Bacillus amyloliquefaciens and its applications

Abstract

This invention relates to the field of microbiology, and particularly to *Bacillus amyloliquefaciens* and its applications. This invention provides a strain of *Bacillus amyloliquefaciens* and its application in the production of strong-aroma baijiu (Chinese liquor). Liquid culture of this strain achieved a utilization rate of 0.49–1.1 g / L of isoamyl alcohol after 48 hours, overcoming the limitations of simply screening low-yield yeasts or controlling processes to reduce isoamyl alcohol content. Furthermore, this strain can be applied to baijiu brewing, significantly reducing the isoamyl alcohol content in baijiu by approximately 20%, with stable results.

Description

Technical Field

[0001] This invention relates to the field of microbiology, and particularly to Bacillus amyloliquefaciens and its applications. Background Technology

[0002] As a popular beverage, alcoholic beverages are increasingly in demand, with people demanding higher quantities and quality. Isoamyl alcohol is one of the main higher alcohols in baijiu (Chinese white liquor). Appropriate amounts of isoamyl alcohol can enrich the body of the liquor and, under the action of acetyltransferase, can form isoamyl acetate with acetic acid, imparting a delicate aroma. However, excessive isoamyl alcohol content in baijiu will result in a bitter taste.

[0003] Furthermore, isoamyl alcohol takes longer to oxidize in the human body than ethanol, thus remaining in the body for a longer period and increasing the risk of "headache" and "intoxication" after drinking baijiu. Appropriately reducing and controlling the synthesis of isoamyl alcohol during baijiu fermentation can help reduce discomfort for consumers and improve the drinking experience.

[0004] Currently, isoamyl alcohol production is mainly reduced through methods such as screening low-yield yeast strains, genetic modification, and process optimization. However, research on strains that utilize isoamyl alcohol to reduce its content is relatively limited.

[0005] The technical solutions and disadvantages of existing technologies:

[0006] Table 1. Existing technologies for reducing isoamyl alcohol / higher alcohol levels and existing problems

[0007]

[0008] Disadvantage 1: Existing literature only studies and screens strains that produce low levels of higher alcohols to reduce the levels of higher alcohols in baijiu, but this cannot avoid the production of isoamyl alcohol, so the effect is not ideal.

[0009] Disadvantage 2: Current literature focuses on controlling the yield of "higher alcohols" through fermentation processes and raw materials, but the results are not ideal based on the literature reviewed.

[0010] Disadvantage 3: While ultrasound can reduce higher alcohols in wine to some extent, it significantly increases production costs, making the effect less than ideal.

[0011] Therefore, providing a strain of Bacillus amyloliquefaciens capable of utilizing isoamyl alcohol and its application is of significant practical importance. Summary of the Invention

[0012] In view of this, the present invention aims to control the excessively high content of isoamyl alcohol in the production process of baijiu by screening microorganisms that can use isoamyl alcohol as the sole carbon source.

[0013] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0014] In a first aspect, the present invention provides Bacillus amyloliquefaciens FB-1, which has the accession number CCTCC NO: M20242158.

[0015] In some specific embodiments of the present invention, the Bacillus amyloliquefaciens FB-1 uses isoamyl alcohol as a carbon source.

[0016] Secondly, the present invention also provides a method for the large-scale culture of Bacillus amyloliquefaciens FB-1, comprising the following steps:

[0017] Step 1: Strain activation: The Bacillus amyloliquefaciens FB-1 strain was used as the strain for activation;

[0018] Step 2: Preparation of primary seed culture: The activated Bacillus amyloliquefaciens FB-1 obtained in Step 1 is cultured to obtain primary seed culture;

[0019] Step 3: Prepare fermentation broth: Cultivate the primary seed liquid obtained in step 2 to obtain the fermentation broth of Bacillus amyloliquefaciens FB-1.

[0020] In some specific embodiments of the present invention, the activation in step 1 is as follows: the Bacillus amyloliquefaciens FB-1 stored at -80°C is inoculated into solid LB medium and cultured at 34~38°C for 12~24 hours to obtain the activated Bacillus amyloliquefaciens FB-1.

[0021] In some specific embodiments of the present invention, the preparation of primary seed in step 2 is as follows: the activated Bacillus amyloliquefaciens FB-1 strain is mixed with sterile water and then inoculated into primary seed culture medium and cultured at 34~38℃ for 12~24h to obtain the primary seed liquid; the primary seed culture medium is LB medium and the pH of the primary seed culture medium is 6.5~7.0.

