Suction head integrating extracellular vesicle capture and proteomics pretreatment and application of suction head
By designing an integrated pipette tip structure and using aptamer-modified epoxy resin material to load the sieve plate in the pipette tip, highly specific capture and processing of low-sample extracellular vesicles is achieved, solving the problems of cumbersome steps and insufficient specificity in existing technologies, and improving the efficiency and accuracy of proteomic detection.
Patent Information
- Application Number
- CN202510875577.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-27
- Publication Date
- 2025-09-26
AI Technical Summary
The existing extracellular vesicle proteomics detection methods are cumbersome, have weak specificity, and cannot effectively process trace samples.
A pipette tip that integrates extracellular vesicle capture and proteomic pre-processing was designed. The sieve plate was loaded in the pipette tip using aptamer-modified epoxy resin material, and centrifugation was combined to achieve highly specific capture and proteomic pre-processing.
It achieves high-specificity capture of extracellular vesicles in low-sample volume body fluids, completes subsequent sample pre-processing steps, improves the efficiency and accuracy of proteomic detection, and reduces interference from miscellaneous proteins.
Smart Images
Figure CN120699741A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biochemical technology detection, and in particular to a pipette tip integrating extracellular vesicle capture and proteomics pre-processing and applications thereof. Background Art
[0002] Extracellular vesicles are small membrane-bound vesicles secreted by cells into the external environment. They contain a variety of biomolecules, such as proteins, lipids, and RNA. Extracellular vesicles play an important role in intercellular communication, material exchange, and regulation of physiological processes, and are involved in a variety of biological processes. As information carriers, they can transmit a variety of molecules, including proteins, nucleic acids, and lipids, and participate in intercellular signaling and regulation. Extracellular vesicles play an important role in immune responses, such as regulating the immune system's response by carrying antigens or immunosuppressive molecules. In addition, extracellular vesicles can also serve as diagnostic markers for diseases, especially in the fields of cancer, cardiovascular disease, and neurodegenerative diseases. The molecular components carried by vesicles often reflect the state of the disease and have significant biological and clinical value.
[0003] At present, there are some mature methods for isolating, purifying, analyzing the contents and mechanisms of extracellular vesicles, such as ultracentrifugation, ultrafiltration, size exclusion, etc. However, how to extract extracellular vesicles from actual samples such as plasma and urine and perform proteomic analysis still faces many technical and theoretical challenges.
[0004] Since the currently used extracellular vesicle extraction and subsequent proteomic detection methods all have problems with multiple steps and transfer processes, the only few integrated extracellular vesicle proteomic sample pretreatment methods also have the problem of weak specificity leading to excessive impurities and cannot support the proteomic sample pretreatment of trace extracellular vesicles. Summary of the Invention
[0005] In order to solve the problem of the lack of a sample pre-treatment method with integrated steps, high specificity and low sample loading in the field of extracellular vesicle proteomics, the present invention provides a pipette tip integrating extracellular vesicle capture and proteomics pre-treatment and its application.
[0006] To address the aforementioned issues, this application, based on the specificity of aptamers in capturing target substances and the advantages of pipette tips, such as their small size and open environment, has designed a pipette tip that integrates extracellular vesicle capture and proteomic preprocessing. The tip is loaded with a sieve plate, extracellular vesicle capture material, and protein capture material. Furthermore, based on this integrated pipette tip, a method for extracellular vesicle capture and proteomic preprocessing is provided.
[0007] The present application scheme has the ability to specifically capture extracellular vesicles in low-volume body fluid samples and complete subsequent sample pre-processing steps to directly obtain a peptide solution.
[0008] The purpose of the present invention can be achieved by the following technical solutions:
[0009] The present invention first provides a pipette tip that integrates extracellular vesicle capture and proteomics pre-processing, comprising a pipette tip body and a sieve plate installed inside the pipette tip body. The sieve plate is filled with a protein capture material and an extracellular vesicle capture material. The protein capture material is an epoxy resin material (Epoxy) containing epoxy groups, and the extracellular vesicle capture material is an epoxy resin material (Epoxy-CD63) modified with a CD63 aptamer.
[0010] In one embodiment of the present invention, the sieve plate is located at the front end of the pipette tip body.
[0011] In one embodiment of the present invention, the protein-capturing material is located above the sieve plate, and the extracellular vesicle-capturing material is located above the protein-capturing material.
[0012] In one embodiment of the present invention, a centrifuge tube is further provided outside the pipette tip body.
[0013] In one embodiment of the present invention, the sequence of the CD63 aptamer is CACCCCACCTCGCTCCCGTGACACTAATGCTA, and its 5' end is modified with 5'SH C6.
