A strain of Streptomyces SZWQ98, its inoculant and its application
The streptomyces SZWQ98 and its inoculants obtained through screening and identification have solved the problems of insignificant control effects on various soil-borne plant diseases and insufficient stability of biocontrol strains in existing technologies. They have achieved effective control of various soil-borne diseases and promotion of plant growth, meeting the needs of green development in modern agriculture.
Patent Information
- Application Number
- CN202510876293.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-27
- Publication Date
- 2026-01-30
- Estimated Expiration
- 2045-06-27
AI Technical Summary
Existing biological control technologies are not effective enough in controlling a variety of soil-borne plant diseases, and the stability and adaptability of biocontrol strains are insufficient, making it difficult to meet the needs of green development in modern agriculture.
A strain of Streptomyces SZWQ98 and its inoculant are provided. The Streptomyces SZWQ98 obtained through screening and identification can produce a variety of enzymes, has broad-spectrum antibacterial activity, and can be used in microbial inoculants to control soil-borne diseases such as potato black scurf, potato verticillium wilt, potato scab, sweet potato root rot, potato powdery scab, and peanut fruit rot, while promoting plant growth.
Streptomyces SZWQ98 significantly inhibits the growth of various soil-borne diseases and promotes plant growth, providing a new biocontrol resource and improving the stability and broad-spectrum of control effects.
Smart Images

Figure CN120699822B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, and in particular to a strain of Streptomyces SZWQ98, its inoculant, and its application. Background Technology
[0002] Soil-borne plant diseases are a serious problem in agricultural production, significantly impacting crop growth, development, and yield. Among them, soil-borne diseases such as potato scab, potato powdery scab, and peanut fruit rot are particularly prominent, causing huge economic losses to the production of these crops. Currently, control measures for these soil-borne diseases mainly fall into two categories: chemical pesticide control and biological control.
[0003] While chemical pesticides can quickly and effectively control disease outbreaks, long-term use can lead to soil pollution, increased pathogen resistance, and ecological imbalance, failing to meet the requirements of sustainable development in modern agriculture. Therefore, developing safe, environmentally friendly, and efficient biological control methods has become a key research focus. Biological control primarily utilizes microorganisms and their metabolites to inhibit the growth and reproduction of pathogens, offering advantages such as being non-toxic, harmless, and less prone to developing resistance. However, existing biological control technologies still have some shortcomings: firstly, some biocontrol strains have narrow inhibitory spectra, making it difficult to effectively control multiple soil-borne diseases simultaneously; secondly, biocontrol strains lack stability and adaptability in practical applications, being significantly affected by environmental factors, resulting in unstable control efficacy. Furthermore, existing biocontrol resources targeting integrated pest management for promoting plant growth and controlling soil-borne diseases remain scarce, limiting their widespread application in agricultural production.
[0004] In conclusion, there is an urgent need to develop a highly efficient, stable biocontrol strain with broad-spectrum antibacterial activity to effectively control a variety of soil-borne plant diseases, while simultaneously promoting healthy plant growth and meeting the needs of modern agricultural green development. Summary of the Invention
[0005] The purpose of this invention is to provide a Streptomyces strain SZWQ98, its inoculant, and its applications to solve the problems existing in the prior art. The Streptomyces SZWQ98 provided by this invention has significant control efficacy against various soil-borne plant diseases and also promotes plant growth, providing a new biocontrol resource for the biological control of soil-borne plant diseases and the promotion of plant growth.
[0006] To achieve the above objectives, the present invention provides the following solution:
[0007] This invention provides a Streptomyces sp. strain SZWQ98, which has the accession number CGMCC No. 30577.
[0008] The present invention also provides the application of the aforementioned Streptomyces SZWQ98 in the preparation of microbial inoculants, which are used to promote plant growth and / or prevent soil-borne diseases.
[0009] Optionally, the soil-borne diseases include potato black scurf, potato verticillium wilt, potato scab, sweet potato root rot, potato powdery scab, and peanut fruit rot;
[0010] The plants mentioned include cucumbers, peas, peanuts, and wheat.
[0011] The present invention also provides a microbial inoculant, the active ingredient of which includes the aforementioned Streptomyces SZWQ98.
[0012] Optionally, the microbial agent includes liquid and solid agents; in the liquid agent, the effective viable count of Streptomyces SZWQ98 is 4.6 × 10⁻⁶. 7 -5.20×10 7 CFU / mL; the effective viable count of Streptomyces SZWQ98 in the solid bacterial agent is 2.30 × 10⁻⁶ CFU / mL. 7 CFU / g.
[0013] The present invention also provides the application of the aforementioned Streptomyces SZWQ98 or the aforementioned microbial agent in promoting plant growth.
[0014] Optionally, the plants include cucumbers, peas, peanuts, and wheat; the promotion of plant growth includes promoting the growth of root length, plant height, leaf length, and leaf width of cucumber seedlings, and promoting the growth of plant height of pea, peanut, and wheat seedlings.
[0015] The present invention also provides the application of the aforementioned Streptomyces SZWQ98 or the aforementioned microbial agent in the prevention and control of soil-borne diseases.
