtain sweetened blueberry pulp;

[0161] (4) Inoculate the seed culture suspension together with traditional brewing yeast into the sugar-adjusting blueberry pulp. The amount of seed culture suspension inoculated is 3%-5% of the weight of the sugar-adjusting blueberry compound pulp.

[0162] (5) Ferment at 25-30℃ for 25 days to obtain the blueberry wine (Group B2) of this embodiment.

[0163] 2. Fruit wine quality analysis

[0164] In this embodiment, the blueberry wine served as the control group (B2) and was compared with the berry wine (experimental group BP2) made from the compound fruit pulp in Example 7, which was fermented with a combination of acid-lowering non-saccharifying yeast and wine-specific yeast. In other words, the same strains (acid-lowering non-saccharifying yeast and wine-specific yeast) were used to ferment different fruit pulps (blueberry and dragon fruit compound pulp, and blueberry pulp) to evaluate the beneficial effects of combining dragon fruit.

[0165] (1) Acidity of fruit wine

[0166] The acidity of berry wine (group BP2) prepared by fermentation of blueberry and dragon fruit mixed fruit pulp with acid-lowering non-brewing yeast and wine-specific yeast was 3.59 g / L, while the acidity of fruit wine (group B2) prepared by fermentation of blueberry single fruit pulp with acid-lowering non-brewing yeast and wine-specific yeast was 4.91 g / L. It can be seen that the acidity of berry wine produced by blending dragon fruit mixed fruit pulp can be significantly reduced.p <0.05), the decrease rate was 26.88%.

[0167] (2) Alcohol content of fruit wine

[0168] The alcohol content of the berry wine (Group BP2) prepared by fermentation of blueberry and dragon fruit mixed fruit pulp with added acid-reducing non-brewing yeast and wine-specific yeast was 11.5%, while the alcohol content of the fruit wine (Group B2) prepared by fermentation of blueberry single fruit pulp with added acid-reducing non-brewing yeast and wine-specific yeast was 11.8%. There was no significant difference between the two. p >0.05). It can be seen that, under the same fermentation conditions, the berry wine prepared by fermenting the compound dragon fruit pulp with added acid-lowering non-brewing yeast and wine-specific yeast will not significantly affect the final alcohol content of the fruit wine product.

[0169] (3) Color quality test of fruit wine

[0170] The color quality test chart of fruit wine is shown below. Figure 11 As shown, Figure 11 B2 represents the control group: blueberry pure fruit pulp fermented with a combination of acid-lowering non-brewing yeast and wine-specific yeast; BP2 represents the experimental group: blueberry and dragon fruit mixed fruit pulp fermented with a combination of acid-lowering non-brewing yeast and wine-specific yeast. Different lowercase letters in the figure indicate significant differences between the two groups. p <0.05), the same lowercase letter indicates that there is no significant difference between the two groups ( p >0.05).

[0171] Depend on Figure 11 It can be seen that, compared with the control group (B2 group) fruit wine, the b-value of the experimental group (BP2 group) fruit wine was not significantly different. p >0.05); the L value of the experimental group (BP2 group) was significantly greater than that of the control group (B2 group). p< 0.05), the a value of the experimental group (BP2 group) was significantly smaller than that of the control group (B2 group). p< The concentration of dragon fruit in the wine (0.05%) indicates that the addition of dragon fruit has a certain negative impact on the red color and brightness of the fermented dry red wine. This shows that although a higher proportion of dragon fruit is more beneficial for reducing acidity, the proportion of dragon fruit in the blend should not be too high, otherwise it will affect the color quality of the dry red wine product.

[0172] (4) Evaluation of volatile flavor compounds

[0173] 1) Sample collection

[0174] The differences in volatile flavor compounds between the experimental group and the control group of fruit wine were compared and analyzed using gas phase ion mobility spectrometry (GC-IMS). To facilitate the analysis, the sample information of the two groups was first numbered, and the sample information table is shown in Table 11.