[0014] In one embodiment of the present invention, the synthesis method of Epoxy-CD63 is:
[0015] The CD63 aptamer was mixed with TCEP (thiol reducing agent), placed in an incubator, and activated by centrifugation at room temperature in the dark. PBS and epoxy material were added to the activated CD63 aptamer, placed in an incubator, reacted, and washed with PBS to obtain epoxy-CD63 material.
[0016] In one embodiment of the present invention, in the synthesis method of Epoxy-CD63, the volume ratio of the CD63 aptamer and TCEP when mixed is 9:1, and the centrifugal activation conditions are: activation at a centrifugal force of 1200 rpm for 1 hour; the amount of the activated CD63 aptamer, PBS, and Epoxy material is: 100 μL:900 μL:100 mg; and the reaction conditions are: 37°C, 1200 rpm, and 24 hours.
[0017] In one embodiment of the present invention, the synthesis method of Epoxy-CD63 is as follows: 90 μL of CD63 aptamer is mixed with 10 μL of TCEP, placed in an incubator, activated at room temperature, dark conditions, and a centrifugal force of 1200 rpm for 1 hour, 900 μL of PBS and 100 mg of Epoxy material are added to the activated CD63 aptamer, placed in an incubator, reacted at 37°C and 1200 rpm for 24 hours, and washed three times with PBS to obtain Epoxy-CD63 material.
[0018] In one embodiment of the present invention, the CD63 aptamer concentration is 34.3uM, and the TCEP concentration is 0.1M.
[0019] In the pipette tip provided by the present invention, which integrates extracellular vesicle capture and proteomics preprocessing, the epoxy in the epoxy-CD63 binds to the CD63 aptamer via epoxy and sulfhydryl groups. The CD63 aptamer in the epoxy-CD63 binds to the CD63 protein on the surface of the extracellular vesicle membrane, effectively preventing nonspecific adsorption of interfering proteins. The epoxy is used to capture proteins by cross-linking with amino groups in the protein via epoxy groups.
[0020] The present invention further provides a method for preparing the pipette tip integrating extracellular vesicle capture and proteomics pre-processing, comprising the following steps:
[0021] A sieve plate is placed at the front end of the tip body, and the protein capture material and the extracellular vesicle capture material are placed in a PBS solution. The PBS solution containing the protein capture material and the extracellular vesicle capture material is added to the tip body, and washed with PBS. The excess solution is removed by centrifugation to obtain the tip integrating extracellular vesicle capture and proteomics pre-processing.
[0022] The present invention further provides an application of the pipette tip that integrates extracellular vesicle capture and proteomic pre-processing, which is used for extracellular vesicle capture and proteomic pre-processing, comprising the following steps:
[0023] S1: Add the body fluid sample to the pipette tip to capture extracellular vesicles;
[0024] S2: Add a mixture of urea, thiourea, NaHPO4, TECP, and IAA to the pipette tip and place it in an incubator to lyse extracellular vesicles and capture the proteins released after extracellular vesicle lysis;
[0025] S3: Add ethanolamine to the pipette tip and place it in an incubator to block the redundant capture sites of the protein capture material and the extracellular vesicle capture material;
[0026] S4: Add Trypsin solution to the pipette tip and place it in an incubator for enzymatic hydrolysis of the protein. After the enzymatic hydrolysis is completed, centrifuge to obtain a peptide solution.
[0027] In one embodiment of the present invention, in step S1, the body fluid sample is selected from urine filtrate, plasma eluate or cerebrospinal fluid eluate.
[0028] The urine filtrate is obtained by: obtaining a urine sample, performing a first centrifugation on the urine sample to obtain a primary supernatant, and treating the primary supernatant through a filter membrane to obtain a urine filtrate.
[0029] The plasma eluate is obtained by: obtaining a plasma sample, and subjecting the plasma sample to a cross-linked agarose gel Mini-SEC column treatment to obtain a plasma eluate;
[0030] The cerebrospinal fluid eluate is obtained by obtaining a cerebrospinal fluid sample, and subjecting the cerebrospinal fluid sample to a cross-linked agarose gel Mini-SEC column treatment to obtain the cerebrospinal fluid eluate.
[0031] In one embodiment of the present invention, the Mini-SEC column is synthesized by slurrying 4% cross-linked agarose gel filler with deionized water and transferring it to an empty column tube containing a 50 μm sieve plate with a matching diameter at the bottom. The filler is slowly poured into the empty column tube, ensuring that no bubbles remain in the column. A 50 μm sieve plate is then added to the top of the column. The column bed, measuring 15 mm x 5 cm, is compacted using a push rod. Finally, the column bed is rinsed with 20 mL of phosphate-buffered saline (PBS).
