Application of ZmYAB15 gene in regulating high temperature tolerance of maize

Abstract

The present application relates to the field of biotechnology, in particular to the application of ZmYAB15 gene in regulating the high temperature tolerance of corn. The present application increases the expression level of ZmYAB15 protein in corn or the expression amount of ZmYAB15 gene in corn, achieves the effects of increasing the spikelet opening rate of corn, promoting the development of spikelet parenchyma tissue of corn, increasing the opening angle of corn spikelet and increasing the number of tassel branches, and realizes the purpose of improving the high temperature tolerance of corn. Therefore, the ZmYAB15 protein, ZmYAB15 gene or biological material provided by the present application can be used to regulate the high temperature tolerance of corn, and has important significance for cultivating high temperature tolerant corn varieties.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to the application of ZmYAB15 gene in regulating the high temperature tolerance of corn. BACKGROUND

[0002] At present, corn (Zea mays L.) is one of the main food and feed crops, which is severely persecuted by high temperature. The yield of corn will be greatly reduced after being subjected to high temperature heat stress. Therefore, it is a major task to be tackled to excavate high temperature resistance gene resources, elucidate the molecular mechanism of high temperature resistance and cultivate new varieties of high temperature tolerant crops.

[0003] High temperature heat stress can cause various physiological and biochemical changes in corn. For example, high temperature can cause stamen opening to be blocked, hinder the growth of filaments, affect the shedding of pollen and increase the distance between male and female; high temperature can destroy the chloroplast structure of leaves, significantly reduce the content of chlorophyll, and reduce the photosynthetic efficiency and inhibit photosynthesis; high temperature can accelerate the filling speed, shorten the filling time, and cause the premature termination of endosperm development; high temperature can also hinder root growth and reduce root activity, leading to early root decline and affecting water transmission and nutrient absorption of the whole plant. In terms of biochemical processes, high temperature can cause damage to photosynthesis, increase membrane permeability, accumulate too much reactive oxygen species and hormone imbalance, so high temperature stress severely limits corn production from multiple angles. Moreover, corn at different growth stages has different sensitivity to high temperature heat stress, especially at the flowering stage. After corn is subjected to high temperature heat stress during flowering, the stamen opening is affected, the anther dehiscence and pollen shedding are inhibited, thereby greatly reducing the seed setting rate and significantly reducing the corn yield. Under the background of global warming, high temperature during flowering has become one of the main limiting factors of high corn yield.

[0004] In order to reduce the impact of high temperature heat stress on corn production, in recent decades, researchers have continuously excavated genes related to corn heat tolerance, studied the physiological response mechanism under high temperature stress, and improved heat-resistant corn varieties through hybridization or molecular breeding techniques, combined with relevant agricultural measures (reasonable arrangement of sowing period, avoidance of high temperature period, selection of high temperature resistant corn varieties, field environment regulation, etc.). However, in recent years, frequent high temperature heat stress has had a huge impact on corn production, and excavating high temperature resistance genes and improving and cultivating new varieties of high temperature resistant corn are effective measures to fundamentally reduce the impact of high temperature heat stress. However, there are few reported high temperature resistant genes, and the related research foundation is also relatively weak. SUMMARY

[0005] The purpose of the present application is to provide the application of ZmYAB15 gene in regulating the high temperature tolerance of corn, so as to solve the problems existing in the prior art.

[0006] In order to achieve the above purpose, the present application provides the following scheme:

[0007] The application provides application of a ZmYAB15 protein, a ZmYAB15 gene or a biological material containing the ZmYAB15 gene in any one of the following,

[0008] (1) regulating high-temperature tolerance of corn;

[0009] (2) regulating floret opening rate of corn;

[0010] (3) regulating floret plume tissue development of corn;

[0011] (4) regulating floret awn opening angle of corn;

[0012] (5) regulating tassel branch number of corn;

[0013] (6) cultivating high-temperature tolerant corn;

[0014] The amino acid sequence of the ZmYAB15 protein is shown as SEQ ID NO: 2; and the nucleotide sequence of the ZmYAB15 gene is shown as SEQ ID NO: 1.