[0016] Optionally, the soil-borne diseases include potato black scurf, potato verticillium wilt, potato scab, sweet potato root rot, potato powdery scab, and peanut fruit rot.
[0017] Optionally, the soil-borne diseases are potato black scurf, potato powdery scab, and peanut fruit rot.
[0018] The present invention discloses the following technical effects:
[0019] This invention screened a Streptomyces alfalfa strain from the rhizosphere soil of potato scab-infected fields with repeated cropping for many years, naming it Streptomyces SZWQ98. This strain is Gram-positive, capable of producing spores, and can produce proteases, pectinases, cellulases, and chitinases. This invention is the first to discover that Streptomyces SZWQ98 can inhibit the growth and disease development of Streptomyces scab, Rhizoctonia solani, Fusarium oxysporum, and Fusarium solani, with stable inhibitory effects. Furthermore, greenhouse pot experiments and field control trials verified that Streptomyces SZWQ98 has significant control effects against various soil-borne plant diseases (potato black scurf, potato powdery scab, and peanut fruit rot), and also promotes plant growth, providing a new biocontrol resource for the biological control of soil-borne plant diseases and promoting plant growth. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0021] Figure 1 This is a colony morphology diagram of Streptomyces alfalfa SZWQ98.
[0022] Figure 2 These are partial physiological and biochemical function test results for strain SZWQ98; where A represents the chitinase production ability test result; B represents the cellulase production ability test result; C represents the protease production ability test result; D represents the starch hydrolase production ability test result; E represents the siderophore production ability test result; F represents the potassium solubilization ability test result; G represents the nitrogen fixation ability test result; and H represents the IAA production ability test result.
[0023] Figure 3 Phylogenetic tree of strain SZWQ98 constructed based on 16S rRNA;
[0024] Figure 4 Phylogenetic tree of strain SZWQ98 constructed based on the rpoB gene;
[0025] Figure 5 Phylogenetic tree of strain SZWQ98 constructed based on the recA gene;
[0026] Figure 6This study investigated the inhibitory effects of *Streptomyces hygroscopicus* SZWQ98 on six pathogenic fungi. Specifically, A represents the inhibitory effect of *Streptomyces hygroscopicus* SZWQ98 on *Streptomyces hygroscopicus* CPS-1 (potato scab causal agent); B represents the inhibitory effect of *Streptomyces hygroscopicus* SZWQ98 on *Rhizoctonia solani* RS-7 (potato black scurf causal agent); C represents the inhibitory effect of *Streptomyces hygroscopicus* SZWQ98 on *Verticillium dahliae* VD-1 (potato verticillium wilt causal agent); D represents the inhibitory effect of *Streptomyces hygroscopicus* SZWQ98 on *Fusarium solani* GZ-3 (sweet potato root rot causal agent); E represents the inhibitory effect of *Streptomyces hygroscopicus* SZWQ98 on *Neurospora hygroscopicus* GF-1 (peanut fruit rot causal agent); and F represents the inhibitory effect of *Streptomyces hygroscopicus* SZWQ98 on *Fusarium oxysporum* GF-2 (peanut fruit rot causal agent).
[0027] Figure 7 The effects of treating alfalfa with Streptomyces SZWQ98 fermentation broth for 21 days on plant growth promotion were investigated. A represents the growth promotion effect on pea seedlings; B represents the growth promotion effect on cucumber seedlings; C represents the growth promotion effect on wheat seedlings; and D represents the growth promotion effect on peanut seedlings.
[0028] Figure 8 The results of a greenhouse pot seedling control experiment of Streptomyces alfalfa SZWQ98 inoculum against potato black scurf; where A is the control and B is the treatment with Streptomyces alfalfa SZWQ98 inoculum.
[0029] Figure 9 The results of a field tuber control trial of Streptomyces alfalfa SZWQ98 inoculum against potato black scurf; where A represents conventional management and B represents treatment with Streptomyces alfalfa SZWQ98 inoculum.
[0030] Figure 10 The results of a field trial on the control of peanut pod rot by alfalfa streptomyces SZWQ98 inoculant; where A represents conventional management and B represents treatment with alfalfa streptomyces SZWQ98 inoculant.
[0031] Figure 11 The results of a field trial on the control of potato powdery scab using the alfalfa streptomyces SZWQ98 inoculant are shown; where A represents conventional management and B represents treatment with the alfalfa streptomyces SZWQ98 inoculant. Detailed Implementation
[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0033] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0034] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0035] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0036] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0037] The pathogens used in the embodiments of this invention, namely *Streptomyces scabies* CPS-1, *Rhizoctonia solani* RS-7, *Verticillium dahliae* VD-1, *Fusarium oxysporum* GZ-3, *Neocosmosporavasinfecta* GF-1, and *Fusarium solani* GF-2, were all provided by the Laboratory of Plant Disease Biological Control and Molecular Plant Pathology, College of Plant Protection, Hebei Agricultural University.
