Application of strigolactone GR24 or its induced protein CsJIP-like in improving cold resistance of tea tree
By spraying with strigolactone GR24 and using CsJIP-like gene technology, we can activate cold-resistance-related pathways in tea trees, reduce the content of harmful substances in tea trees, and increase enzyme activity. This solves the problems of high workload and low efficiency in improving the cold resistance of tea trees, and provides an efficient and environmentally friendly solution for cold resistance in tea trees.
Patent Information
- Application Number
- CN202511178423.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-22
- Publication Date
- 2026-01-09
- Estimated Expiration
- 2045-08-22
AI Technical Summary
Existing technologies for improving the cold resistance of tea trees are characterized by large workload, complex procedures, and low efficiency. Traditional chemical cold-resistant agents may cause environmental pollution, and the long breeding cycle makes it difficult to quickly meet production needs.
By using exogenous application of strigolactone GR24 and CsJIP-like gene overexpression or silencing technology, the contents of REL, MDA, H2O2 and O2·- in tea plants were reduced, while the activities of SOD, POD, CAT and APX enzymes were increased. GR24 was used to activate cold resistance-related pathways and CsJIP-like genes that respond to low temperature were screened as molecular markers.
It significantly improves the cold resistance of tea trees, reduces application costs, avoids the risk of chemical cold-resistant agent residues, provides novel molecular markers and genetic resources, and rapidly enhances the cold resistance of tea trees.
Smart Images

Figure CN120718947B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of plant stress resistance regulation technology and plant genetic engineering, specifically to the application of strigolactone GR24 or its induced protein CsJIP-like in improving the cold resistance of tea trees. Background Technology
[0002] tea tree( Camellia sinensis (L.) O. Kuntze is an important economic crop in my country. Low temperature is one of the main abiotic stresses affecting the yield and distribution of tea trees. Low temperature can cause tea trees to suffer frost damage, which manifests as damage to leaves, branches and even roots, affecting physiological and metabolic processes such as photosynthesis and respiration, leading to reduced enzyme activity and increased reactive oxygen species levels. In severe cases, it can cause the death of tea trees, becoming a key environmental factor restricting the development of the tea industry.
[0003] Currently, various technologies have been applied to cold-resistant tea trees. Agricultural measures include rational fertilization and increasing phosphorus and potassium fertilizers to enhance the cold resistance of tea trees; timely pruning to remove frozen branches and promote new shoot growth; and mulching for insulation, such as using straw or plastic film to cover the roots or surface of the tea trees to reduce damage to the root system from low temperatures. Physical protection methods include building windbreaks and using smoke for frost prevention to improve the microclimate of the tea garden and mitigate the damage from low temperatures. In terms of biotechnology, efforts have been made to breed cold-resistant tea varieties, cultivating varieties with strong cold resistance through hybridization and other means. While agricultural measures and physical protection methods are effective, they require significant manpower, material resources, and financial investment. For example, mulching for insulation requires timely installation and removal of coverings, resulting in a large workload; smoke for frost prevention may cause environmental pollution and is difficult to implement in large-scale tea gardens. Regarding variety selection, traditional hybridization breeding is time-consuming and inefficient, making it difficult to quickly meet the production demand for cold-resistant varieties. Summary of the Invention
[0004] To address the shortcomings of the existing technology, this invention aims to provide an application of strigolactone GR24 or its inducible protein CsJIP-like in improving the cold resistance of tea trees. On the one hand, exogenous spraying of GR24 can solve the problems of high workload and complex procedures in tea tree cold resistance; on the other hand... CsJIP-like Genes can serve as novel molecular markers for cold-resistant breeding of tea trees, and their cold resistance can also be improved through gene overexpression technology.
[0005] The technical solution of this invention is as follows:
[0006] The application of strigolactone GR24 or its inducible protein CsJIP-like in improving the cold resistance of tea trees, wherein its structural formula is shown in Formula I, and the amino acid sequence of the inducible protein CsJIP-like is shown in SEQ ID No. 2.
[0007] Further, the strigolactone GR24 reduces the content of REL, MDA, H2O2 and O2 ·- , and improves the activity of SOD, POD, CAT and APX enzymes.
[0008] A method for improving the cold resistance of tea plants, which comprises spraying a strigolactone GR24 solution or increasing the expression of the induced protein CsJIP-like on the tea plants.
[0009] Further, the spraying time is before the low temperature stress at 4 DEG C, and the concentration of the strigolactone GR24 solution is 0.05-1.5 μmol·L -1 .