[0175] Table 11 Sample Information Table for Example 8

[0176]

[0177] 2) Comparative analysis of volatile component spectra

[0178] After obtaining the spectra of each sample, the spectrum of the blueberry pulp sample B0-S before fermentation was used as a reference. The spectra of other samples were subtracted from the reference spectrum to obtain a comparison chart of the differences between the samples, as shown below. Figure 12 As shown. If the volatile organic compound (VOC) content in the target sample and the reference is the same, the subtracted background is white; red indicates that the concentration of the substance in the target sample is higher than that in the reference, and blue indicates that the concentration of the substance in the target sample is lower than that in the reference. From Figure 12 The results clearly show that after fermentation, the volatile organic compounds in blueberry wine with added dragon fruit increased significantly.

[0179] 3) Fingerprint analysis of volatile organic compounds

[0180] To further compare the types and contents of volatile organic compounds in each sample, fingerprint analysis was performed. The results are as follows: Figure 13 As shown, Figure 13 From left to right, the following are listed: 2-ethyl-1-hexanol, (Z)-3-hexenol, 1-hexanol, 1-penten-3-ol, 1-pentanol, 1-butanol, 2-propanol, nonanal, heptanal, hexanal, propanal, acetaldehyde, acetal, (E) -2-Pentenal, 2-Hepenoanone, 3-Hepenoanone, 2-Pentenanone, 2-Butanone, Acetone, Cis-3-Hexenyl Acetate, Amyl Acetate, Isopropyl Butyrate, Methyl Butyrate, Pinene, Benzene, Allyl Sulfide, Dimethyl Sulfur, 1-Propanol, Ethyl Propionate, Methyl 2-Methylbutyrate, Methyl Hexanoate, Butyric Acid, Linalool, 3-Methyl-1-Butanol, 2-Methyl-1-Propanol, Ethanol, Methanol, Ethyl Octanoate, Ethyl Hexanoate, Ethyl Isobutyrate, Ethyl 2-Methylbutyrate, Ethyl 3-Methylbutyrate, Isoamyl Acetate, Isobutyl Acetate, Ethyl Butyrate, Methyl 3-Methylbutyrate, Methyl Acetate, Hexyl Acetate, Phenylacetaldehyde, 3-Methyl-2-Butenal, 2-Propanol, Cyclopentanone, 2-Methylpropional, Acetic Acid, Acetonitrile, 3-Methylbutanol, Linalool Oxide, (E) -2-Heptenal, (E)-2-Hexenal, 1-Heptanol, cis-2-penten-1-ol, butyl hexanoate, ethyl acetate, propyl acetate, isobutyl isobutyrate, ethyl lactate, 4-methyl-2-pentanone, 2-methyl-3-heptanone.

[0181] Depend on Figure 13 It can be seen that ① B0-S contains relatively high levels of substances such as 2-ethyl-1-hexanol, Z-3-hexenol, 1-hexanol, 1-penten-3-ol, 1-pentanol, 1-butanol, 2-propanol, nonanal, heptanal, hexanal, propanal, acetaldehyde, acetal, E-2-pentenal, 2-heptanone, 3-heptanone, 2-pentanone, 2-butanone, acetone, leaf ester acetate, amyl acetate, isopropyl butyrate, methyl butyrate, β-pinene, benzene, allyl propyl sulfide, and dimethyl sulfide; BPO-S contains relatively high levels of substances such as 2-methylpropanal. This indicates that dragon fruit contains a relatively high amount of 2-methylpropanal.

[0182] ② B2-M contains high levels of substances such as 1-propanol, ethyl propionate, methyl 2-methylbutyrate, and methyl hexanoate; BP2-M ​​contains high levels of substances such as acetic acid, acetoin, and 3-methylbutyraldehyde. It can be seen that the compound fruit pulp containing dragon fruit has a high acetic acid content in the early stage of fermentation. If the fermentation time is insufficient, it will be detrimental to acid reduction.

[0183] ③ B2-E contains higher levels of butyric acid, linalool, 3-methyl-1-butanol, 2-methyl-1-propanol, ethanol, methanol, ethyl octanoate, ethyl hexanoate, ethyl isobutyrate, ethyl 2-methylbutyrate, ethyl 3-methylbutyrate, isoamyl acetate, isobutyl acetate, ethyl butyrate, methyl 3-methylbutyrate, methyl acetate, hexyl acetate, phenylacetaldehyde, 3-methyl-2-butenal, 2-propenal, and cyclopentanone; BP2-E contains higher levels of linalool oxide, E-2-heptenal, E-2-hexenal, 1-heptanol, Z-2-penten-1-ol, butyl hexanoate, ethyl acetate, propyl acetate, isobutyl isobutyrate, ethyl lactate, and 4-methyl-2-pentanone. Therefore, after fermentation of the compound fruit pulp containing dragon fruit, the content of organic acids such as butyric acid significantly decreases, while the content of esters significantly increases.