[0015] Preferably, the high-temperature tolerance of corn, the floret opening rate of corn, the floret plume tissue development of corn, the floret awn opening angle of corn and the tassel branch number of corn are improved by increasing the expression level of the ZmYAB15 protein in corn or increasing the expression amount of the ZmYAB15 gene in corn;

[0016] The biological material includes a recombinant expression vector or a recombinant bacterium.

[0017] The application provides a method for improving high-temperature tolerance of corn, which comprises the step of overexpressing a ZmYAB15 gene in corn; and the nucleotide sequence of the ZmYAB15 gene is shown as SEQ ID NO: 1.

[0018] The application provides a method for improving floret opening rate of corn, which comprises the step of overexpressing a ZmYAB15 gene in corn; and the nucleotide sequence of the ZmYAB15 gene is shown as SEQ ID NO: 1.

[0019] The application provides a method for promoting floret plume tissue development of corn, which comprises the step of overexpressing a ZmYAB15 gene in corn; and the nucleotide sequence of the ZmYAB15 gene is shown as SEQ ID NO: 1.

[0020] The application provides a method for improving floret awn opening angle of corn, which comprises the step of overexpressing a ZmYAB15 gene in corn; and the nucleotide sequence of the ZmYAB15 gene is shown as SEQ ID NO: 1.

[0021] The application provides a method for increasing the number of tassel branches of corn, comprising the step of overexpressing a ZmYAB15 gene in corn; the nucleotide sequence of the ZmYAB15 gene is shown as SEQ ID NO: 1.

[0022] The application provides a method for breeding high-temperature-resistant corn, comprising the step of overexpressing a ZmYAB15 gene in corn; the nucleotide sequence of the ZmYAB15 gene is shown as SEQ ID NO: 1.

[0023] The application discloses the following technical effects:

[0024] The application provides a new application of a ZmYAB15 protein, a ZmYAB15 gene or a biological material. The results of specific embodiments of the application prove that, compared with wild-type corn (B104), the spikelet opening of corn tassel is blocked under high temperature, the spikelet opening rate of corn tassel is improved under high temperature for the material overexpressing the ZmYAB15 gene compared with the wild-type corn, the expression of the ZmYAB15 gene is down-regulated after high-temperature treatment (42 DEG C), and the expression of the ZmYAB15 gene is responsive to high temperature. Meanwhile, the results of specific embodiments of the application also prove that the gene can regulate the spikelet opening rate of corn, regulate the development of the spikelet plume tissue of corn, regulate the opening angle of the spikelet of corn, regulate the number of tassel branches of corn and breed high-temperature-resistant corn, and finally realize the regulation of the high-temperature resistance of corn, specifically, by improving the expression level of the ZmYAB15 protein in corn or improving the expression amount of the ZmYAB15 gene in corn, the effects of improving the spikelet opening rate of corn, promoting the development of the spikelet plume tissue of corn, improving the opening angle of the spikelet of corn and improving the number of tassel branches of corn are achieved, and the purpose of improving the high-temperature resistance of corn is achieved. Therefore, the ZmYAB15 protein, the ZmYAB15 gene or the biological material provided by the application can be used for regulating the high-temperature resistance of corn, and has important significance for breeding high-temperature-resistant varieties. BRIEF DESCRIPTION OF DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings in the following description are only some embodiments of the application, and for those skilled in the art, other drawings can also be obtained from these drawings without creative labor.

[0026] Figure 1 Two selfing lines (B73 and B104) at the two-leaf one-heart stage were treated with high temperature for 0h, 3h, 6h, 12h, 24h, 36h and 12h of recovery growth, and the expression amount of the ZmYAB15 gene in the second leaf was determined.