[0010] Further, the concentration of the strigolactone GR24 solution is 0.5 μmol·L -1 .
[0011] The application of the CsJIP-like gene in improving the cold resistance of tea plants, wherein the nucleotide sequence of the CsJIP-like gene is shown in SEQ ID No. 1.
[0012] A vector for improving the cold resistance of tea plants, which comprises the CsJIP-like gene.
[0013] An engineering bacterium for improving the cold resistance of tea plants, which comprises the vector.
[0014] The application of the induced protein CsJIP-like or the CsJIP-like gene or the vector or the engineering bacterium in preparing a reagent for improving the cold resistance of tea plants.
[0015] Compared with the prior art, the application has the beneficial effects that:
[0016] The strigolactone analogue GR24 is artificially synthesized and has higher chemical stability, and can play a role for a long time under field conditions. As a derivative of a plant source signal molecule, it can significantly activate the cold resistance related pathway at a very low concentration (micromolar level), reduce the application cost, and avoid the residual risk of traditional chemical cold resistance agents (such as ethephon).
[0017] Meanwhile, the application screens and clones a CsJIP-like gene which responds to low temperature and GR24 signal at the same time, and verifies that the gene directly participates in the cold resistance process of tea plants, which provides a new idea for the cold resistance mechanism of tea plants and provides a new gene resource for the molecular design breeding of tea plants. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1The effects of different concentrations of exogenous styrax lactone GR24 on the physiological indicators of tea trees under low temperature stress were investigated. Among them, A represents the effect of relative conductivity (REL); B represents the effect of malondialdehyde (MDA) content; and C represents the effect of proline (PRO) content.
[0019] Figure 2 The effects of exogenous application of styrax lactone GR24 and melatonin MT on physiological indicators of tea trees under low temperature stress were investigated. A represents the effect of relative conductivity (REL); B represents the effect of malondialdehyde (MDA) content; C represents the effect of hydrogen peroxide (H2O2) content; and D represents the effect of superoxide anion (O2). .- E represents the effect of superoxide dismutase (SOD) activity; F represents the effect of peroxidase (POD) activity; G represents the effect of catalase (CAT) activity; and H represents the effect of ascorbic acid peroxidase (APX) activity.
[0020] Figure 3 for CsJIP-like Gene expression patterns and tissue-specificity analysis under different spraying treatments.
[0021] Figure 4 Transient overexpression of tea leaves CsJIP-like Analysis of cold resistance afterward.
[0022] Figure 5 The tea leaves fell silent for a moment CsJIP-like Analysis of cold resistance afterward. Detailed Implementation
[0023] The present invention will be further described in detail below with reference to specific embodiments.
[0024] It should be noted that these embodiments are only used to illustrate the present invention and are not intended to limit the present invention. Simple improvements to the method under the premise of the present invention are all within the scope of protection claimed by the present invention.
[0025] The tea variety used in the following examples is Shuchazao, and the seedlings are plug trays approximately 20 cm tall, purchased from Anhui Niansheng Agricultural Co., Ltd. The hormone and indicator detection kits used in the examples are: strigolactone GR24 (CAS No. 76974-79-3, Beijing Solarbio Technology Co., Ltd., molecular formula C...). 17 H 14 O5 (molecular weight 298.29 g / mol, structural formula as shown in Formula I); melatonin MT (CAS No. 73-31-4, Sangon Biotech Shanghai Co., Ltd.); MDA and PRO content assay kits (Suzhou Greens Biotechnology Co., Ltd.); SOD, POD, CAT and APX enzyme activity assay kits and H2O2 and O2 assay kits. ·-Elisa Kit (Solarbio, Beijing, China).
[0026]
[0027] Formula I
[0028] The pSESY-Blunt vector used in the following examples is a general cloning vector, which can be purchased; the pBTEX-HA overexpression vector is a vector preserved by the research group; the Escherichia coli strain DH-5α and the Agrobacterium GV3101 (pSoup-p19) strain are commonly used strains, which can be purchased.