[0038] Example 1: Isolation, screening, and identification of strain SZWQ98
[0039] 1. Isolation and screening of strain SZWQ98
[0040] Soil samples were taken from the root system of diseased plants in fields where potatoes had been continuously cropped for many years and were infected with scab. The samples were placed in a 200-mesh sieve and then sieved into PDA culture dishes coated with Streptomyces scabies CPS-1, the scab pathogen of potato scab. The dishes were then incubated at 28°C for 72 hours. Colonies of actinomycetes that showed inhibition zones were picked, purified by streak plating three times, and then preserved on PDA slant plates. After incubation for 120 hours, the cultures were stored in a culture preservation cabinet at 4°C.
[0041] Spore suspensions of different soil-borne pathogens (CPS-1, RS-7, VD-1, GZ-3, GF-1, and GF-2) were spread on PDA agar plates. Sterile filter paper discs with a diameter of 5.0 mm were placed on the plates. The obtained actinomycetes were propagated on oat liquid medium, and 5 μL was evenly inoculated onto the filter paper discs. The plates were incubated at 28℃ for 72 h. The strains that showed inhibitory effects against different soil-borne pathogens were selected, and the strain with the best effect was recorded as strain SZWQ98.
[0042] 2. Identification of strain SZWQ98
[0043] 2.1 Morphological observation of strain SZWQ98
[0044] Strawberry strain SZWQ98 was streaked onto PDA agar plates and incubated upside down at 28°C for 72 hours. Colony growth was observed and recorded, and the colony morphology on the plates was as follows: Figure 1 As shown, single colonies are small, round, with a ring-shaped protrusion in the center, and are initially white, turning gray later.
[0045] 2.2 Physiological and biochemical functional determination of strain SZWQ98
[0046] Inorganic phosphorus medium: 10.0g glucose, 0.5g (NH4)2SO4, 0.3g MgSO4·7H2O, 0.3g NaCl, 0.3g KCl, 0.03g FeSO4·7H2O, 0.03g MnSO4·7H2O, 5.0g Ca3(PO4)2, 17.0g agar, add distilled water to a final volume of 1.0L, maintain pH between 7.0 and 7.4, autoclave at 121℃ for 20min.
[0047] Nitrogen-fixing medium: KH2PO4 0.2g, MnSO4 0.2g, NaCl 0.2g, CaCO3 5.0g, mannitol 10.0g, CaSO4 0.1g, agar 18.0g, add distilled water to a final volume of 1.0L, pH 7.0, autoclave at 121℃ for 30min.
[0048] Potassium-solubilizing medium: Na2HPO4 2.0g, FeCl3 0.005g, MgSO4·7H2O 0.5g, CaCO3 0.1g, sucrose 5.0g, potassium feldspar powder (washed 5 times with deionized water) 1.0g, bromothymol blue 0.1g, agar 20.0g, add distilled water to a final volume of 1.0L, pH 7.0, autoclave at 121℃ for 20min.
[0049] Chitinase medium: NaCl 1.5g, KH2PO4 0.3g, K2HPO4 0.7g, FeSO4·7H2O 0.02g, MgSO4 0.5g, agar 20.0g, 2% chitin colloid 250mL, add distilled water to make up to 1.0L, pH 7.0, autoclave at 121℃ for 20min.
[0050] Protease culture medium: 15.0g skim milk powder, 15.0g agar, add distilled water to a final volume of 1.0L, set pH to normal, autoclave at 110℃ for 15min.
[0051] Pectinase culture medium: 0.5g MgSO4·7H2O, 1.0g KH2PO4·3H2O, 0.01g FeSO4·7H2O, 2.0g pectin, 0.2g Congo red, 20.0g agar, add distilled water to a final volume of 1.0L, set pH to natural, autoclave at 121℃ for 20min.
[0052] Starch hydrolase culture medium: 2.0g soluble starch, 3.0g beef extract, 5.0g peptone, 2.5g glucose, 18.0g agar, add distilled water to a final volume of 1.0L, pH 7.0, autoclave at 121℃ for 20min.
[0053] IAA medium: Add 0.1g of L-tryptophan to LB medium and autoclave at 121℃ for 20min.
[0054] Cellulase medium: 10.0g peptone, 10.0g sodium carboxymethyl cellulose (CMC-Na), 5.0g yeast extract, 5.0g NaCl, 0.2g MgSO4, 1.0g KH2PO4, 20.0g agar, add distilled water to a final volume of 1.0L, autoclave at 115℃ for 30min.
[0055] Laccase medium: Add 0.04% guaiacol to LB medium and autoclave at 121℃ for 20 min.
[0056] Siderophore culture medium (CAS): CAS 0.0605g, HDTMA 0.0729g, FeCl3·6H2O 0.002645g, NaH2PO4·2H2O 0.29525g, Na2HPO4·12H2O 1.2135g, NH4Cl 0.125g, KH2PO4 0.0375g, NaCl 0.0625g, agar 9.0g, diluted with distilled water to a final volume of 1.0L, autoclaved at 116℃ for 30min, purchased from Haibo Biotechnology Co., Ltd.
[0057] Salkowski colorimetric solution: 15 mL of 0.5 mol / L FeCl3 solution, 300 mL of H2SO4, and 500 mL of distilled water. Mix well before use and store away from light.
