Rice cold-tolerant gene OsPTR and application thereof

Abstract

The invention belongs to the technical field of plant genetic engineering and rice breeding, and particularly discloses a rice cold-tolerant gene OsPTR and application thereof. The rice cold-tolerant gene OsPTR is identified by constructing a co-expression network of a rice gene and a transposon and combining GWAS analysis, and the nucleotide sequence of the rice cold-tolerant gene OsPTR is as shown in SEQ ID No.1. Transposon insertion polymorphism exists in an intron region of the rice cold-tolerant gene OsPTR, and the nucleotide sequence of the transposon is as shown in SEQ ID No.2. The transposon causes generation of different splicing isomers by influencing a post-transcriptional processing process, so that expression regulation and functions of the rice cold-tolerant gene OsPTR are influenced, and the transposon has a nucleotide sequence as shown in SEQ ID No.2 in a material which does not carry transposon insertion. The expression level of the OsPTR is obviously reduced. Overexpression of the OsPTR can significantly improve the cold tolerance of the rice. The invention provides new gene resources and molecular markers for cold-tolerant breeding of rice.

Description

Technical Field

[0001] The present invention belongs to the technical fields of plant gene engineering and rice breeding, and particularly relates to a rice cold-resistant gene OsPTR and an application thereof. Background Art

[0002] As an important food crop, rice's yield and quality are often affected by abiotic stress, among which low temperature stress is one of the important factors limiting rice production. When cold damage occurs, rice will experience a series of physiological damage phenomena such as stunted growth, decreased pollination rate, and reduced fruit set rate, which seriously affect the stable and high yields in rice-growing areas. To this end, researchers have conducted extensive exploration of the cold tolerance mechanism of rice at the molecular level and have identified several key genes closely related to cold stress response. For example, COLD1 plays a core role in sensing cold stimulation and activating the calcium signaling pathway; OsCNGC9 is related to the cold signal transduction process; and OsRS2Z38 enhances cold tolerance by regulating changes in splicing sites. These findings provide important genetic resources for the selection and breeding of cold-tolerant rice varieties and have also promoted the rapid development of rice molecular breeding.

[0003] In recent years, with the maturity of third-generation sequencing technology and the advent of the pan-genome concept, rice genome research has gradually transitioned from a single reference genome to a graphical pan-genome. This shift has enabled the discovery of a large number of structural variations that were difficult to detect using traditional methods. In particular, variations caused by transposons have become a hotspot for functional gene discovery. Transposons, as important mobile genetic elements, are widely present in plant genomes and can be divided into retrotransposons and DNA transposons based on their transposition mechanism. In rice, DNA transposons such as mPing have been shown to regulate stress-related gene networks. Furthermore, a growing number of studies have shown that transposon insertion polymorphisms have significant effects on trait formation, even surpassing traditional single-nucleotide polymorphisms.

[0004] The function of OsPTR has been studied in plants such as Arabidopsis thaliana, but due to its multi-copy nature, its role in cold tolerance has not been reported in rice. Therefore, exploring the function and mechanism of action of OsPTR in rice is of great significance for revealing the mechanism of rice cold tolerance. Summary of the Invention

[0005] The present invention constructs a co-expression network of rice genes and transposons, combined with GWAS analysis, to identify the rice cold-tolerant gene OsPTR, whose CDS sequence is shown in SEQ ID No. 1. The intron region of the rice cold-tolerant gene OsPTR contains a transposon insertion polymorphism, and the nucleotide sequence of the transposon is shown in SEQ ID No. 2. The transposon affects the post-transcriptional processing process, leading to the generation of different splicing isomers, thereby affecting the expression regulation and function of the rice cold-tolerant gene OsPTR. In materials that do not carry specific transposon insertions, the expression level of OsPTR is significantly reduced. In rice, overexpression of OsPTR can significantly improve the cold tolerance of rice.

[0006] In view of this, the present invention aims to provide a rice cold-tolerant gene OsPTR and its application.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] The present invention provides an application of a rice cold-tolerant gene OsPTR in improving the cold tolerance of rice. The nucleotide sequence of the rice cold-tolerant gene OsPTR is shown in SEQ ID No. 1.

[0009] Furthermore, the application is to improve the cold tolerance of rice by overexpressing the rice cold tolerance gene OsPTR in rice.

[0010] The present invention also provides the use of the protein encoded by the rice cold-tolerant gene OsPTR in improving the cold tolerance of rice. The amino acid sequence of the protein encoded by the rice cold-tolerant gene OsPTR is shown in SEQ ID No. 3.