[0027] Figure 2 Obtaining of ZmYAB15 gene editing material; wherein, a is a CRISPR / Cas9 vector schematic diagram of ZmYAB15 gene; b is ZmYAB15 gene editing mutant sequence analysis; c is a schematic diagram of three mutation types of ZmYAB15 gene editing material;

[0028] Figure 3 Obtaining of ZmYAB15 gene overexpression material; wherein, a is a schematic diagram of overexpression vector (pCAMBIA3301-ubi-ZmYAB15) of ZmYAB15 gene; b is a DNA positive identification electrophoresis gel map of ZmYAB15 overexpression material; c is the expression amount of ZmYAB15 gene in ZmYAB15 gene overexpression material;

[0029] Figure 4 Wild type corn B104 (control strain WT) and ZmYAB15 gene editing strain in Langfang, Hebei Province, tassel phenotype and tassel agronomic character statistics in the field; wherein, a is the phenotype of ZmYAB15 gene editing material (Zmyab15-1 and Zmyab15-2) and control strain (WT) in the field at flowering stage; b is the phenotype of ZmYAB15 gene editing material (Zmyab15-1 and Zmyab15-2) and control strain (WT) in the field at flowering stage; c-e are respectively the statistics and analysis of ZmYAB15 gene editing material (Zmyab15-1 and Zmyab15-2) and control strain (WT) in the field at flowering stage, tassel branch number, spike opening rate and opening angle;

[0030] Figure 5 Wild type corn B104 (control strain WT) and ZmYAB15 gene editing strain in the field at flowering stage, the anatomic structure of spike and the change of parenchyma tissue morphology; wherein, a is the structure diagram of spike of control strain (WT) and ZmYAB15 gene editing material (Zmyab15-1, Zmyab15-2 and Zmyab15-3); b is the change of opening angle, the condition of imbibition and the morphological structure of parenchyma of ZmYAB15 gene editing material and control strain (WT) at green anther to yellow anther stage;

[0031] Figure 6Figure 1. The tassel phenotype, the structure of spikelet and the agronomic traits of tassel of wild type maize B104 (control line WT) and ZmYAB15 gene overexpression lines in Langfang, Hebei province. a, the tassel phenotype of ZmYAB15 gene overexpression materials (ZmYAB15-OE1 and ZmYAB15-OE2) and the control line (WT) in the field at the flowering stage; b, the structure of spikelet and the structure of the glume of ZmYAB15 gene overexpression materials (ZmYAB15-OE1 and ZmYAB15-OE2) and the control line (WT) in the field at the flowering stage; c-e, the number of tassel branches, the spikelet opening rate and the opening angle of ZmYAB15 gene overexpression materials (ZmYAB15-OE1 and ZmYAB15-OE2) and the control line (WT) in the field at the flowering stage. DETAILED DESCRIPTION

[0032] The following detailed description of various example embodiments of the application is not to be taken in a limiting sense, but is understood to be merely a description of certain aspects, features, and embodiments of the application.

[0033] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Additionally, the use of the term "about" in relation to a value or a range of values is understood to include each individual value or range of values falling within the range of the upper and lower limits of the range. Any intermediate value or range of values, whether stated or not, that falls within the range of the upper and lower limits of the range is also included in the application. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned in this specification are herein incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference in this specification is not intended as an admission that the reference is prior art to this application.

[0035] Many modifications and variations of this application can be made in the light of the above teachings without departing from the spirit and scope thereof. Other implementations of this application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only and are not intended to be limiting.

[0036] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", and the like are open-ended terms that are intended to denote the inclusion of elements or steps, but not to exclude any other elements or steps. It is thus possible that the application includes more than one of any element or step.

[0037] Example 1 Response of ZmYAB15 gene to high temperature treatment

[0038] To investigate whether the expression of ZmYAB15 gene is responsive to high temperature stress, two inbred lines of B73 and B104 were used for matrix soil culture, and were placed in a 25°C incubator for seedling. When the corn seedlings grew to the two-leaf-one-heart stage, they were placed in a 42°C incubator for 36h, and then were placed in a 25°C, 12h light incubator for 12h recovery growth. The second leaf of the seedlings with consistent growth was taken at 0h, 3h, 6h, 12h, 24h, 36h of high temperature treatment and 12h of recovery growth for fluorescence quantitative PCR experiment. The results showed that the transcription level of ZmYAB15 gene was affected by different high temperature treatment times, specifically: the expression of ZmYAB15 gene in two inbred lines was significantly down-regulated with time (P<0.05) Figure 1 Therefore, it can be known that ZmYAB15 gene responds to high temperature stress.