[0022] In some specific embodiments of the present invention, the preparation of fermentation broth in step 3 is as follows: the primary seed culture is transferred to an expanded fermentation medium at an inoculation rate of 2% to 5% by volume, and cultured at 34 to 38°C, a rotation speed of 180 to 220 rpm / min, an aeration rate of 0.5 to 0.8 vvm, and an aeration rate of 0.04 MPa to 0.06 MPa for 12 to 24 hours to obtain the fermentation broth, wherein the effective viable count of the fermentation broth is 8 × 10⁻⁶. 8cfu / mL ~12×10 8 cfu / mL;

[0023] The expanded fermentation medium comprises the following components by mass fraction: 1.5% glucose, 0.2% calcium carbonate, 2% yeast extract, 0.05% magnesium sulfate, 0.06% potassium dihydrogen phosphate, 0.05% sodium chloride, 100 mL water, and pH 6.5-7.0.

[0024] Thirdly, the present invention also provides a fermentation broth obtained by the aforementioned extended culture method.

[0025] Fourthly, the present invention also provides an inoculum for Bacillus amyloliquefaciens FB-1, including the fermentation broth.

[0026] Preferably, the plants include those needed for brewing spirits.

[0027] Fifthly, the present invention also provides the application of the aforementioned Bacillus amyloliquefaciens FB-1, the aforementioned fermentation broth, or the aforementioned microbial agent in the brewing of baijiu (Chinese liquor).

[0028] Preferably, the Bacillus amyloliquefaciens FB-1 uses isoamyl alcohol as a carbon source in the brewing of baijiu, which can significantly reduce the isoamyl alcohol content in baijiu by about 20%.

[0029] Preferably, the liquor includes sauce-flavored liquor.

[0030] In a sixth aspect, the present invention also provides a method for brewing baijiu (Chinese liquor), wherein brewing raw materials are mixed with the aforementioned Bacillus amyloliquefaciens FB-1, the aforementioned bacterial liquid, or the aforementioned bacterial agent, and then fermented.

[0031] In a seventh aspect, the present invention also provides a type of liquor produced by the brewing method described above.

[0032] In some specific embodiments of the present invention, the brewing method of baijiu (Chinese liquor) specifically includes the following steps:

[0033] First, take a certain amount of sorghum, crush it, add water, and pile it up for 12-24 hours. Then, mix in 10-20% rice husks and steam the sorghum at 127℃ for 60 minutes. Let the steamed sorghum cool to about 25-30℃, then mix in fermented distiller's grains at a ratio of sorghum to fresh distiller's grains of 1:3-4 (by weight). Next, add about 10-20% of the sorghum's grain weight of Daqu (made at 50-60℃, purchased from Luzhou Ruihua Biotechnology on Taobao) and mix well. Finally, add 1% of the prepared high-concentration bacterial solution (8×10⁶ viable bacteria) as inoculum. 8 The concentration of CFU / mL was added to the cooled mash, while the control group consisted of an equal volume of sterile saline. After thorough mixing, the mixture was placed in small jars, sealed with water, and fermented for approximately 45 days. After fermentation, the mash was removed, distilled, and the resulting liquor was analyzed.

[0034] This invention provides a bacterial culture obtained by the aforementioned expanded culture method. The viable count of the bacterial culture is not less than 8.0 × 10⁻⁶. 8 CFU / mL.

[0035] This invention also provides a strain of Bacillus amyloliquefaciens and its application in the production of strong-aroma baijiu. Liquid culture of this strain achieved the utilization of 0.49~1.1g / L of isoamyl alcohol after 48h of culture, which makes up for the method of reducing isoamyl alcohol by screening low-yield yeast or process control alone.

[0036] This strain can also be applied to baijiu brewing, significantly reducing the isoamyl alcohol content in baijiu by about 20%, with stable results.

[0037] Biological Preservation Instructions

[0038] Bacillus amyloliquefaciens FB-1 ( Bacillus amyloliquefaciens FB-1 was deposited on October 11, 2024, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M20242158. Attached Figure Description

[0039] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0040] Figure 1 Show phylogenetic tree;

[0041] Figure 2 The aroma components of baijiu (Chinese liquor) were detected. Detailed Implementation

[0042] This invention discloses Bacillus amyloliquefaciens and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0043] The main technical solutions adopted in this invention include:

[0044] This invention mainly provides a strain of Bacillus amyloliquefaciens that utilizes isoamyl alcohol and its application in the production of strong-aroma baijiu. The screening method and application include the following steps: screening and identification of the isoamyl alcohol-utilizing strain, determination of the fermentation performance of the isoamyl alcohol-utilizing strain, and expansion culture and application of the isoamyl alcohol-utilizing strain.