[0058] Colloidal chitin: Slowly pour 300 mL of pre-cooled concentrated hydrochloric acid into a beaker containing 20.0 g of chitin powder, add 100 mL of distilled water, stir with a glass rod to form a paste, place in a 4°C refrigerator to swell for 24 h, then add more distilled water and stir well. Centrifuge at 5000 r / min for 10 min, discard the supernatant, wash the precipitate repeatedly with water until neutral, and add distilled water to a final volume of 1.0 L.
[0059] Strains SZWQ98 were inoculated onto protease, pectinase, cellulase, chitinase, and laccase agar, respectively, and incubated at 28°C for 4 days. The presence of clear zones around the strain on the protease, pectinase, and chitinase agar was observed. If clear zones were present, the strain exhibited corresponding antibiotic properties; otherwise, it did not.
[0060] Starting from day 2, observe the laccase culture medium daily to see if a reddish-brown oxidation zone appears around the strain. If an oxidation zone appears, it indicates that the strain can produce laccase; otherwise, it cannot.
[0061] After culturing strain SZWQ98 on cellulase medium for 5 days, an appropriate amount of Congo red solution (1 mg / mL) was added to the medium. After staining for 1 hour, the Congo red solution was poured out, and the strain was repeatedly washed with distilled water. Finally, it was soaked and eluted with an appropriate amount of NaCl solution (1 mol / L) for 30 minutes. The NaCl eluent was then poured out. If a clear zone was formed around the strain, it indicated that cellulase could be produced; otherwise, it could not.
[0062] After culturing for 7 days on a medium for testing inorganic phosphorus solubility, hydrolysis zones were observed around the colonies, indicating that this strain has the ability to dissolve inorganic phosphorus.
[0063] After culturing on CAS medium for 7 days, hydrolysis zones appeared around the colonies, indicating that the strain has the ability to produce siderophores.
[0064] The potassium solubilization and nitrogen fixation capacity test showed that the tested strain had the ability to solubilize potassium and fix nitrogen, and the presence of colonies on the culture medium proved that the strain had the ability to solubilize potassium and fix nitrogen.
[0065] After culturing on amylase production capacity test medium for 7 days, iodine solution was added for uniform staining. After standing for 5 minutes, a hydrolysis zone appeared around the colony, indicating that it has the ability to produce amylase.
[0066] The strain was inoculated into IAA production capacity test medium and cultured on a shaker for 7 days. 1.0 mL of bacterial solution was added to a test tube, and an equal amount of Salkowski colorimetric solution was added and mixed well. The mixture was left to stand in the dark for 30 min. When the color turned red, it indicated that the strain had the ability to produce IAA.
[0067] In summary, the detection results of strain SZWQ98 are shown in Table 1 and... Figure 2 As shown.
[0068] Table 1. Statistical analysis of functional test results for strain SZWQ98
[0069] Related characteristics Strain SZWQ98 Protease production + Cellulase production + Chitinase production + Laccase - amylase production + Iron production carrier + Produced by IAA + Phosphate solubilization - Potassium solubilization + Nitrogen fixation +
[0070] Note: "+" indicates a positive result, and "-" indicates a negative result.
[0071] Depend on Figure 2 As shown in Table 1, this strain produces protease, cellulase, amylase, chitinase, IAA, and siderophores, and also has potassium solubilization and nitrogen fixation functions.
[0072] 2.3. Multi-gene molecular identification by combining 16S rRNA, rpoB, and recA gene sequences.
[0073] DNA was extracted from strain SZWQ98 using a fungal genomic DNA extraction kit (Kingclone Biotechnology Co., Ltd.). PCR amplification was performed using the universal amplification primer 27F / 1492R for the 16S rRNA gene, and the specific primers rpoB-F / rpoB-R and recA-F / recA-R for the RNA polymerase β subunit encoding gene rpoB and the recombinase A encoding gene recA. The primer sequences are detailed in Table 2.