[0039] The nucleotide sequence of ZmYAB15 gene is shown in SEQ ID NO: 1, specifically:

[0040]

[0041] The amino acid sequence of the ZmYAB15 protein encoded by the ZmYAB15 gene is shown as SEQ ID NO: 2, in particular as follows:

[0042] MMSSSSSSSSSAACCFPLDHLAPSPTEQLCYVHCNCCDTILAVGVPCSSLFKTVTVRCGHCANLLSVNLRGLLLPPAAPAPPNHLNFAHSLLSPTSPHGLLDELALQQAPSFLMEQASANLSSTMTGRSSNSSCASNLPPPAPMPAAQPVQQEAELPKTAPSVNRPPEKRQRVPSAYNRFIKDEIQRIKAGNPDITHREAFSAAAKNWAHFPHIHFGLMPDQGLKKTFKTHQDGAEDMLLKDDLYAAAAAAAAANMGITPF.

[0043] Example 2 Obtaining of ZmYAB15 gene editing material

[0044] In order to study the function of the ZmYAB15 gene, a CRISPR / Cas9 gene knockout vector of the ZmYAB15 gene was constructed, and genetic transformation of corn plants was carried out (background material B104).

[0045] Construction of CRISPR / Cas9 knockout vector pUbi-Cas9-YAB15-gRNA (pCPB-Ubi::hspCas9 gene editing vector): The first and second exons of the ZmYAB15 (Zm00001eb248640_T001) gene were selected as the target region, and target point 1 and target point 2 were determined according to the nucleotide sequence of the ZmYAB15 gene (SEQ ID NO: 1) using the online tool CRISPR-P2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and then oligonucleotide synthesis was performed. The primers for specifically binding to the target sequence are shown in Table 1.

[0046] Table 1 Primers for specifically binding to the target sequence

[0047]

[0048] Then, the sgRNA (single guide RNA) sequence for the target gene was designed, and the nucleotide sequence of the sgRNA is shown as SEQ ID NO: 7, in particular as follows:

[0049] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.

[0050] Linearized pCBP-Ubi-cas9: 1 h enzyme digestion at 37 °C with Hind III (NEB, R0104V VIAL), and recovery of the 16.8 kb main fragment; rSAP dephosphorylation.

[0051] Equimolar mixture of Targetl-F / R or Target2-F / R, 95 °C for 5 min, then reduced to 25 °C at a rate of 0.1 °C / s to form the annealed gRNA double strand, i.e. Hind III-Target 1-sgRNA-U6a-Target 2-sgRNA-Hind III.

[0052] The nucleotide sequence of Hind III-Target 1-sgRNA-U6a-Target 2-sgRNA-Hind III is shown in SEQ ID NO: 8, specifically:

[0053] ccgcaagcaccgaattGTGGTCCAGCGGGAAGCAGCgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttaagctgctgtttttgttagccccatcgaatccttgacataatgatcccgcttaaataagcaacctcgcttgtatagttccttgtgctctaacacacgatgatgataagtcgtaaaatagtggtgtccaaagaatttccaggcccagttgtaaaagctaaaatgctattcgaatttctactagcagtaagtcgtgtttagaaattatttttttatataccttttttccttctatgtacagtaggacacagtgtcagcgccgcgttgacggagaatatttgcaaaaaagtaaaagagaaagtcatagcggcgtatgtgccaaaaacttcgtcacagagagggccataagaaacatggcccacggcccaatacgaagcaccgcgacgaagcccaaacagcagtccgtaggtggagcaaagcgctgggtaatacgcaaacgttttgtcccaccttgactaatcacaagagtggagcgtaccttataaaccgagccgcaagcaccgaattGAGGTTGACGGAGAGTAGGTgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttaagcttggcactggcc.

[0054] Then, the Hind III-target 1-sgRNA-U6a-target 2-sgRNA-Hind III fragment is subjected to a Golden Gate reaction with linearized pCBP (pCBP is disclosed in the document RNA-guided Cas9 as an in vivo desired-target mutator in maize. Plant Biotechnol J. 2017 Dec, 15(12): 1566-1576. doi.10.1111 / pbi.12739) to construct a successful pCPB-Ubi::hspCas9 gene editing vector. The Golden Gate reaction system and reaction conditions are shown in Table 2. The structure of the pCPB-Ubi::hspCas9 gene editing vector is shown in a of Figure 2