[0029] The enzymes and molecular biology kits used in the following examples are: TB Green Premix Ex Taq II quantitative enzyme (Tli RNaseH Plus) (Takara, Beijing, China), 5* PrimeScript™ RT Master Mix reverse transcriptase (Takara, Beijing, China), 2*PHanta® Max Master Mix (Dye Plus) high-fidelity enzyme (Vazyme, Nanjing, China), QuickCut KpnI enzyme cutting enzyme and QuickCut StuI enzyme cutting enzyme (Takara, Beijing, China); SteafyPure Plant RNA Extraction Kit plant RNA extraction kit (Accurate Biology, Changsha, China), FastPureGel DNA Extraction Mini Kit product purification kit (Vazyme, Nanjing, China), FastPure Plasmid Mini Kit plasmid extraction kit (Vazyme, Nanjing, China).
[0030] Example 1
[0031] The optimal spraying concentration screening test of strigolactone GR24 includes the following steps:
[0032] Prepare 5 concentrations of GR24 solution, which are 0.05, 0.1, 0.5, 1.0, 1.5 μmol·L -1 The test sets 22℃ control group and 4℃ low temperature test group, 20 tea seedlings with good growth and consistent growth state are selected for each treatment. The control group is sprayed with distilled water, and the test group is sprayed with equal amount of distilled water and 5 concentrations of GR24 solution. The range is the whole tea seedling, and the spraying is stopped until the leaf edge drops the solution. After the spraying is finished, the tea seedlings are moved into 22℃ and 4℃ incubators respectively, and the relative electrical conductivity (REL), malondialdehyde (MDA) and proline (PRO) are detected after 2 days of treatment. The test detection sets 3 biological replicates and 6~9 technical replicates.
[0033] From Figure 1 It can be seen that, compared with 4℃, the REL and MDA contents of tea seedlings sprayed with GR24 are reduced, and the PRO content is increased, indicating that spraying GR24 before low temperature stress can improve the cold resistance of tea trees. And 0.5 μmol·L -1 The three indicators of the treatment group are better, while the effects of the three indicators after treatment with other concentrations of GR24 are unstable. Therefore, 0.5 μmol·L -1 is selected as the best spraying concentration for tea tree cold resistance.
[0034] Example 2
[0035] The test of comparing the cold resistance of tea trees after spraying GR24 and MT includes the following steps:
[0036] The tea varieties, spraying degree and treatment conditions used in this test are the same as in Example 1. The test is set up with a 22℃ control group and a 4℃ test group. The control group is sprayed with distilled water, and the test group is sprayed with equal amounts of distilled water, 0.5 μmol·L -1 GR24, 100 μmol·L -1 MT. After treatment, the relative electrical conductivity (REL), malondialdehyde (MDA), hydrogen peroxide (H2O2) and superoxide anion (O2 ·- ) content, superoxide dismutase (SOD) and peroxidase (POD), catalase (CAT), ascorbate peroxidase (APX) activity are detected. The test is also set up with 3 biological repeats and 6-9 technical repeats.
[0037] Figure 2 It is shown that, compared with the 4℃ treatment group, the REL, MDA, H2O2 and O2 ·- contents of tea trees sprayed with GR24 and MT are significantly reduced, while the SOD, POD, CAT, APX enzyme activities are significantly improved. The REL, MDA, H2O2 and O2 ·- contents of tea trees in the GR24 group are significantly lower than those in the MT group, and the SOD, POD, CAT, APX enzyme activities are significantly higher than those in the MT group, indicating that the cold resistance effect of GR24 is better than that of MT. The above results show that foliar spraying of GR24 can improve the enzyme activities of SOD, POD and CAT, APX in tea trees, reduce oxidative stress in tea trees, and protect the integrity of cell membranes; at the same time, it can reduce the REL, MDA and H2O2, O2 ·- contents in tea trees, maintain cell osmotic balance, and improve the cold resistance level of tea trees, and the cold resistance effect is more significant than that of MT.
[0038] Example 3
[0039] A novel cold-resistance gene responding to GR24 was cloned from tea plants. CsJIP-like ( Jasmonate-Induced Protein-like CsJIP-like The cold-resistance function of the gene was verified through transient overexpression and antisense oligonucleotide assays, including the following steps:
[0040] 1. CsJIP-like Bioinformatics analysis
[0041] First, download from the TPIA website. CsJIP-like The protein sequence of the gene (SEQ ID No. 2, as shown in Table 1) was obtained and imported into the Expasy website (https: / / web.expasy.org / protparam / ) to calculate various physical and chemical parameters of the gene. The protein is a hydrophilic protein with a CDS sequence of 525 bp, 174 amino acids, a molecular weight of 19001.79 da, and an isoelectric point of 5.08 pi.