[0032] In one embodiment of the present invention, washing is performed between each step S1-S4 by centrifugation at a centrifugal force of 1800 g for 2 minutes. For all centrifugation or washing operations, the pipette tip is placed in a 1.5 mL centrifuge tube and centrifuged to remove excess unreacted material.
[0033] In one embodiment of the present invention, washing is performed with water, NaCl, or water after centrifugation in step S2. Washing is performed with water after centrifugation in step S3.
[0034] In one embodiment of the present invention, in step S1, the capture condition is: placing the tip in an incubator at 37° C., 1000 rpm, for 20 minutes.
[0035] In one embodiment of the present invention, in step S2, 6 M urea, 2 M thiourea, 5 mM TCEP, 10 mM IAA, and 0.1 M NaHPO4 are added, and then placed in an incubator at 55°C, 1000 rpm for 1 hour, thereby rupturing the extracellular vesicles and fixing the proteins.
[0036] In one embodiment of the present invention, in step S3, the concentration of ethanolamine added is 2M.
[0037] In one embodiment of the present invention, in step S3, the conditions for blocking excess capture sites are: placing the sample in an incubator at 55°C, 1000 rpm, for 1 hour. The purpose of blocking excess capture sites in the protein capture material and extracellular vesicle capture material is to prevent interference with subsequent enzymatic cleavage of the protein.
[0038] In one embodiment of the present invention, in step S4, the enzymatic hydrolysis conditions are: placing in an incubator, 50° C., 1000 rpm, and time for 30 minutes.
[0039] In one embodiment of the present invention, in step S4, the centrifugation is performed at a centrifugal force of 2000 g for 2 minutes. In step S4, the peptide solution is released from the pipette tip by centrifugation.
[0040] In the present application, the extracellular vesicle capture material and the protein capture material can be replaced by two materials with the same function, but the reaction conditions for capturing extracellular vesicles and the reaction conditions for capturing proteins should be significantly different.
[0041] In the application of the pipette tip provided in this application, which integrates extracellular vesicle capture and proteomics pre-processing, the entire process can be completed within 3 hours, and the extracellular vesicle mass loaded can be as low as 100 ng.
[0042] The present application scheme uses Epoxy-CD63 to specifically identify extracellular vesicles. The CD63 aptamer can effectively avoid nonspecific adsorption of interfering proteins. Epoxy is used to capture proteins after the extracellular vesicles are lysed. At the same time, the excess liquid can be washed away by centrifugation due to the special environment of the pipette tip, and the captured substances can be fixed on the material in the pipette tip.
[0043] The present invention combines the specific recognition of CD63 aptamers, the protein capture and in situ enzymatic cleavage capabilities of Epoxy, the advantages of the small environment of the pipette tip to improve the detection limit and the open environment of the pipette tip, and can efficiently and specifically identify and capture extracellular vesicles in low-sample volume body fluids. The extracellular vesicle pretreatment step environment is integrated into the pipette tip, which is beneficial for subsequent proteomic detection. The method is characterized by high specificity, high repeatability and low cost.
[0044] Compared with the prior art, the present invention has the following beneficial effects:
[0045] (1) Strong anti-protein adsorption ability: The CD63 aptamer has strong specificity and the CD63 protein is specifically expressed on the extracellular vesicle membrane, which can effectively avoid the interference caused by nonspecific adsorption. Therefore, the present invention is designed to modify the CD63 aptamer to the epoxy surface to avoid the nonspecific adsorption of other proteins. Compared with other materials, the specificity of the aptamer and the difference in the conditions for the aptamer to capture extracellular vesicles and epoxy to capture proteins make the pipette tip highly specific, thereby reducing the interference of miscellaneous proteins.
[0046] (2) High targeting to extracellular vesicles: Compared with antibodies, aptamers are smaller in size. The present invention modifies the CD63 aptamer onto Epoxy, ensuring that the substrate has a large number of extracellular vesicle affinity sites, thereby improving the targeting to extracellular vesicles.
[0047] (3) In situ lysis of extracellular vesicles and capture of proteins after lysis: Through the functions of the two materials, the lysis of extracellular vesicles and the capture of proteins after lysis are completed simultaneously in a one-step reaction, thereby improving the recovery rate of proteins in extracellular vesicles and reducing unnecessary losses.
[0048] (4) In situ enzymatic cleavage of captured proteins: Through the design of the tip itself, after capturing the proteins released from extracellular vesicles, in situ enzymatic cleavage can be performed without transfer, reducing protein loss and facilitating subsequent proteomic analysis. BRIEF DESCRIPTION OF THE DRAWINGS
[0049] Figure 1 Schematic diagram of the structure of the pipette tip integrating extracellular vesicle capture and proteomics pre-processing of the present invention.