[0074] Table 2. Molecular Biological Identification and Sequencing Primers
[0075]
[0076]
[0077] The obtained PCR products were detected by 1% agarose gel electrophoresis and sent to Tianjin Qingke Biotechnology Co., Ltd. for sequencing. The nucleotide sequences of different genes of strain SZWQ98 are as follows:
[0078] The nucleotide sequence of 16S rRNA is shown in SEQ ID NO.7, specifically:
[0079]
[0080] The nucleotide sequence of the rpoB gene is shown in SEQ ID NO.8, specifically:
[0081] TTGCCGAGGGCCATCTCGCCCTCTTCGGTCGCGGGACCGTCGGCCAGGACCTGGCCCTCGATCACGCGGGCGCCCTCGTCGACGACGACCTTCTGGTTGACCGAGGTGCCCTGGTTCGACCGGGAGAACTTGGCGATGCGGTACGTGGTGTACGTGCCGTCGTCGTTGGTGACGGTGACGTAGTCCGCGGAGACCTCCTGGACCACACCCGCCTTCTCGGCCTTGATGACGTCACCGGCGTCGACCGCGCAGCGGTACTCCATGCCGGTGCCGACGAGGGGGGCCTCGGCGGTGATCAGCGGCACGGCCTGACGCATCATGTTCGCGCCCATGAGGGCACGGTTGGCGTCGTCGTGCTCCAGGAAGGGGATCATCGCGGTCGCGACGGACACCATCTGGCGCGGCGAGACGTCCATGTAGTCGACGTCCGTGCCGGGCACGTAGTCGATCTCGCCGCCGCGGCGGCGGATCAGGACGCGGGCCTCGGCGAAGTGGAGGTCGTCCGTCAGCGGCGCGTTGGCCTGTGCGATGACGAAGCGGTCCTCCTCGTCGGCCGTGAGGTAGTCGACGTCGTCGGTGACCTGGCCGTCGACGACCTTGCGGTACGGCGTCTCGACGAAGCCGAACGCGTTGACGCGGCCGTACGAGGCGAGCGAACCGATCAGACCGATGTTCGGGCCTTCGGGCGTCTCGATGGGGCACATGCGTCCGTAGTGGGACGGGTGCACGTCACGGACCTCGAAGCCGGCCCGCTCACGGGAGAGACCACCCGGGCCGAGCGCCGAAAGACGGCGCTTGTGGGTGAGACCCGACAGCGGGTTGTTCTGGTCCATGAACTGCGACAGCTGCGAGGTGCCGAAGAATTCCTTGATCGACGCCACGACCGGGCGAAA;
[0082] The nucleotide sequence of the recA gene is shown in SEQ ID NO.9, specifically:
[0083] CGCAATCGGCAAGGGCGCAGTGATGCGCATGGGCGAGCGGCCGAACGAGCCCATCGAGGTCATCCCCACCGGGTCGACCGCGCTCGACGTCGCGCTCGGCGTCGGCGGCATCCCGCGCGGCCGCGTGGTGGAGGTGTACGGCCCGGAGTCCTCCGGTAAGACGACCCTCACCCTGCACGCGGTGGCCAACGCCCAGCGGGCGGGCGGCGCGGTGGCGTTCGTGGACGCGGAGCACGCCCTCGACCCGGAGTACGCGAAGAAGCTCGGCGTCGACATCGACAACCTCATCCTGTCTCAGCCGGACAACGGCGAGCAGGCCCTCGAGATCGTCGACATGCTGGTCCGCTCCGGCGCCCTCGACCTCATCGTCATCGACTCCGTCGCCGCCCTGGTGCCGCGCGCGGAGATCGAGGGCGAGATGGGTGACTCGCACGTGGGTCTCCAGGCCCGCCTGATGAGCCAGGCGCTCCGGAAGATCACCAGCGCGCTCAACCAGTCCAAGACCACCGCGATCTTCATCAACCAGCTCCGCGAGAAGATCGGCGTCATGTTCGGCTCCCCGGAGACCACGACCGGTGGCCGGGCGCTGAAGTTCTACGCCTCGGTGCGCATGGACATCCGCCGCATCGAGACCTTGAAGGACGGCACGGACGCGGTGGGCAACCGCACCCGCGTCAAGGTCGTCAAGAACAAGGTCGCGCCGCCCTTCAAGCAGGCCGAGTTCGACATCCTCTACGGCCAGGGCATCAGCCGCGAGGGCGGCCTGATCGACATGGGCGTCGAGCACGGCTTCGTCCGCAAGGCGGGCGCCTGGTACACGTACGAGGGCGACCAGCTCGGCCAGGGCAAGGAGAACGCCCGG。
[0084] After verifying the obtained sequences, they were submitted to the GenBank database for BLAST alignment. Sequences with high similarity were selected for analysis. A phylogenetic tree of different genes in strain SZWQ98 was constructed using the neighbor-joining method in Mega 11.0 software. Figures 3-5 The 16S rDNA sequence of the strain in this embodiment has 99.72%, 100%, and 100% homology with the 16S rRNA, rpoB gene, and recA gene of Streptomyces alfalfae, respectively.
[0085] Based on the above morphological observations, physiological and biochemical characteristics, and multi-gene sequence identification results, the strain screened in this embodiment can be identified as Streptomyces sp., and named Streptomyces SZWQ98.
[0086] The Streptomyces sp. SZWQ98 obtained in this embodiment of the invention was deposited on May 10, 2024, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences; postal code: 100101), with accession number CGMCC No. 30577.
[0087] Example 2: In-plate inhibition test of Streptomyces alfalfa SZWQ98 against soil-borne pathogens
[0088] The tested pathogens were: Streptomyces scabies CPS-1 (abbreviated as CPS-1), Rhizoctonia solani RS-7 (abbreviated as RS-7), Verticillium dahliae VD-1 (abbreviated as VD-1), Fusarium oxysporum GZ-3, Neocosmosporavasinfecta GF-1 (abbreviated as GF-1), and Fusarium solani GF-2 (abbreviated as GF-2).