[0042] Table 1 Sequence List
[0043] Sequence SEQ ID No. 1 ATGAATACTGTACCCGAAGCTCAGAATAAGGAAGAGTGTGACCCTGATGTCAGCACGCTTGTAAAGATTCACAATGAAACTGGGGCCACTATAACATATTTTACCAAACATGATTTTTCTGGGAAATTAGATAAACAGAGCACATATCCAGCCAAAATAGAAAATGGCGAGTCCGATGTGTTTGAACATAAGGGAACTAGTGGAGAGAATACTGGATCGTGTGGAGCTGTTGTGTATTCGGTCAAAAACAAGGATGGGAAAGCCGGTCATTGGATGCTGTCTTGGTCCAACCCAACCAATGAGGACAATAAGGTCTTTACTGAGATTATTGGACCGGGTCACTATAAGCCAAACTCCAACGACCCTATTTGGGATCGTGTCCATGAAGAGTTGAGCAAGTCTGGCACCACCAGTGCATCTGAATGGAATGGTTGCGAGTCATCTATGACATCTATTCCTAGTAATGATATGAAAAACCGCGTAGATGTGGATGCAACAGTGACACTAGCCACAGCCAAGGCCTAA SEQ ID No. 2 MNTVPEAQNKEECDPDVSTLVKIHNETGATITYFTKHDFSGKLDKQSTYPAKIENGESDVFEHKGTSGENTGSCGAVVYSVKNKDGKAGHWMLSWSNPTNEDNKVFTEIIGPGHYKPNSNDPIWDRVHEELSKSGTTSASEWNGCESSMTSIPSNDMKNRVDVDATVTLATAKA SEQ ID No. 3 CsJIP-like-qRT-F GGTCATTGGATGCTGTCTTGG SEQ ID No. 4 CsJIP-like-qRT-R GGGTCGTTGGAGTTTGGCTTA SEQ ID No. 5 CsJIP-like-ORF-F GGTCATTGGATGCTGTCTTGG ATGAATACTGTACCCGAAGCTC SEQ ID No. 6 CsJIP-like-ORF-R TTAGGCCTTGGCTGTGGCTAG SEQ ID No. 7 CsJIP-like-pBTEX-F ATTTGGAGAGGACAGGGTACCATGAATACTGTACCCGAAGCTC SEQ ID No. 8 CsJIP-like-pBTEX-R AACGTCGTATGGGTAAGGCCTGGCCTTGGCTGTGGCTAG SEQ ID No. 9 CsJIP-like-AS-1 TTTACAAGCGTGCTGACATC SEQ ID No. 10 CsJIP-like-AS-2 CTTTACAAGCGTGCTGACAT SEQ ID No. 11 CsJIP-like-AS-3 TATGTTATAGTGGCCCCAGT SEQ ID No. 12 CsJIP-like-S GGCGGCTAACGCTTCGA
[0044] 2. CsJIP-like Expression pattern analysis and tissue-specific analysis
[0045] Samples from different expression groups and tissues were ground into powder using liquid nitrogen in a mortar. Total RNA was then extracted from tea plants using the SteafyPurePlant RNA Extraction Kit. Purity and concentration were subsequently determined. The qualified RNA was reverse transcribed using 5* PrimeScript™ RT Master Mix reverse transcriptase to obtain cDNA. cDNA was downloaded from the TPIA website (https: / / tpia.teaplants.cn / index.html). CsJIP-like The nucleotide sequence (SEQ ID No. 1) was obtained, and qRT-PCR primers (SEQ ID No. 3 & SEQ ID No. 4) were designed using snapgene software. Then, qRT-PCR detection was performed using cDNA as a template.
[0046] Figure 3 According to the diagram in section A, after low-temperature treatment CsJIP-like The relative expression level of the gene increased by 1.45 times, indicating that... CsJIP-like The gene showed a positive response to low temperature, and its expression level increased significantly in the GR24 and MT treatment groups, indicating that... CsJIP-like It responds positively to GR24 and MT, and the expression level is higher in response to GR24. Figure 3 The B-shaped display shows that CsJIP-likeThe gene is highly expressed in mature leaves such as three-leaf, four-leaf, and five-leaf leaves, and the expression level is about 10 to 20 times higher than that in tissues such as buds and young leaves.