[0050] Figure 2 is the Zeta potential difference before and after the reaction of Epoxy with CD63 aptamer in Example 1.
[0051] Figure 3 The difference in extracellular vesicle capture at different times with the same amount of Epoxy-CD63 material in Example 1.
[0052] Figure 4 The difference in capture efficiency when the same amount of extracellular vesicles and different amounts of Epoxy-CD63 materials in Example 1 are placed in a centrifuge tube and a pipette tip, respectively.
[0053] Figure 5 This is the difference in protein captured by the same amount of epoxy material at different times in Example 1.
[0054] Figure 6The difference in protein captured by the same amount of epoxy material at different blocking times in Example 1.
[0055] Figure 7 is the content of the peptide solution at different ratios of Trypsin solution in the Trypsin enzymatic digestion step in Example 1.
[0056] Figure 8 It is the content of the peptide solution at different enzyme digestion times in the Trypsin digestion step in Example 1.
[0057] Figure 9 This is a repeatability verification of the integrated pipette tip of the present invention in Example 1, which integrates extracellular vesicle capture and proteomics pre-processing, in high-purity urine-derived extracellular vesicles.
[0058] Figure 10 These are the results of the integrated tip of the present invention in Experimental Example 2, which combines extracellular vesicle capture and proteomics pre-processing, on extracellular vesicles derived from body fluids. DETAILED DESCRIPTION
[0059] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments. This embodiment is implemented based on the technical solution of the present invention, and provides a detailed implementation method and specific operation process, but the protection scope of the present invention is not limited to the following embodiments.
[0060] In the following examples, unless otherwise specified, raw materials or processing techniques are conventional commercially available raw materials or conventional processing techniques in the art.
[0061] Example 1:
[0062] This embodiment provides a pipette tip that integrates extracellular vesicle capture and proteomics pre-processing.
[0063] The pipette tip of this embodiment that integrates extracellular vesicle capture and proteomics pre-processing includes a pipette tip body and a sieve plate installed inside the pipette tip body. The sieve plate is filled with protein capture material and extracellular vesicle capture material. The protein capture material is an epoxy resin material (Epoxy) containing epoxy groups, and the extracellular vesicle capture material is an epoxy resin material (Epoxy-CD63) modified with a CD63 aptamer.
[0064] In this embodiment, the sieve plate is located at the front end of the pipette tip body, the protein capture material is located above the sieve plate, and the extracellular vesicle capture material is located above the protein capture material. A centrifuge tube is also provided on the outside of the pipette tip body. In this embodiment, the pipette tip structure integrating extracellular vesicle capture and proteomics pre-processing is as follows Figure 1 shown.
[0065] In this embodiment, the sequence of the CD63 aptamer is CACCCCACCTCGCTCCCGTGACACTAATGCTA, and its 5' end is modified with 5'SH C6.
[0066] In this embodiment, the epoxy resin material (Epoxy) containing epoxy groups comes from Tosoh Corporation, and its model number is TOYOPEARL AF-Epoxy-650M.
[0067] In this embodiment, the preparation method of Epoxy-CD63 is as follows:
[0068] 90 μL of 34.3 μM CD63 aptamer was mixed with 10 μL of 0.1 M tris(2-carboxyethyl)phosphine (TCEP), placed in an incubator, and activated at room temperature, dark conditions, and a centrifugal force of 1200 rpm for 1 hour. 900 μL of PBS and 100 mg of epoxy material were added to the activated CD63 aptamer, and the mixture was placed in an incubator and reacted at 37°C and 1200 rpm for 24 hours. The mixture was washed three times with PBS to obtain epoxy-CD63 material, and the zeta potential of epoxy material and epoxy-CD63 material was measured. The zeta potential difference before and after the reaction of epoxy with CD63 aptamer is shown in Figure 2. Figure 2 As shown, from Figure 2 It can be seen that due to the negative charge of the aptamer, the Zeta potential of the Epoxy-CD63 material after reacting with the CD63 aptamer is lower than that of the Epoxy material that has not reacted with the CD63 aptamer, indicating the successful coupling of Epoxy and CD63 aptamers.
[0069] In this embodiment, a method for preparing a pipette tip that integrates extracellular vesicle capture and proteomic pretreatment is as follows: a sieve plate is loaded at the front end of the pipette tip body. After the sieve plate is loaded into the pipette tip, the protein capture material Epoxy and the extracellular vesicle capture material Epoxy-CD63 are placed in 200 μL of PBS solution. The PBS solution containing the protein capture material and the extracellular vesicle capture material is added to the pipette tip body, washed with PBS, and the excess solution is removed by centrifugation to obtain the pipette tip that integrates extracellular vesicle capture and proteomic pretreatment.