[0089] The inhibition test method for the scab fungus of potato is as follows: Take 40 μL of the spore suspension of the pathogen CPS-1 and spread it evenly on a PDA plate. Use sterile tweezers to pick up a 6 mm diameter SZWQ98 mycelial cake and place it in the center of the plate. Repeat three times. Place the petri dish in a 28℃ incubator and incubate in the dark for 5 days. Measure and record the width of the inhibition band.
[0090] Other pathogens were detected using the plate confrontation method. Using various soil-borne pathogens as indicator bacteria, the antibacterial activity of *Streptomyces alfalfa* SZWQ98 was tested. The specific steps were as follows: A 6mm diameter perforator was used to create a mycelial disc on a pathogen plate. The disc was then inoculated upside down into the center of PDA medium and incubated upside down at 28℃ until the pathogen colony diameter reached 2cm. A 6mm diameter *Streptomyces alfalfa* SZWQ98 mycelial disc was then placed 2cm from the pathogen edge using sterile forceps. Plates without *Streptomyces alfalfa* SZWQ98 served as a control. The experiment was repeated three times. The plates were incubated at 28℃ for 4 days. The pathogen radius (distance between the pathogen edge at inoculation and the colony edge at measurement) in both the control and treatment groups was measured to calculate the inhibition rate. The width of the inhibition band was also measured. The formula for calculating the inhibition rate is as follows:
[0091] Inhibition rate (%) = (radius of pathogen in control group - radius of pathogen in confrontation group) / radius of pathogen in control group × 100.
[0092] The antibacterial test results are shown in Table 3 and Figure 6 As shown, *Streptomyces clover* SZWQ98 exhibits good antibacterial activity against all six tested soil-borne pathogens. It forms a distinct inhibition zone against each tested soil-borne pathogen, significantly inhibiting their growth. Therefore, *Streptomyces clover* SZWQ98 demonstrates good antibacterial activity against various soil-borne pathogens.
[0093] Table 3. Results of antibacterial tests of strain SZWQ98 against six soil-borne pathogens.
[0094]
[0095]
[0096] Example 3: Preparation of Streptomyces alfalfa SZWQ98 inoculant
[0097] 1. Preparation of Streptomyces alfalfa SZWQ98 liquid inoculant
[0098] Streptomyces alfalfa SZWQ98 was inoculated into LB medium and activated at 28°C for 72 h. The activated strain was then propagated in 500 mL Erlenmeyer flasks to obtain a seed culture. This seed culture was inoculated into medium 2 at a 5% inoculation rate, and continuous fermentation was carried out in 500 mL shake flasks and 50 L fermenters for 72 h. Samples were taken promptly after each fermentation. Gradual dilution plate counting was performed to determine the bacterial count in the fermentation broth.
[0099] The liquid volume of a 500mL shake flask was 50mL, the initial inoculum was 8%, the shaker speed was 180r / min, the incubation temperature was 28℃, and the incubation time was 72h, resulting in a primary fermentation of *Streptomyces clover* SZWQ98 liquid inoculum with an effective viable count of 5.20×10⁻⁶ cells / mL. 7 CFU / mL.
[0100] A 50L fermenter was filled with 30L of liquid, with an initial inoculum of 5%, a rotation speed of 200 rpm, a culture temperature of 30℃, and a culture time of 144 h. This yielded a secondary fermentation of *Streptomyces clover* SZWQ98 liquid inoculum, with an effective viable count of 4.60 × 10⁻⁶ cells / year. 7 CFU / mL.
[0101] The formula for culture medium No. 2 is as follows: 1.0 wt.% wheat bran powder, 1.5 wt.% glucose, 1.0 wt.% peanut cake powder, 0.5 wt.% magnesium sulfate, 0.5 wt.% ammonium sulfate, 0.1 wt.% calcium carbonate, 0.5 wt.% sodium chloride, and distilled water to a final volume of 1000 mL. After mixing, autoclave at 121℃ for 20 min.
[0102] 2. Preparation of Streptomyces alfalfa SZWQ98 solid inoculum
[0103] The obtained alfalfa streptomyces SZWQ98 liquid fermentation broth (effective viable count 4.60 × 10⁻⁶) was used to ferment alfalfa streptomyces SZWQ98. 7 (CFU / mL) was inoculated into a solid matrix at an inoculum size of 0.4 mL / g to obtain a solid formulation of Streptomyces cloverii SZWQ98 with a viable count of 2.30 × 10⁻⁶ CFU / mL. 7 CFU / g.
[0104] The solid matrix formulation is a mixture of diatomaceous earth and zeolite powder in a mass ratio of 8:2.
[0105] Example 4: Safety determination of alfalfa streptomyces SZWQ98 seedlings
[0106] Streptomyces alfalfa SZWQ98 liquid inoculant (4.60×10⁻⁶) 7 The safety of the fermentation broth (CFU / mL) in seedlings of cucumber, pea, peanut, and wheat was tested. After emergence, seedlings with uniform growth were selected, and the fermentation broth was diluted 10 times and applied to the roots. Water was used as a control. The plant growth of different plants was monitored and observed. After 15 days of treatment, various growth indicators of the plants were investigated and statistically analyzed. The results are shown in Table 4. Figure 7 .