[0045] Finally, the strain's ability to utilize isoamyl alcohol was verified by liquid fermentation. The results showed that the strain had an outstanding ability to utilize isoamyl alcohol, and it was identified as Bacillus amyloliquefaciens by molecular biology.

[0046] The Bacillus amyloliquefaciens FB-1 will be deposited at the Wuhan Institute of Microbial Culture on October 11, 2024, with accession number: CCTCC NO: M20242158.

[0047] The isoamyl alcohol-using strain of the present invention was screened and identified, and the isolation method was as follows: 10g of Daqu powder sample was accurately weighed and dispersed in 90mL of sterile water containing glass beads. The mixture was filtered through four layers of sterile gauze, and 100uL of the filtrate was taken. The filtrate was diluted and spread on three screening medium plates. The plates were incubated at 37℃ for 2 days. Colonies with good growth were picked and purified twice using a three-zone streak method. Finally, the purified strain, Bacillus amyloliquefaciens FB-1, was obtained.

[0048] The screening medium consisted of: 1g isoamyl alcohol, 0.05g magnesium sulfate, 0.2g potassium dihydrogen phosphate, 0.5g ammonium sulfide, 0.3mL calcium chloride (6.67g / L), 0.3mL ferric chloride (17g / L), 0.05g ferrous sulfate heptahydrate, 0.1g sodium chloride, 2g agar powder, 100mL water, and natural pH.

[0049] The method for testing the isoamyl alcohol utilization fermentation performance of Bacillus amyloliquefaciens includes: firstly, picking a single colony of Bacillus amyloliquefaciens FB-1 from a plate and inoculating it into 200 mL of LB medium, and culturing it in a shaker at 34-38℃ and 180-200 r / min for 12 h, and then inoculating it at an inoculum size of 2%-5% (viable count of 1.9 × 10⁻⁶). 8(CFU / mL) was inoculated into isoamyl alcohol fermentation medium, and samples were taken every 12 hours to detect the isoamyl alcohol content.

[0050] The composition of beef extract peptone medium (LB) is: 10 g / L tryptone, 5 g / L beef extract, 5 g / L sodium chloride (NaCl), adjusted to pH 7.0, and sterilized at 121°C.

[0051] Expanded fermentation medium composition: includes the following components by mass fraction: glucose 1.5%, calcium carbonate 0.2%, yeast extract 2%, magnesium sulfate 0.05%, potassium dihydrogen phosphate 0.06%, sodium chloride 0.05%, water 100mL, pH 6.5~7.0.

[0052] Isoamyl alcohol fermentation medium: 1g isoamyl alcohol, 0.05g magnesium sulfate, 0.2g potassium dihydrogen phosphate, 0.5g ammonium sulfide, 0.3mL 6.67g / L calcium chloride, 0.3mL 17g / L ferric chloride, 0.05g ferrous sulfate heptahydrate, 0.1g sodium chloride, 2g agar powder, 100mL water, pH natural. Sterilize at 121℃.

[0053] The method for expanding the isoamyl alcohol culture using the strain is as follows: It includes the following steps:

[0054] Strain activation: The strain was activated using Bacillus amyloliquefaciens FB-1; wherein, Bacillus amyloliquefaciens FB-1 is deposited at the China General Microbiological Culture Collection Center, with accession number CCTCC NO: M20242158.

[0055] Preparation of primary seeds: Activated Bacillus amyloliquefaciens FB-1 was cultured to obtain primary seeds;

[0056] Preparation of Bacillus amyloliquefaciens fermentation broth: The obtained Bacillus amyloliquefaciens FB-1 primary seed culture was cultured to obtain Bacillus amyloliquefaciens FB-1 fermentation broth / high concentration bacterial culture.

[0057] According to a preferred embodiment, the step of activating the bacterial strain further includes: inoculating Bacillus amyloliquefaciens FB-1 stored at -80°C onto a solid LB medium plate and culturing it at 34~38°C for 12~24 hours to obtain activated Bacillus amyloliquefaciens FB-1 bacterial strain.