[0070] After obtaining the pipette tip that integrates extracellular vesicle capture and proteomic pre-processing, this example further verified its application in extracellular vesicle capture and proteomic pre-processing. The specific steps are as follows:
[0071] (1) Acquisition of urine-derived extracellular vesicles:
[0072] Normal human morning urine samples were collected and stored at 4°C for 3 hours. The samples were then centrifuged at 3200 g for 30 minutes. The supernatant was transferred to a clean 50 mL centrifuge tube and filtered through a 0.22 μm pore size needle filter. The filtered samples were concentrated using a 100 kDa ultrafiltration centrifuge tube at a centrifugal force of 3200 g. All filtered urine samples were ultrafiltered and concentrated to 200-250 μL. PBS solution was then added to the ultrafiltration tube for replacement, and the sample was reconcentrated to 200-250 μL. This was repeated twice. The concentrate was transferred to a 1.5 mL centrifuge tube, and the ultrafiltration tube filter was rinsed with 100 μL of PBS solution, repeatedly pipetting the solution to avoid contact between the pipette tip and the filter membrane. The rinse solution and concentrate were mixed thoroughly to complete the pretreatment and stored at 4°C.
[0073] (2) Size exclusion chromatography for the extraction of high-purity urine-derived extracellular vesicles:
[0074] After degassing, the PBS solution was used as the mobile phase for SEC at a constant flow rate of 1 mL / min. The size exclusion chromatography column was connected to the Shimadzu chromatography system, and the system was balanced until the pressure and UV detection signal were stable. The UV detection wavelength was 280 nm and the column temperature was 25°C. The pre-treated samples were loaded in automatic injection mode with a loading volume of 100 μL. According to the UV detection signal, the fractions with a retention time of 5.0-6.7 min were collected and concentrated using a 100 kDa ultrafiltration centrifuge tube with a centrifugal force of 11,000 g. After concentration, the fractions were transferred to a clean 0.6 mL centrifuge tube to obtain high-purity urine-derived extracellular vesicles.
[0075] (3) Capture of high-purity urine-derived extracellular vesicles by the pipette tip:
[0076] High-purity urine-derived extracellular vesicles were added to the pipette tip and placed in an incubator at 37°C, 1000 rpm, for 20 minutes. Excess liquid was washed away by centrifugation at 1800 g for 2 minutes, and PBS solution was added for washing. Excess liquid was washed away by centrifugation at 1800 g for 2 minutes.
[0077] Since the proteins on the surface of extracellular vesicles will be detected by the BCA kit, the amount of protein in the solution before capture and the eluate after capture is detected by the BCA kit to detect whether the extracellular vesicles are captured, and a certain amount of extracellular vesicles is controlled to test the capture effect of the same amount of capture material to optimize the capture time. Figure 3 It can be seen that the number of extracellular vesicles captured reached the maximum at 15 minutes, that is, the optimal capture time for extracellular vesicles was 15 minutes. At the same time, the same amount of extracellular vesicles and different amounts of materials were placed in centrifuge tubes and pipette tips, and the capture efficiency was tested respectively to detect the superiority of different amounts of materials in the pipette tip environment compared with the same amount of materials in the centrifuge tube. Figure 4It can be seen that the reaction efficiency of the pipette tip of the present invention when the amount of material is 1 mg, 2 mg, 3 mg, 4 mg, and 5 mg is much higher than that in the centrifuge tube. The difference in reaction efficiency between the pipette tip and the centrifuge tube becomes more significant as the amount of material decreases.
[0078] (4) Protein capture by the tip:
[0079] After capturing extracellular vesicles, 10 μL of a mixture of 6 M Urea, 2 M thiourea, 5 mM TCEP, 10 mM IAA, and 0.1 M NaHPO4 (all final concentrations) was added to the tip until the liquid level was higher than the material in the tip. The tip was placed in an incubator at 55°C, 1000 rpm, for 1 hour to lyse the extracellular vesicles and capture proteins. The excess liquid was washed away by centrifugation at 1800 g for 2 minutes and washed with water, 1 M NaCl, and water. The excess liquid was washed away by centrifugation at 1800 g for 2 minutes.
[0080] For Epoxy material, add enough BSA protein, keep other conditions the same, change the time, use BCA kit to compare the change of protein quality before and after Epoxy capture, and optimize the capture time. Figure 5 It can be seen that 12 μg of protein has been captured at 60 min. Considering that when the capture time is prolonged, excessive binding of protein and Epoxy will affect the subsequent enzymatic cleavage efficiency, 60 min is selected as the optimal capture time for protein.