[0055] Table 2 Golden Gate reaction system and reaction conditions

[0056]

[0057] The pCPB-Ubi::hspCas9 gene editing vector is transformed into Agrobacterium EHA105 chemically competent cells to obtain Agrobacterium containing the pCPB-Ubi::hspCas9 gene editing vector. Then, corn embryo transformation is performed:

[0058] The corn young embryo (1.5-2.0 mm) 10-12 days after pollination is pre-cultured for 3 days (the medium used for pre-culture: N6 medium as the basic medium, containing 2 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D)). Then, the following process is performed:

[0059] ​Agrobacterium infection with pCPB-Ubi::hspCas9 gene editing vector for 5 min, co-cultivation for 3 d, transfer to screening medium N6-Bialaphos (N6 medium-based medium containing 5 mg / L Bialaphos) for screening for 4 weeks, differentiation culture (the medium used for differentiation culture: MS medium-based medium containing 2 mg / L BAP), rooting culture (the medium used for rooting culture: 1 / 2 MS medium), identification of positive plants, and obtaining of ZmYAB15 gene editing material (ZmYAB15 gene knockout mutant); then, PCR identification and sanger sequencing of nucleotide sequence to finally obtain Zmyab15 (Zmyab15-1, Zmyab15-2 and Zmyab15-3) gene homozygous mutant. Sequence analysis of the gene editing mutant is shown in b of Figure 2 . The three mutant types of ZmYAB15 gene editing material are shown in c of Figure 2 . The results show that the mutation type of Zmyab15-1 is a frame mutation caused by deletion of 303 bp between the first target site and the second target site; the mutation type of Zmyab15-2 is a frame mutation caused by deletion of 335 bp between the first target site and the second target site; and the mutation type of Zmyab15-3 is a frame mutation caused by deletion of 306 bp between the first target site and the second target site.

[0060] Example 3: Obtaining of ZmYAB15 gene overexpression material

[0061] CDS amplification: corn inbred line B104 was planted in a greenhouse (28°C, 16 h light / 8 h darkness), and three-leaf-stage young leaves were quickly frozen in liquid nitrogen for standby. Total RNA extraction: Trizol (Invitrogen, 15596-018); reverse transcription: PrimeScript II 1stStrand cDNA Synthesis Kit (TaKaRa, 6210A). Using cDNA as a template, PCR was performed using high-fidelity enzyme PrimeSTAR HS (TaKaRa, R010A) to amplify the 786 b of the complete CDS region of ZmYAB15 (SEQ ID NO: 9), as shown below:

[0062] ATGATGTCGTCCTCGTCCTCGTCCTCGTCGTCGGCCGCCTGCTGCTTCCCGCTGGACCACCTCGCGCCGTCCCCCACCGAGCAGCTCTGCTACGTGCACTGCAACTGCTGCGACACCATCCTCGCCGTCGGCGTGCCTTGCAGCAGCCTGTTCAAGACGGTGACGGTGCGTTGTGGCCACTGCGCCAACCTACTCTCCGTCAACCTCCGCGGCCTCCTGCTCCCGCCCGCCGCGCCGGCGCCGCCCAACCATCTCAACTTCGCTCACTCCTTGCTGTCACCCACATCCCCGCATGGCCTCTTGGACGAGTTGGCTCTCCAGCAGGCGCCGAGCTTCCTGATGGAGCAGGCGAGTGCCAACCTGAGCAGCACCATGACGGGCCGCAGCAGCAACAGCAGCTGCGCCAGCAACCTGCCGCCGCCGGCGCCGATGCCTGCAGCTCAGCCTGTGCAGCAGGAAGCCGAACTGCCCAAGACCGCCCCGTCGGTAAACAGGCCTCCGGAGAAGCGGCAGAGAGTCCCGTCGGCATACAACCGGTTCATCAAGGACGAGATCCAGCGCATCAAGGCCGGCAACCCGGACATCACCCACCGGGAGGCGTTCAGCGCAGCCGCAAAGAATTGGGCCCATTTCCCACACATCCACTTCGGCCTCATGCCGGACCAGGGCCTCAAGAAGACCTTCAAGACTCATCAGGATGGCGCTGAAGACATGCTACTCAAAGACGATCTCTACGCCGCAGCGGCTGCAGCTGCAGCAGCCAACATGGGCATCACTCCATTCTAA.