[0058] According to a preferred embodiment, the step of preparing primary seeds further includes: extracting 1-5 single colonies with better growth on a plate, mixing them in 5 ml of sterile water, inoculating them into a primary seed culture medium, and culturing them at a temperature of 34-38℃ for 12-24 h to obtain Bacillus amyloliquefaciens FB-1 primary seed solution.

[0059] According to a preferred embodiment, the primary seed culture medium is LB medium, and the pH of the primary seed culture medium is 6.5~7.0.

[0060] According to a preferred embodiment, the step of preparing the fermentation broth further includes: transferring the primary seed culture at a volume fraction of 2%–5% into the culture medium in the seed tank, and culturing at 34–38°C with a rotation speed of 180–220 rpm / min, an aeration rate of 0.5–0.8 vvm, and a tank pressure maintained at 0.04 MPa–0.06 MPa for 12–24 hours to obtain a high-concentration Bacillus amyloliquefaciens FB-1 bacterial broth with an effective viable count of 8 × 10⁻⁶. 8 cfu / mL ~12×10 8 cfu / mL.

[0061] According to a preferred embodiment, the expanded fermentation medium comprises the following components by mass fraction: 1.5% glucose, 0.2% calcium carbonate, 2% yeast extract, 0.05% magnesium sulfate, 0.06% potassium dihydrogen phosphate, and 0.05% sodium chloride, in 100 mL, with a pH of 6.5-7.0.

[0062] The isoamyl alcohol-utilizing strain is used as follows:

[0063] Take a certain amount of sorghum, crush it, add water, and pile it up for 12-24 hours. Then, mix in 20% rice husks and steam the sorghum at 127℃ for 60 minutes. Let the steamed sorghum cool to about 25-30℃, then mix in fermented distiller's grains at a ratio of sorghum to fresh distiller's grains of 1:3-4 (by weight). Then, add about 10%-20% of the sorghum's weight of Daqu (fermentation temperature reached 50-60℃, purchased from Luzhou Ruihua Biotechnology on Taobao) and mix well. Finally, add 1% of the prepared high-concentration bacterial solution (8×10⁶ viable bacteria) as inoculum. 8 The concentration of CFU / mL was added to the cooled mash, while the control group consisted of an equal volume of sterile saline. After thorough mixing, the mixture was placed in small jars, sealed with water, and fermented for approximately 45 days. After fermentation, the mash was removed, distilled, and the resulting liquor was analyzed.

[0064] The beneficial effects of the technical solution of this invention are as follows:

[0065] 1. The viable count of the Bacillus amyloliquefaciens strain obtained from the expanded culture of the strain screened in this invention is not less than 8.0 × 10⁻⁶. 8 CFU / mL.

[0066] 2. The Bacillus amyloliquefaciens obtained by screening in this invention can be cultured for 48 hours and then used with 0.49~1.1g / L of isoprene, which makes up for the shortcomings of simply screening low-yield yeasts or controlling the process to reduce higher alcohols.

[0067] 3. The Bacillus amyloliquefaciens strain that utilizes isoamyl alcohol obtained by screening in this invention can be applied to the brewing of baijiu (Chinese liquor), and can significantly reduce the isoamyl alcohol content in baijiu by 19.7%, approximately 20%, with stable results.

[0068] The Bacillus amyloliquefaciens provided by this invention, as well as the raw materials and reagents used in its application, are all commercially available.

[0069] The present invention will be further illustrated below with reference to the embodiments:

[0070] Example 1: Screening of strains utilizing isoamyl alcohol

[0071] Screening medium: 1g isoamyl alcohol, 0.05g magnesium sulfate, 0.2g potassium dihydrogen phosphate, 0.5g ammonium sulfide, 0.3mL calcium chloride (6.67g / L), 0.3mL ferric chloride (17g / L), 0.05g ferrous sulfate heptahydrate, 0.1g sodium chloride, 2g agar powder, 100mL water, pH natural.

[0072] Accurately weigh 10g of Daqu powder sample (made at a temperature of 50-60℃, purchased from Luzhou Ruihua Biotechnology on Taobao) and disperse it in 90mL of sterile water containing glass beads. Filter the solution through four layers of sterile gauze, take 100uL of the filtrate, dilute it and spread it on three plates of screening medium. Incubate at 37℃ for 2 days. Select colonies with good growth and purify each colony twice using a three-zone streak method. Finally, the purified strain—Bacillus amyloliquefaciens FB-1 strain—was obtained.