[0081] (5) Blocking of redundant capture sites in the tip:
[0082] Add an appropriate amount of 2M ethanolamine to the tip until it is higher than the material in the tip, place it in an incubator, and incubate it at 55°C, 1000 rpm for 1 hour to block excess epoxy capture sites so as not to affect subsequent protein cleavage. Wash away excess liquid by centrifugation at 1800g for 2 minutes and wash with water. Wash away excess liquid by centrifugation at 1800g for 2 minutes.
[0083] Prepare several pipette tips for blocking, first let them capture a certain amount of BSA protein, then add 2M ethanolamine to block for different time periods, wash after blocking, add BSA protein again, and use the BCA kit to detect the amount of BSA protein captured, so as to optimize the blocking time, such as Figure 6 As shown in the figure, when the blocking time is 30 minutes, Epoxy can still capture some proteins. When it reaches 60 minutes, the amount of captured proteins is greatly reduced, indicating that the capture site of Epoxy has been blocked. 60 minutes is selected as the optimal blocking time for Epoxy.
[0084] (6) In situ enzymatic cleavage of captured proteins:
[0085] Prepare several pipette tips. After completing the capture of extracellular vesicles, protein capture, and blocking of redundant capture sites, add Trypsin solutions in different proportions to the amount of extracellular vesicles to the pipette tips. Place them in an incubator at 50°C, 1000 rpm, and react for 1 hour. Then, release the peptide solution from the pipette tips by centrifuging at a centrifugal force of 2000g for 2 minutes to obtain the peptide solution. By testing the content of the peptide solution, the enzyme digestion results of the Trypsin solutions in different proportions to the extracellular vesicles are obtained, such as Figure 7 As shown in the figure, the enzymatic digestion effect of Trypsin solution with a ratio of 1:2 to extracellular vesicles was the best.
[0086] Prepare several pipette tips. After completing the capture of extracellular vesicles, protein capture, and blocking of excess capture sites, add a 1:2 Trypsin solution to the pipette tip (if the concentration is to be determined or the protein amount is too low, select 100 ng / μL Trypsin solution, the Trypsin solution volume is 10 μL). Place it in an incubator at 50°C and 1000 rpm. After different reaction times, release the peptide solution from the pipette tip by centrifugation at a centrifugal force of 2000 g for 2 minutes to obtain the peptide solution. By testing the content of the peptide solution, the enzyme digestion result at that time is obtained, such as Figure 8 As shown in the figure, the enzyme digestion effect reaches its maximum value at 30 min, that is, 30 min is the optimal enzyme digestion time.
[0087] (7) Preparation of peptide solution before mass spectrometry:
[0088] The peptide solution was desalted using a Merck Millipore ZipTip microchromatographic column, eluted with a 40% ACN, 0.1% TFA mixed solution, freeze-dried, and redissolved in a 1% FA solution for ion mobility trap time-of-flight mass spectrometry detection.
[0089] (8) Optimization of Trypsin concentration and enzyme cleavage time during enzyme cleavage:
[0090] Control a certain amount of material and a certain amount of extracellular vesicles, and carry out steps (1) to (7). Add trypsin in different proportions to the amount of extracellular vesicles to the pipette tip, place it in an incubator, and incubate it at 50°C, 1000 rpm, for 30 minutes to obtain a peptide solution. Release the peptide solution from the pipette tip by centrifugation at a centrifugal force of 2000g for 2 minutes, measure it using a nanodrop 2000c instrument, and optimize the trypsin concentration according to the obtained concentration results.
[0091] Control a certain amount of material and a certain amount of extracellular vesicles, and carry out steps (1) to (7). Add a certain amount of Trypsin solution to the pipette tip, place it in an incubator, and incubate it at 50°C, 1000 rpm for 15, 30, 45, and 60 minutes, respectively, to obtain a peptide solution. The peptide solution is released from the pipette tip by centrifugation at a centrifugal force of 2000g for 2 minutes, and measured by a nanodrop 2000c instrument. The Trypsin enzyme cleavage time is optimized according to the obtained concentration results.
[0092] Mass spectrometry results
[0093] refer to Figure 9 In three high-purity urine-derived extracellular vesicle samples, 2477, 2566, and 2475 proteins were detected, respectively. After comparison with the Vesiclepedia database, the number of proteins detected belonging to extracellular vesicles was 2100, 2154, and 2072. At least 83.76% of the identified proteins belonged to extracellular vesicles. This method has good stability and high specificity.