[0063] The nucleotide sequences of the primers used for amplification are as follows:

[0064] ZmYAB15-F: 5'-TAGACGCGTGGATCCATGATGTCGTCCTCGTCCTCG-3', SEQ ID NO: 10; ZmYAB15-R: 5'-TTTGTAGTCTTCGAAGAATGGAGTGATGCCCATGTTGG-3', SEQ ID NO: 11.

[0065] Vector construction: The amplified product was digested with BamHI / BstBI, and then inserted into the corresponding site of plant overexpression vector pCAMBIA3301 (the vector was disclosed in the literature "Modification of vectors for functional genomic analysis in plants. Genet Mol Res. 2014 Sep 26;13(3):7815-25. doi: 10.4238 / 2014.September.26.20.), to obtain the recombinant plasmid pCAMBIA3301-Ubi-ZmYAB15 (Fig. 1). Figure 3 Vector elements: maize ubiquitin promoter (ZmUbi1), ZmYAB15 CDS, NOS terminator, bar grass ampicillin resistance gene (used for transformation screening).

[0066] Agrobacterium-mediated maize genetic transformation: the correctly sequenced pCAMBIA3301-Ubi-ZmYAB15 was transformed into Agrobacterium EHA105 by freeze-thaw method, cultured at 28°C in YEB (50 mg / L kanamycin + 25 mg / L rifampicin) to OD 600 =0.6, centrifuged at 4°C and 5000g for 10 min, and resuspended in the infection solution (MS medium containing 100 μM AS, pH 5.2). The recipient material: 10-12 d pollinated maize B73 immature embryos (1.5-2.0 mm) were sterilized with sodium hypochlorite and pre-cultured in N6-AS co-culture medium (the medium was based on N6 medium, also containing 2 mg / L 2,4-D and 100 μM AS) for 3 d. Transformation and screening: the immature embryos were immersed in the Agrobacterium suspension for 5 min, and co-cultured for 3 d (25°C, dark); screening: transferred into N6- double propylamine phosphine medium (the medium was based on N6 medium, also containing 2 mg / L 2,4-D, 5 mg / L grass ampicillin and 250 mg / L cephalothin), subcultured every 2 weeks until the resistant callus grew; differentiation: the resistant callus was transferred into MS-BAP differentiation medium (the medium was based on MS medium, also containing 2 mg / L 6-benzyladenine (6-BA) and 0.5 mg / L furan methyl amino purine (KT)), and cultured under light (16 h light / 8 h dark, 25°C).

[0067] Positive plant identification: Leaf of T0 generation regenerative seedling was taken, genomic DNA was extracted by CTAB method, and PCR detection was performed using primer ubi-F (TAGCCCTGCCTTCATACG, SEQ ID NO: 12) and primer (nos-R: CAAGACCGGCAACAGGAT, SEQ ID NO: 13), and a 1050 bp band appeared in electrophoresis to determine positive Figure 3 RT-qPCR: T0 generation was selfed for two generations to obtain T2 generation ZmYAB15 gene overexpression material, RT-qPCR was performed on T2 generation ZmYAB15 gene overexpression material and wild type plants (B73), and the expression of ZmYAB15 in each plant was detected, and the results showed that the expression of ZmYAB15 in T2 generation ZmYAB15 gene overexpression material was increased by 25-55 times compared with wild type (b in Figure 3 c); it is shown that stable overexpression homozygous lines have been obtained, which are named as ZmYAB15-OE1, ZmYAB15-OE2, ZmYAB15-OE3.