[0073] 16S rDNA Sequencing and Analysis

[0074] (1) DNA extraction

[0075] The purified single colonies of different morphologies were inoculated into isoamyl alcohol fermentation medium (preparation method: 1g isoamyl alcohol, 0.05g magnesium sulfate, 0.2g potassium dihydrogen phosphate, 0.5g ammonium sulfide, 0.3mL 6.67g / L calcium chloride, 0.3mL 17g / L ferric chloride, 0.05g ferrous sulfate heptahydrate, 0.1g sodium chloride, 2g agar powder, 100mL water, pH at rest. Sterilize at 121℃). The medium was incubated at 37℃ for 24h. 2mL of the culture was transferred to a sterile centrifuge tube and centrifuged at 13000r / min for 10min. The supernatant was discarded, and the bacterial pellet was collected (this process was repeated 2-3 times). Genomic DNA was extracted from the bacterial pellet using a rapid bacterial genomic DNA extraction kit (OMEGAD3350) following the prescribed procedure.

[0076] (2) PCR amplification and construction of phylogenetic tree

[0077] The DNA solution obtained in step (1) was used as an amplification template, and the universal bacterial primers were used: forward primer 27F: AGAGTTTGATCCTGGCTCAG (as shown in SEQ ID No. 1);

[0078] PCR amplification was performed using reverse primer 1492R: TACCGCTACCTTGTTACGACTT (as shown in SEQ ID No. 2);

[0079] The PCR amplification system is: 5×Buffer (containing Mg) 2+ 10 μL of 200 μmol / L dNTPs, 1 μL each of forward and reverse primers, 1 μL of Taq DNA polymerase, 3 μL of template DNA, and sterile water to bring the total volume to 50 μL.

[0080] The amplification conditions were: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 1 min; 55℃ annealing for 1 min; 72℃ extension for 1.5 min, for a total of 30 cycles; and a final extension at 72℃ for 10 min.

[0081] The amplification products were detected by 1% agarose gel electrophoresis, and the PCR products were sequenced at BGI Genomics Co., Ltd. After cutting the sequenced sequences using BioEdit, reliable sequence fragments were uploaded to the NCBI nucleic acid alignment website for comparison. The sequences with the highest homology were selected, and a phylogenetic tree was constructed using MEGA 5.0 software. The phylogenetic tree based on 16S rDNA is shown below. Figure 1 As shown.

[0082] The strain was identified as Bacillus amyloliquefaciens by 16S rDNA and named Bacillus amyloliquefaciens FB-1.

[0083]

[0084] Example 2: Fermentation performance test of the strain

[0085] First, a single colony of Bacillus amyloliquefaciens FB-1 obtained in Example 1 was picked from the plate and inoculated into 200 mL of LB medium. The culture was then incubated at 34-37℃ and 180-200 rpm for 12-24 h to obtain a seed culture (with a viable count of 1.9 × 10⁻⁶). 8 The isoamyl alcohol (CFU / mL) was inoculated at a 5% inoculum into a fermentation medium with isoamyl alcohol as the carbon source (isoamyl alcohol fermentation medium composition: 1g isoamyl alcohol, 0.05g magnesium sulfate, 0.2g potassium dihydrogen phosphate, 0.5g ammonium sulfide, 0.3mL 6.67g / L calcium chloride, 0.3mL 17g / L ferric chloride, 0.05g ferrous sulfate heptahydrate, 0.1g sodium chloride, 2g agar powder, 100mL water, pH natural, sterilized at 121℃). The medium was then statically incubated at different temperatures (29℃, 31℃, 33℃, 35℃, 37℃, 39℃) at 180-200 rpm for 48 hours, and samples were taken to detect isoamyl alcohol consumption. (Three parallel experiments were performed at each temperature).

[0086] As shown in Table 2, FB-1 showed the greatest decrease in isoamyl alcohol when cultured at 37℃ and 180-200 r / min for 48 h.

[0087] Table 2. Isoamyl alcohol consumption at different culture temperatures

[0088]

[0089] Isoamyl alcohol content detection:

[0090] Sample pretreatment: Mix 1 mL of anhydrous ethanol with 1 mL of fermentation broth, let stand for half an hour, then use a disposable syringe to draw an appropriate amount of the mixed sample solution, insert a 0.22 μm aqueous filter membrane, and inject it into a 2.0 mL centrifuge tube. Then use a pipette to draw 1 mL of the sample solution from the centrifuge tube into the sample bottle. Finally, draw 20 μL of standard sample below the liquid level in the sample bottle.