[0094] Example 2:
[0095] To verify whether the method of the present invention can directly perform proteomics research on extracellular vesicles in body fluids, the specific steps are as follows:
[0096] (1) Preparation of Epoxy-CD63:
[0097] Mix 90 μL of 34.3 uM CD63 aptamer with 10 μL of 0.1 M TCEP, place in an incubator, and activate at room temperature, dark conditions, and a centrifugal force of 1200 rpm for 1 hour. Add 900 μL of PBS and 100 mg of epoxy material to the activated CD63 aptamer, place in an incubator, and react at 37°C and 1200 rpm for 24 hours. Wash three times with PBS to obtain epoxy-CD63 material.
[0098] (2) Filling the tip with Epoxy and Epoxy-CD63 aptamers:
[0099] After the frit was filled into the pipette tip, Epoxy-CD63 and Epoxy material were placed in 200 μL PBS and added to the pipette tip, which was then washed with PBS. Excess solution was removed by centrifugation to obtain a complete pipette tip.
[0100] (3) Urine treatment:
[0101] Normal human morning urine samples were collected, stored at 4°C for 1 hour, and centrifuged at 2000 g for 10 minutes. The supernatant was transferred to a clean 50 mL centrifuge tube and filtered using a needle filter membrane with a pore size of 0.22 μm to obtain the urine filtrate.
[0102] (4) Treatment of plasma:
[0103] A plasma sample is obtained, and the plasma sample is processed on a mini-SEC column to obtain a plasma eluate.
[0104] (5) Treatment of cerebrospinal fluid:
[0105] A cerebrospinal fluid sample is obtained, and the cerebrospinal fluid sample is processed using a mini-SEC column to obtain a cerebrospinal fluid eluate.
[0106] (6) Capture of extracellular vesicles in body fluids by the tip:
[0107] 10 μL of treated urine filtrate, 1 μL of plasma eluate, and 10 μL of cerebrospinal fluid eluate were added to the pipette tip respectively, placed in an incubator, and incubated at 37°C, 1000 rpm, for 20 minutes. The excess liquid was washed away by centrifugation at 1800 g for 2 minutes, and PBS solution was added for washing. The excess liquid was washed away by centrifugation at 1800 g for 2 minutes.
[0108] (7) Protein capture by the tip:
[0109] After capturing the extracellular vesicles, 10 μL of a mixture of 6MUrea, 2M thiourea, 5mM TCEP, 10mM IAA, and 0.1M NaHPO4 (all concentrations here are final concentrations) was added to the three pipette tips until the liquid level was higher than the material in the pipette tip. The pipette tips were placed in an incubator at 55°C, 1000 rpm, and 1 hour to lyse the extracellular vesicles and capture proteins. The excess liquid was washed away by centrifugation at 1800g for 2 minutes and washed with water, 1M NaCl, and water. The excess liquid was washed away by centrifugation at 1800g for 2 minutes.
[0110] (8) Blocking of redundant capture sites in the tip:
[0111] Add an appropriate amount of 2M ethanolamine to all three pipette tips until the content is higher than the material in the pipette tip, and place them in an incubator at 55°C, 1000 rpm, for 1 hour to block excess epoxy capture sites so as not to affect subsequent protein enzymatic cleavage. Wash away excess liquid by centrifugation at 1800g for 2 minutes and wash with water. Wash away excess liquid by centrifugation at 1800g for 2 minutes.
[0112] (9) In situ enzymatic cleavage of captured proteins:
[0113] Add a trypsin solution with a protein weight ratio of 1:2 to each of the three pipette tips (if the concentration is to be determined or the protein weight is too low, select a 100 ng / μL trypsin solution), place in an incubator, and incubate at 50°C, 1000 rpm, for 30 minutes to obtain a peptide solution. Release the peptide solution from the pipette tip by centrifugation at a centrifugal force of 2000 g for 2 minutes to obtain three peptide solutions.
[0114] (10) Preparation of peptide solution before mass spectrometry:
[0115] The three peptide solutions were desalted using a Merck Millipore ZipTip microchromatographic column, eluted separately with a 40% ACN, 0.1% TFA mixed solution, freeze-dried, and redissolved in a 1% FA solution for ion mobility trap time-of-flight mass spectrometry detection.
[0116] (11) Mass spectrometry results
[0117] like Figure 10 As shown, in the mass spectrometry data results from three sources, the protein identification amount of 10 μL cerebrospinal fluid was 1145, of which 957 proteins (accounting for 83.58%) belonged to extracellular vesicles; the protein identification amount of 1 μL plasma was 1172, of which 982 proteins (accounting for 83.79%) belonged to extracellular vesicles; the protein identification amount of 10 μL urine was 859, of which 758 proteins (accounting for 88.24%) belonged to extracellular vesicles. The invention has high specificity and high identification amount.