[0047] 3. Transient overexpression of tea leaves CsJIP-like Improve the cold resistance of tea trees
[0048] After designing the ORF-PCR primers (SEQ ID No. 5 & SEQ ID No. 6) using snapgene software, proceed according to the instructions for using 2*PHanta® Max Master Mix (Dye Plus). CsJIP-like Gene PCR amplification. After amplification, agarose gel electrophoresis was performed. The correct bands were excised from the gel, the products were recovered, and ligated into the pSESY-Blunt vector. Positive colonies were initially screened using kanamycin (Kan) medium. Single colonies were selected, streaked, and cultured for amplification and colony PCR verification. Positive colonies with correct bands were selected for sequencing. Plasmids were extracted from single strains with correct sequencing results using the FastPure® Plasmid Mini Kit and stored at -20°C.
[0049] Homologous arm primers were designed (see SEQ ID No. 7 and SEQ ID No. 8), and transient transformation was constructed using homologous recombination. CsJIP-like -pBTEX vector (restriction site is) KpnI and StuI The bacteria were then transformed into Agrobacterium GV3101 (pSoup-p19) for propagation and colony PCR verification, and stored in an ultra-low temperature freezer at -80°C.
[0050] Tea seedlings with uniform growth were selected for transgenic experiments. The infection solution was injected into the 4th-5th leaves of the tea plants using a syringe, and then the plants were incubated at 22℃ for 2 days. After 2 days, positive plants were placed in a 0℃ incubator for 12 hours, and samples were taken for testing. CsJIP- like Relative gene expression levels, MDA, H2O2, and O2 ·- Content. Each treatment group had 3 biological replicates and 6–9 technical replicates.
[0051] Figure 4 The results showed that after 2 days of bacterial infection, the tea plants... CsJIP-like The expression levels were significantly increased. Compared with the 0℃ CK treatment group, the REL, MDA content, H2O2 content, and O2 content of tea plants in the 0℃ OE treatment group were significantly higher. ·- The levels of all samples decreased significantly, indicating overexpression. CsJIP-like Genes enable tea plants to improve their cold resistance by reducing ROS and mitigating cell membrane damage.
[0052] 4. The tea leaves are silent. CsJIP-like Improve the cold resistance of tea trees
[0053] Designed using the Sfold website (https: / / sfold.wadsworth.org / cgi-bin / index.pl) CsJIP- like Antisense oligodeoxynucleotides (asODNs) of the gene were used, and asODNs were BLASTed on the TPIA website to screen for asODNs with high specificity and no special structural regions as transient silencing primers. Sense oligodeoxynucleotides (sODNs) were obtained using universal primers, and the specific primers can be found in SEQ ID No. 9 ~ SEQ ID No. 12.
[0054] Tea seedlings with uniform growth were selected for the experiment. Three antisense oligonucleotide primers were first diluted to 10 μM, then mixed in a 1:1:1 ratio. The primers were then injected into the 4th and 5th leaves of the tea plants, and the plants were incubated at 22℃ for 24 h. After 24 h, positive plants were placed in a 0℃ incubator for 12 h, and samples were taken for analysis. CsJIP- like Relative gene expression levels, MDA, H2O2, and O2 ·- Content. Each treatment group had 3 biological replicates and 6–9 technical replicates.
[0055] Figure 5 The display showed that after 24 hours of silence... CsJIP-like The expression level was significantly reduced. Compared with 0℃ sODN, the MDA content, H2O2 content, and O2 content of the 0℃ asODN treatment group were significantly reduced. ·- The levels all increased significantly, indicating that silence... CsJIP-like Tea plants accumulate more ROS and experience increased cell membrane damage, which conversely indicates... CsJIP-like Genes can improve the cold resistance of tea plants.
[0056] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described with reference to preferred embodiments, those skilled in the art should understand that various changes in form and detail can be made without departing from the spirit and scope of the invention as defined in the appended claims.
Claims
1. A method of increasing cold tolerance in a tea plant, the method comprising, The CsJIP-like gene has a nucleotide sequence as shown in SEQ ID No.
1.
2. The method of claim 1, wherein, The CsJIP-like gene has a nucleotide sequence as shown in SEQ ID No.
1.
3. Application of CsJIP-like gene in improving cold resistance of tea plant, characterized in that, The CsJIP-like gene has a nucleotide sequence as shown in SEQ ID No.
1.
4. Use of the CsJIP-like gene or the vector or the engineering bacteria containing the CsJIP-like gene in preparation of a reagent for improving cold resistance of tea plant, characterized in that, The CsJIP-like gene has a nucleotide sequence as shown in SEQ ID No.
1. The CsJIP-like gene has a nucleotide sequence as shown in SEQ ID No. 1.