[0091] Gas chromatography conditions: LZP-930 capillary column for baijiu (25m × 0.32mm × 1μm); carrier gas: N2; temperature program: using the baijiu flavor detection method, the initial temperature was 55℃, held for 2 min, then increased to 130℃ at 5℃ / min, held for 17 min, then increased to 200℃ at 15℃ / min, held for 5 min. The injection port temperature was 230℃, and the detector temperature was 250℃; the sampling end time was 26.667 min. The internal standard was n-butyl acetate, with a concentration of 17.94 mg / ml.

[0092] Example 3: Application of Bacillus amyloliquefaciens FB-1 in the production of strong-aroma baijiu

[0093] Scale-up culture of Bacillus amyloliquefaciens: Single colonies of the activated strain were picked from plates and inoculated into LB medium. The culture was carried out in shake flasks at 34–38°C and 180–200 rpm for 12–48 h, yielding a viable count of 1.9 × 10⁻⁶ cells / mL. 8 The primary seed culture was prepared at CFU / mL. A fermenter was selected as the seed tank, and 60% LB medium was added, along with 0.2% (v / v) of polyether defoamer. The pH was adjusted to 6.8 with sodium hydroxide. The mixture was then sterilized at 121°C for 20 min, cooled to 37°C, and inoculated into the expansion medium (comprising the following components by mass fraction: glucose 1.5%, calcium carbonate 0.2%, yeast extract 2%, magnesium sulfate 0.05%, potassium dihydrogen phosphate 0.06%, sodium chloride 0.05%, water 100 mL, pH 6.5–7.0) at a volume ratio of 2%–5%. The culture was maintained at an aeration ratio of 0.5–0.8 vvm, a tank pressure of 0.05 MPa, a stirring speed of 180–200 rpm, and 37°C. Samples were taken every 4 hours for analysis. The culture was considered complete when the cell count in the fermentation broth reached 8.0 × 10⁶ cells / mL. 8 Once the concentration of CFU / mL is reached, the mixture can be transferred to a fermentation tank to obtain the fermentation broth for later use.

[0094] (1) Raw material crushing: High-quality sorghum is used as raw material, and the crushing degree is required to pass through a 20-mesh sieve with more than 70% to 75% of the raw materials.

[0095] (2) Moistening: Mix sorghum flour with water at 60-70℃, which is equivalent to 60% of the raw material mass, and pile it up for moistening for 18-20 hours.

[0096] (3) Steaming: Mix the moistened material with rice husks (which have been steamed) that are equivalent to 20% of the weight of sorghum flour, mix well, and then steam for 1 hour after steaming.

[0097] (4) Ingredients: After the steamed material is cooled to about 30°C, it is mixed with traditional fermented lees. The ratio of lees to fresh lees is 1:3 to 4. The fermentable starch content of the material after mixing should be 16% to 18% and the acidity should be 1.6 to 2.0 mmol / 10g. The mass of strong aroma koji powder (the koji making temperature reaches 50 to 60°C, purchased from Luzhou Ruihua Biotechnology on Taobao) is equivalent to 10% to 20% of the mass of sorghum.

[0098] (5) Add Bacillus amyloliquefaciens: Finally, add the prepared high-concentration bacterial solution (with a viable count of 8 × 10⁻⁶) at an inoculation rate of 1% of the sorghum weight. 8 The control group was a mixture of CFU / mL and the cooled mash, with an equal volume of sterile saline solution.

[0099] (6) Small jar fermentation: Seal the mouth of the jar with a layer of plastic film, then invert a bowl and seal it with water, and place it under a constant temperature of 30℃ for 45 days for fermentation.

[0100] (7) Distillation: The fermented mash is loaded into a still for distillation. When loading the still, the material on both sides of the still should be about 1-2 cm higher than the middle. When collecting the liquor, the beginning and end should be removed. When the original liquor has an alcohol content of less than 53% vol, the collection should be stopped.

[0101] (8) Detection of aroma components of baijiu: Gas chromatography was used to detect and analyze the baijiu samples.