[0107] Table 4. Statistical analysis of growth indicators of different crop seedlings after treatment with Streptomyces alfalfa SZWQ98 fermentation broth.
[0108]
[0109]
[0110] From Table 4 and Figure 7 It was found that the application of *Streptomyces alfalfa* SZWQ98 fermentation broth significantly promoted the growth of cucumber seedlings in terms of root length, plant height, leaf length, and leaf width, and also promoted the growth of pea, peanut, and wheat seedlings. Statistical results on various seedling indicators showed that *Streptomyces alfalfa* SZWQ98 was safe for all tested plant seedlings and had a certain growth-promoting effect.
[0111] Example 5: Control effect of Streptomyces alfalfa SZWQ98 on potato black scurvy
[0112] 1. Experiment on the efficacy of liquid bacterial agents
[0113] A greenhouse experiment was conducted to control potato black scurf using fermentation broth of *Streptomyces hygroscopicus* SZWQ98. 20cm diameter pots were filled to 3 / 4 of their height with a substrate (natural soil, vermiculite, and nutrient soil in a 2:1:1 mass ratio). Five seed potatoes of the tested potato variety "Feureita" were planted in the substrate per pot. Two treatments were included: a control group inoculated with the pathogen and sterile water, and a treatment group inoculated with the pathogen and *Streptomyces hygroscopicus* SZWQ98 fermentation broth. Each treatment was replicated six times. When the seedlings reached approximately 15cm in height, each pot in the treatment group was inoculated with 4.60 × 10⁻⁶ *Streptomyces hygroscopicus* SZWQ98 fermentation broth. 7 200 mL of a 20-fold dilution of CFU / mL was administered. Three days later, both the treatment and control groups were inoculated with 1×10⁻⁶ CFU / mL of the black nevus pathogen. 6 The solution was prepared at 200 mL (CFU / mL), maintaining a suitable temperature and moist soil. After 20 days, a disease incidence survey was conducted, and the disease index and control effect were calculated. The results showed that the control efficacy of Streptomyces alfalfa SZWQ98 fermentation broth reached 82.88%, and the number of lesions on the stems was significantly reduced (Table 5). Figure 8 ).
[0114] Table 5. Greenhouse control effect of Streptomyces alfalfa SZWQ98 fermentation broth on potato black scurvy.
[0115] deal with Disease index Prevention and control effect alfalfa streptomyces SZWQ98 fermentation broth 12.50±0.90 82.88% CK 73.00±0.79 —
[0116] 2. Experiment on the combined control efficacy of solid-liquid bacterial agents
[0117] A field experiment was conducted to control potato black scurf using the alfalfa streptomyces SZWQ98 inoculant. The experimental plots were potato fields that had been continuously cropped with potatoes for many years and were infected with the disease. The potato variety used in the experiment was "Atlantic". Each treatment area was 66.6 m². 2 Apply Streptomyces alfalfa SZWQ98 solid inoculant (2.30 × 10⁻⁶) in furrows during sowing. 7 CFU / g), dosage is 0.09 kg / m³. 2During potato growth, use Streptomyces alfalfa SZWQ98 liquid inoculant (4.60×10⁻⁶). 7 Two drip irrigation treatments were administered (CFU / mL), each at a dose of 10 L / treatment, diluted 20 times. Conventional production management served as the control. At potato harvest, five-point sampling was conducted on tubers using a diagonal method to calculate the disease incidence, disease index, and control efficacy. The results showed that the control had a disease incidence of 94.0% and a disease index of 45.13; the treatment with *Streptomyces alfalfa* SZWQ98 inoculant resulted in a disease incidence of 28.57%, a disease index of 14.29, and a control efficacy of 68.34%, demonstrating significant control effects (Table 6). Figure 9 ).
[0118] Table 6. Statistical results of field control trials of *Streptomyces alfalfa* SZWQ98 inoculant against potato black scurvy.
[0119]
[0120]
[0121] Example 6: Effect of Streptomyces alfalfa SZWQ98 inoculant on peanut fruit rot.
[0122] The experimental plot was a peanut field infected with peanut pod rot due to continuous cropping for many years. The experimental variety was Yunnan Seven-Color Peanut, and the treatment area was 180m². 2 The specific steps are as follows: During the peanut plant growth period, apply Streptomyces alfalfa SZWQ98 inoculant (4.60×10⁻⁶). 7 The fertilizer was applied via drip irrigation three times (CFU / mL). The first application was on July 8, 2024, during the flowering and pegging stage; the second application was on August 7, 2024; and the third application was on August 28, 2024. Each application was 0.2 L / m³. 2 Diluted 20 times before application, with conventional management as the control. Before peanut harvest, a survey was conducted on all pods in both the treatment and control groups, and the number of pods at each grade was counted. Disease incidence, disease index, and control efficacy were measured for each treatment. Results showed that the disease incidence rate in the control plot was 76.75%, and the disease index was 34.59; after treatment with *Streptomyces alfalfa* SZWQ98 inoculant, the disease incidence rate was 47.15%, the disease index was 17.54, and the control efficacy was 49.29%, demonstrating significant efficacy. The diseased pod loss rate in the control group was 13.03%, while the diseased pod loss rate after treatment with *Streptomyces alfalfa* SZWQ98 inoculant was 5.19%. The loss rate in the treatment group was significantly lower than that in the control group, reducing yield loss by 7.84%, indicating a better control effect on peanut pod rot (Table 7). Figure 10 ).