[0184] 4) Cluster analysis

[0185] To further compare the types of volatile organic compounds in each sample, cluster analysis of the volatile organic compounds was performed, and the results are as follows: Figure 14 As shown. By Figure 14 It is evident that after 48 hours of fermentation, there was no significant difference in the total volatile organic compounds (VOCs) between the fruit wine with added dragon fruit (BP2-M) and the fruit wine without added dragon fruit (B2-M). After fermentation, there was also no significant difference in the total VOCs between the berry wine with added dragon fruit (BP2-E) and the fruit wine without added dragon fruit (B2-E group). However, overall, adding too much dragon fruit can negatively impact the flavor compounds of the fruit wine. Therefore, the dragon fruit blending ratio should be controlled within 3:7 to effectively ensure that the flavor and quality of the product do not decline.

[0186] Therefore, when blueberries are combined with dragon fruit for fermentation to prepare fruit wine, it will not negatively affect the total content of volatile organic compounds (VOCs) and can even produce beneficial effects: it can significantly reduce the content of volatile organic acids such as butyric acid and increase the content of volatile esters. However, in general, if too much dragon fruit is added, it will have a negative effect on the flavor compounds of the fruit wine. Therefore, the ratio of dragon fruit to blueberries should be controlled within 3:7 to effectively ensure that the flavor and quality of the product do not decline.

[0187] Those skilled in the art should understand that the technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments have been described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0188] The above embodiments are merely illustrative of several implementation methods of this application, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of this application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this application should be determined by the appended claims.

Claims

1. A method for reducing the acidity of berry wine, characterized in that, Includes the following steps: A compound fruit pulp was prepared by blending blueberry pulp and dragon fruit pulp in a predetermined ratio. Non-brewing yeast was then inoculated into the compound fruit pulp along with brewing yeast for fruit wine fermentation, yielding berry wine. The non-brewing yeast was a specific microbial strain selected from blueberry fruit raw materials, possessing the function of reducing organic acids. The non-brewing yeast was selected from one or any combination of *Hansenula polymorpha*, *Pichia pastoris*, *Pichia brunneoincarnata*, and *Sagittaria sagitta*. The *Hansenula polymorpha* strain has the accession number CGMCC No. 28901 and was deposited on November 8, 2023, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The *Pichia pastoris* strain has the accession number CGMCC. Accession number CGMCC No. 28903 was deposited on November 8, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; accession number CGMCC No. 28904 of *Brunerella brunneoincarnata* was deposited on November 8, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; accession number CGMCC No. 28902 of *Sagittaria sagittifolia* was deposited on November 8, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

2. The method for reducing the acidity of berry wine according to claim 1, characterized in that, The weight ratio of dragon fruit pulp to blueberry pulp is 2:8 to 3:

7.

3. The method for reducing the acidity of berry wine according to claim 1, characterized in that, The process of inoculating non-brewing yeasts together with brewing yeasts into a compound fruit pulp for fruit wine fermentation. Includes the following steps: S1: Prepare a seed culture suspension from non-saccharifying yeast; S2: Adjust the sugar content of the compound fruit pulp to 20%~24% to obtain a sugar-adjusted compound fruit pulp; S3: Inoculate the seed culture suspension and saccharifying yeast together into the sugar-adjusted compound fruit pulp for fermentation to obtain berry wine.

4. The method for reducing the acidity of berry wine according to claim 3, characterized in that, The concentration of the seed bacterial suspension in step S1 is 10. 6 -10 9 CFU / mL, the inoculation amount of seed bacterial suspension in step S3 is 3%~5% of the weight of the sugar-adjusting compound fruit pulp.

5. The method for reducing the acidity of berry wine according to claim 3, characterized in that, In step S3, the seed culture suspension and brewing yeast are inoculated together into the sugar-adjusting compound fruit pulp and fermented at 25-30℃ for 20-25 days to obtain berry wine.

Citation Information

Patent Citations

  • Alternaria algida HZNK494 and application thereof

    CN119859583A