[0102] Wine sample component analysis:

[0103] Sample pretreatment: Take 2 mL of wine sample, filter it through a 0.22 μm aqueous phase filter membrane, and then inject it into a 2.0 mL centrifuge tube. Then, use a pipette to draw 1 mL of sample solution from the centrifuge tube into the sample bottle. Finally, draw 20 μL of standard sample into the sample bottle below the liquid level.

[0104] Gas chromatography conditions: LZP-930 capillary column for baijiu (25m × 0.32mm × 1μm); carrier gas: N2; temperature program: using the baijiu flavor detection method, the initial temperature was 55℃, held for 2 min, then increased to 130℃ at 5℃ / min, held for 17 min, then increased to 200℃ at 15℃ / min, held for 5 min. The injection port temperature was 230℃, and the detector temperature was 250℃; the sampling end time was 26.667 min. The internal standard was n-butyl acetate, with a concentration of 17.94 mg / ml.

[0105] Table 3. Results of wine samples

[0106]

[0107] As shown in Table 3, the levels of n-propanol, n-butanol, isoamyl alcohol, and isobutanol in the experimental group decreased compared with those in the control group. However, only isoamyl alcohol showed a significant decrease, decreasing by 65.9 mg / L (19.7%) compared with the control group. Ethyl hexanoate increased, increasing by 70.8 mg / L (9.0%) compared with the control group.

[0108] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Bacillus amyloliquefaciens FB-1, characterized in that, Its accession number is CCTCC NO: M20242158; The Bacillus amyloliquefaciens FB-1 used isoamyl alcohol as a carbon source.

2. The method for large-scale culture of Bacillus amyloliquefaciens FB-1 as described in claim 1, characterized in that, Includes the following steps: Step 1: Strain activation: The Bacillus amyloliquefaciens FB-1 strain was used as the strain for activation; Step 2: Preparation of primary seed culture: The activated Bacillus amyloliquefaciens FB-1 obtained in Step 1 is cultured to obtain primary seed culture; Step 3: Prepare fermentation broth: Cultivate the primary seed liquid obtained in step 2 to obtain the fermentation broth of Bacillus amyloliquefaciens FB-1.

3. The method for expanding culture as described in claim 2, characterized in that, In step 1, the activation is as follows: the Bacillus amyloliquefaciens FB-1 stored at -80℃ is inoculated into solid LB medium and cultured at 34~38℃ for 12~24 hours to obtain the activated Bacillus amyloliquefaciens FB-1.

4. The method for expanding culture as described in claim 2, characterized in that, In step 2, the preparation of the primary seed is as follows: the activated Bacillus amyloliquefaciens FB-1 strain is mixed with sterile water and then inoculated into the primary seed culture medium. The culture is carried out at 34-38℃ for 12-24 hours to obtain the primary seed liquid. The primary seed culture medium is LB medium and the pH of the primary seed culture medium is 6.5-7.

0.

5. The method for expanding culture as described in claim 2, characterized in that, In step 3, the preparation of the fermentation broth involves: transferring the primary seed culture at an inoculum volume of 2%–5% into an expanded fermentation medium, and culturing it at 34–38°C, a rotation speed of 180–220 rpm / min, an aeration rate of 0.5–0.8 vvm, and an aeration rate of 0.04 MPa–0.06 MPa for 12–24 hours to obtain the fermentation broth, wherein the effective viable cell count of the fermentation broth is 8 × 10⁻⁶. 8 cfu / mL ~12×10 8 cfu / mL; The expanded fermentation medium comprises the following components by mass fraction: 1.5% glucose, 0.2% calcium carbonate, 2% yeast extract, 0.05% magnesium sulfate, 0.06% potassium dihydrogen phosphate, 0.05% sodium chloride, 100 mL water, and pH 6.5-7.

0.

6. An inoculum of Bacillus amyloliquefaciens FB-1, characterized in that, This includes fermentation broth obtained by the scale-up culture method as described in any one of claims 2 to 5.

7. The application of Bacillus amyloliquefaciens FB-1 as described in claim 1, or the fermentation broth obtained by the expanded culture method as described in any one of claims 2 to 5, or the microbial agent as described in claim 6, in the brewing of baijiu (Chinese liquor).

8. A method for brewing baijiu (Chinese white liquor), characterized in that, Fermentation is carried out by mixing brewing raw materials with Bacillus amyloliquefaciens FB-1 as described in claim 1, fermentation broth obtained by the expanded culture method as described in any one of claims 2 to 5, or fermentation with the inoculum as described in claim 6.

Images