[0123] Table 7. Statistical results of the control test of *Streptomyces alfalfa* SZWQ98 inoculant against peanut fruit rot.
[0124] Processing Number Incidence rate (%) Disease index Preventive efficacy (%) Loss rate (%) Streptomyces alfalfa SZWQ98 inoculant 47.15 17.54 49.29 5.19 Production comparison 76.75 34.59 — 13.03
[0125] Example 7: Control effect of Streptomyces alfalfa SZWQ98 on potato powdery scab
[0126] The experimental plots were fields where potato powdery scab had been present for many years due to continuous cropping, with each treatment covering an area of 66.6 m². 2 The potato variety used in the experiment was "Wotu No. 5". The specific steps were as follows: when planting on May 7, 2024, alfalfa streptomyces SZWQ98 solid inoculant was applied in furrows at a rate of 0.09 kg / m². 2 During the plant growth period, alfalfa streptomyces SZWQ98 liquid inoculant was applied via drip irrigation three times. The first application was on July 24, 2024, during the tuber formation stage; the second application was on August 10, 2024, during the tuber enlargement stage; and the third application was on August 23, 2024, during the tuber enlargement stage. Each application was 0.2 L / m². 2 The dilution was 20 times, with conventional management as the control. Before potato harvest, a five-point sampling survey was conducted using the diagonal method to count the number of tubers at each grade. The incidence rate, disease index, and control efficacy were calculated. The experimental results showed that the incidence rate of potato powdery scab in the control group of the "Wotu No. 5" variety was 76.7%, and the disease index was 50.32. The incidence rate in the treatment group with *Streptomyces alfalfa* SZWQ98 inoculant was 43.63%, and the disease index was 22.11. The control efficacy of *Streptomyces alfalfa* SZWQ98 inoculant against potato powdery scab was 56.06% (Table 6). Figure 11 ).
[0127] Table 6. Statistics of the survey on the control of potato powdery scab by biocontrol agents.
[0128]
[0129]
[0130] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A strain of Streptomyces sp. SZWQ98, characterized in that, The Streptomyces SZWQ98 has a preservation number of CGMCC No.30577.
2. The use of the Streptomyces of claim 1 in the preparation of microbial inoculants, characterized in that, The microbial agent is used for promoting plant growth and / or preventing soil-borne diseases.
3. Use according to claim 2, characterized in that, The soil-borne diseases include potato black scurf, potato brown rot, potato scab, sweet potato root rot, potato powdery scab and peanut fruit rot. The plants include cucumber, pea, peanut and wheat.
4. A microbial inoculant, characterized in that, The effective component includes the Streptomyces SZWQ98 of claim 1. The microbial agent includes a liquid microbial agent and a solid microbial agent; in the liquid microbial agent, the effective viable cell number of the Streptomyces SZWQ98 is 4.6×10 7 -5.20×10 7 CFU / mL, and the preparation method comprises the following steps: The Streptomyces SZWQ98 is inoculated into LB medium and activated for 72 hours at 28℃, and then expanded to obtain fermentation seed liquid, which is inoculated into No.2 medium for fermentation culture to obtain fermentation liquid, which is prepared into the liquid microbial agent; the No.2 medium is composed of 1.0wt.% wheat bran powder, 1.5wt.% glucose, 1.0wt.% peanut cake powder, 0.5wt.% magnesium sulfate, 0.5wt.% ammonium sulfate, 0.1wt.% calcium carbonate and 0.5wt.% sodium chloride. The effective viable cell number of Streptomyces SZWQ98 in the solid bacterial agent is 2.30×10 7 CFU / g, and the preparation method comprises the following steps: The fermentation liquid obtained in the preparation of the liquid microbial agent is inoculated into a solid substrate obtained by mixing diatomite and zeolite powder at a mass ratio of 8:2 to obtain the solid microbial agent. 5.A use of the Streptomyces SZWQ98 of claim 1 or the microbial agent of claim 4 in promoting plant growth.
6. Use according to claim 5, characterized in that, The plants include cucumber, pea, peanut and wheat; and the promotion of plant growth includes promoting the growth of cucumber seedling root length, plant height, leaf length and leaf width, and promoting the growth of pea, peanut and wheat seedling plant height. 7.A use of the Streptomyces SZWQ98 of claim 1 or the microbial agent of claim 4 in preventing soil-borne diseases.
8. Use according to claim 7, characterized in that, The soil-borne diseases include potato black scurf, potato brown rot, potato scab, sweet potato root rot, potato powdery scab and peanut fruit rot.
Citation Information
Patent Citations
Streptomyces strain PBSH9 for controlling potato scab and promoting potato growth, and application thereof
CN110200016A
Radiation-resistant streptomyces and application thereof
CN116716225A