[0118] The above description of the embodiments is intended to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above-described embodiments. Improvements and modifications made by those skilled in the art based on the disclosure of the present invention, without departing from the scope of the present invention, should be within the scope of protection of the present invention.
Claims
1. A pipette tip that integrates extracellular vesicle capture and proteomics pre-processing, characterized in that: The invention comprises a pipette tip body and a sieve plate installed inside the pipette tip body. The sieve plate is filled with a protein capture material and an extracellular vesicle capture material. The protein capture material is an epoxy resin material containing epoxy groups, and the extracellular vesicle capture material is an epoxy resin material Epoxy-CD63 modified with a CD63 aptamer.
2. The tip integrating extracellular vesicle capture and proteomics pre-processing according to claim 1, characterized in that: The sieve plate is located at the front end of the pipette tip body, the protein capturing material is located above the sieve plate, and the extracellular vesicle capturing material is located above the protein capturing material.
3. The pipette tip integrating extracellular vesicle capture and proteomics pre-processing according to claim 1, characterized in that: The sequence of the CD63 aptamer is CACCCCACCTCGCTCCCGTGACACTAATGCTA, and its 5' end is modified with 5'SH C6.
4. The tip integrating extracellular vesicle capture and proteomics pre-processing according to claim 1, characterized in that: The synthesis method of Epoxy-CD63 is as follows: mixing a CD63 aptamer with TCEP, placing the mixture in an incubator, incubating the mixture in the dark at room temperature, and centrifuging for activation; adding PBS and Epoxy material to the activated CD63 aptamer, placing the mixture in an incubator, reacting the mixture, and washing the mixture with PBS to obtain the Epoxy-CD63 material.
5. Use of the pipette tip integrating extracellular vesicle capture and proteomics pre-processing according to any one of claims 1 to 4, characterized in that: Used for extracellular vesicle capture and proteomics pre-processing, including the following steps: S1: Add the body fluid sample to the pipette tip to capture extracellular vesicles; S2: Add a mixture of urea, thiourea, NaHPO4, TECP, and IAA to the pipette tip and place it in an incubator to lyse extracellular vesicles and capture the proteins released after extracellular vesicle lysis; S3: Add ethanolamine to the pipette tip and place it in an incubator to block the redundant capture sites of the protein capture material and the extracellular vesicle capture material; S4: Add Trypsin solution to the pipette tip and place it in an incubator for enzymatic hydrolysis of the protein. After the enzymatic hydrolysis is completed, centrifuge to obtain a peptide solution.
6. The use of the pipette tip integrating extracellular vesicle capture and proteomics pre-processing according to claim 5, characterized in that: In step S1, the body fluid sample is selected from urine filtrate, plasma eluate or cerebrospinal fluid eluate; The urine filtrate is obtained by: obtaining a urine sample, performing a first centrifugation on the urine sample to obtain a primary supernatant, and treating the primary supernatant through a filter membrane to obtain a urine filtrate; The plasma eluate is obtained by: obtaining a plasma sample, and subjecting the plasma sample to a mini-SEC column treatment to obtain a plasma eluate; The cerebrospinal fluid eluate is obtained by obtaining a cerebrospinal fluid sample, and performing mini-SEC column treatment on the cerebrospinal fluid sample to obtain the cerebrospinal fluid eluate.
7. The use of the pipette tip integrating extracellular vesicle capture and proteomics pre-processing according to claim 5, characterized in that: Washing was performed between each step of steps S1-S4 by centrifugation.
8. The use of the pipette tip integrating extracellular vesicle capture and proteomics pre-processing according to claim 5, characterized in that: In step S2, 6 M urea, 2 M thiourea, 5 mM TCEP, 10 mM IAA, and 0.1 M NaHPO4 were added, and then placed in an incubator at 55°C, 1000 rpm for 1 hour to rupture the extracellular vesicles and fix the proteins.
9. The use of the pipette tip integrating extracellular vesicle capture and proteomics pre-processing according to claim 5, characterized in that: In step S3, the concentration of added ethanolamine is 2 M; In step S3, the conditions for blocking the redundant capture sites are: placing in an incubator at 55° C., 1000 rpm, for 1 hour.
10. The use of the pipette tip integrating extracellular vesicle capture and proteomics pre-processing according to claim 5, characterized in that: In step S4, the enzymatic hydrolysis conditions are as follows: placing in an incubator, 50°C, 1000 rpm, for 30 minutes; In step S4, the centrifugal treatment is performed at a centrifugal force of 2000 g for 2 minutes.