[0068] Example 4: Tassel phenotype and tassel agronomic traits of wild type B104 inbred line corn material (control line WT) and ZmYAB15 gene edited line in Langfang, Hebei field

[0069] In order to verify whether ZmYAB15 gene is related to high temperature, the identified homozygous gene edited material (Zmyab15-1 and Zmyab15-2) and the corresponding control material (wild type B104 inbred line corn material) were planted in Langfang, Hebei field (the highest temperature in summer reached 42°C, which was the flowering period), and the phenotype was observed, and the results are shown in Figure 4 a. The results show that the tassel phenotype of ZmYAB15 edited material is abnormal under high temperature. Subsequently, the tassel branch (main branch) (b in Figure 4 ) and the structure of spikelet were further observed by using a stereomicroscope. It was found that the opening of spikelet of ZmYAB15 edited material was hindered, which was consistent with the phenotype of heat-tolerant corn varieties under high temperature during flowering period; then the tassel branch number, spikelet opening rate and opening angle were counted in the field, and it was found that the ZmYAB15 edited material had no significant difference in tassel branch number compared with wild type material, and the spikelet opening rate and opening angle were significantly reduced. These results show that the ZmYAB15 gene edited under high temperature affects the opening of corn spikelet (c-e in Figure 4 ).

[0070] Example 5: Anatomical structure of spikelet and changes in parenchyma tissue morphology of wild type B104 inbred line corn material (control line WT) and ZmYAB15 gene edited line during flowering period in the field

[0071] In order to further study the key structure of ZmYAB15 gene regulating the opening of maize tassel glume, the identified homozygous gene editing materials (Zmyab15-1, Zmyab15-2 and Zmyab15-3) and the corresponding control material WT (wild type B104 inbred line maize material) were planted in the field of Langfang, Hebei. The spikelets of ZmYAB15 editing materials and control materials were dissected, and each structure was displayed, observed under a stereomicroscope and images were collected. The maize tassel is a conical inflorescence, attached to the top of the stem, composed of a spike handle, a main shaft, branches and spikelets. Figure 5 The structure diagram of the spikelet after dissection of the wild type and ZmYAB15 gene editing lines in a is shown. Each spikelet is composed of two glumes (inner glume: IG, outer glume: OG) and two flowers; each flower is composed of a palea (Pa), a lemma (Le), a stamen (filament and anther: An) and a lodicule (Lo); the palea and lemma are both membranous. Figure 5 The b in FIG. 6B is the spikelet opening and the morphological structure change of the lodicule of the control material WT and the ZmYAB15 gene editing materials (Zmyab15-1, Zmyab15-2 and Zmyab15-3) from the green anther period to the yellow anther period. The stereomicroscope observation results show that the control material lodicule has normal imbibition process, while the mutant materials all show weakened imbibition ability, leading to blocked glume opening; the control material lodicule structure is full and juicy, like a small scale, while the ZmYAB15 gene editing material lodicule structure is flat and scaly. This can indicate that the ZmYAB15 gene regulates the development of the lodicule tissue in the maize spikelet, and then affects its imbibition function; the lodicule is the key structure of glume opening, and the ZmYAB15 editing material will reduce the opening rate and opening angle of the maize spikelet.

[0072] Example 6 Wild type B104 inbred line maize material (control line WT) and ZmYAB15 gene overexpression line in Hebei Langfang field tassel phenotype, spikelet dissection structure morphology and tassel agronomic traits statistics

[0073] To further study the regulation of ZmYAB15 gene on the opening of the glume, the inventors planted the identified homozygous overexpression ZmYAB15 gene material (ZmYAB15-OE1, ZmYAB15-OE2) and the corresponding control material WT (wild type B104 selfing line corn material) in Langfang, Hebei (the highest temperature reached 42°C in summer, which was the flowering period), observed the phenotype, and the tassel phenotype results are shown in Figure 6a. The results showed that the tassel phenotype of the ZmYAB15 gene overexpression material appeared difference under high temperature. Then the structure of the spikelet was further observed by using a stereomicroscope; the results showed that there was no significant difference in the morphology and structure of the spikelet and the glume between the ZmYAB15 overexpression material and the control material (WT). Then the number of tassel branches, the spikelet opening rate and the opening angle of the glume were counted in the field, and the results showed that the number of tassel branches, the spikelet opening rate and the opening angle of the glume of the ZmYAB15 gene overexpression material were significantly increased compared with the control material (WT) (c-e in Figure 6). Figure 6 These results showed that overexpression of ZmYAB15 gene could increase the opening rate of corn spikelet, promote the development of corn spikelet glume tissue, increase the opening angle of corn spikelet glume and the number of tassel branches, and achieve the purpose of improving the high temperature tolerance of corn.

[0074] The above-described embodiments are only to describe the preferred modes of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.

Claims

1. The use of ZmYAB15 protein, ZmYAB15 gene, or biological material containing ZmYAB15 gene in any of the following: (1) Regulating the high-temperature tolerance of corn; (2) Cultivating heat-resistant corn; The amino acid sequence of the ZmYAB15 protein is shown in SEQ ID NO: 2; the nucleotide sequence of the ZmYAB15 gene is shown in SEQ ID NO:

1. The application involves increasing the expression level of the ZmYAB15 protein or the expression amount of the ZmYAB15 gene in maize to improve the heat resistance of maize or to cultivate heat-resistant maize.

2. The use of ZmYAB15 protein, ZmYAB15 gene, or biological material containing ZmYAB15 gene in any of the following: (1) Regulating the opening rate of maize spikelets under high temperature conditions; (2) Regulating the development of maize spikelet sclerotium tissue under high temperature conditions; (3) Adjusting the opening angle of maize spikelets under high temperature conditions; (4) Regulating the number of male branches in maize under high temperature conditions; The amino acid sequence of the ZmYAB15 protein is shown in SEQ ID NO: 2; the nucleotide sequence of the ZmYAB15 gene is shown in SEQ ID NO:

1. The application involves increasing the expression level of the ZmYAB15 protein or the expression amount of the ZmYAB15 gene in maize to improve the opening rate of maize spikelets, promote the development of maize spikelet sap tissue, increase the opening angle of maize spikelets, and increase the number of male branches.

3. The application according to claim 1 or 2, characterized in that, The biomaterials include recombinant expression vectors or recombinant bacteria.

4. The application of ZmYAB15 protein or ZmYAB15 gene in regulating the heat tolerance of maize, characterized in that... The amino acid sequence of the ZmYAB15 protein is shown in SEQ ID NO: 2; the nucleotide sequence of the ZmYAB15 gene is shown in SEQ ID NO: 1; the application is to reduce the heat resistance of corn by knocking out the ZmYAB15 gene in corn.

5. The application of ZmYAB15 protein or ZmYAB15 gene in any of the following: (1) Regulating the opening rate of maize spikelets under high temperature conditions; (2) Regulating the development of maize spikelet sclerotium tissue under high temperature conditions; (3) Adjusting the opening angle of maize spikelets under high temperature conditions; The amino acid sequence of the ZmYAB15 protein is shown in SEQ ID NO: 2; the nucleotide sequence of the ZmYAB15 gene is shown in SEQ ID NO:

1. The application involves knocking out the ZmYAB15 gene in maize to reduce the opening rate of maize spikelets, inhibit the development of maize spikelet sap tissue, and reduce the opening angle of maize spikelets.

6. A method for improving the high-temperature resistance of corn, characterized in that, The method includes the step of overexpressing the ZmYAB15 gene in maize; the nucleotide sequence of the ZmYAB15 gene is shown in SEQ ID NO:

1.

7. A method for increasing the ear opening rate of maize under high temperature conditions, characterized in that, The method includes the step of overexpressing the ZmYAB15 gene in maize; the nucleotide sequence of the ZmYAB15 gene is shown in SEQ ID NO:

1.

8. A method for promoting the development of maize spikelet sclerotium tissue under high temperature conditions, characterized in that, The method includes the step of overexpressing the ZmYAB15 gene in maize; the nucleotide sequence of the ZmYAB15 gene is shown in SEQ ID NO:

1.

9. A method for increasing the glenching angle of maize spikelets under high temperature conditions, characterized in that, The method includes the step of overexpressing the ZmYAB15 gene in maize; the nucleotide sequence of the ZmYAB15 gene is shown in SEQ ID NO:

1.

10. A method for increasing the number of branches on a maize tassel under high-temperature conditions, characterized in that, The method includes a step of overexpressing the ZmYAB15 gene in maize; the nucleotide sequence of the ZmYAB15 gene is shown in SEQ ID NO:

1.

11. A method for cultivating heat-resistant maize, characterized in that, The method includes the step of overexpressing the ZmYAB15 gene in maize; the nucleotide sequence of the ZmYAB15 gene is shown in SEQ ID NO: 1.

Images