[0011] The present invention also provides the rice cold-tolerant gene OsPTR, an expression cassette comprising the rice cold-tolerant gene OsPTR, an expression vector, and a recombinant bacterium for use in improving rice cold-tolerant germplasm resources. The nucleotide sequence of the rice cold-tolerant gene OsPTR is shown in SEQ ID No. 1.

[0012] The present invention also provides a rice cold-tolerant gene OsPTR, an expression cassette comprising the rice cold-tolerant gene OsPTR, an expression vector, and a recombinant bacterium for use in cultivating cold-tolerant rice. The nucleotide sequence of the rice cold-tolerant gene OsPTR is shown in SEQ ID No. 1.

[0013] The present invention also provides a method for improving the cold tolerance of rice. The method comprises overexpressing the rice cold tolerance gene OsPTR in rice through transgenic, hybridization, backcrossing, selfing or asexual reproduction, thereby improving the cold tolerance of rice. The nucleotide sequence of the rice cold tolerance gene OsPTR is shown in SEQ ID No. 1.

[0014] The present invention also provides a transposon of the rice cold-tolerant gene OsPTR. The transposon is located in the intron region of the rice cold-tolerant gene OsPTR, and its nucleotide sequence is shown in SEQ ID NO. 2. The transposon has insertion polymorphism, and the expression level of OsPTR is significantly reduced in materials without transposon insertion.

[0015] The present invention also provides the application of the transposon in improving cold-resistant rice germplasm resources.

[0016] The present invention also provides the use of the transposon in cultivating cold-resistant rice.

[0017] Beneficial effects of the present invention: The present invention provides a novel rice cold-tolerance gene, OsPTR, whose nucleotide sequence is shown in SEQ ID No. 1 and the amino acid sequence of the encoded protein is shown in SEQ ID No. 2. This gene has two haplotypes in indica and japonica rice, and overexpression of this gene can significantly enhance rice cold tolerance. The present invention also provides a transposon of the rice cold-tolerance gene, OsPTR, located in the intron region of the rice cold-tolerance gene, OsPTR, whose nucleotide sequence is shown in SEQ ID NO. 2. The transposon has insertion polymorphism, which affects post-transcriptional processing, resulting in the generation of different splicing isoforms, thereby affecting the expression regulation and function of the gene OsPTR. In materials without transposon insertions, the expression level of OsPTR is significantly reduced. The rice cold-tolerance gene, OsPTR, provided by the present invention not only enriches the rice cold-tolerance gene library, but also provides new gene resources and breeding resources for rice breeding, which is of great significance for analyzing the mechanism of rice cold tolerance and molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 For pan-genome construction; where a is the pan-genome construction process; b is the histogram of transposon insertion sites and numbers; c is the PCA diagram based on TIP; d is the population structure diagram based on TIP.

[0019] Figure 2 Figure 2 is the transcriptional regulation and epigenetic modification characteristics of polymorphic TEs; a is a Venn diagram of the number of TIP genes; b is a boxplot of the effect of TE insertion on gene expression; c is a TE annotation flowchart; d is a line graph of epigenetic modification; e is a stacked bar graph of epigenetic modification across the entire genome; and f is a stacked bar graph of epigenetic modification near genes.

[0020] Figure 3 Mining OsPTR genes for GWAS; a is the Manhattan plot of TIP-GWAS; b is the local Manhattan plot based on SV and SNP; c is the visualization of read alignment; d is the box plot of survival rate and genotype

[0021] Figure 4 is the expression level and variable splicing of OsPTR; a is the box plot of gene expression before and after cold stress; b is the visualization of transcriptome data of two haplotypes.

[0022] Figure 5 Functional identification of OsPTR; among them, a is the box plot of gene expression levels in cold-tolerant (CT) and cold-sensitive (CS) materials; b is the bar graph of gene expression levels under different stresses; c is the phenotypic diagram of transgenic plants; d is the cold treatment survival rate of transgenic plants; e is the line graph of the change of ion leakage rate under cold treatment; f is the DAB and NBT staining images before and after cold stress.

[0023] Figure 6 Verification of OsPTR mutation site; a is the target sequence and sgRNA; b is the homozygous and heterozygous typing diagram; c is the mutation sequence verified by Sanger sequencing. DETAILED DESCRIPTION

[0024] The technical solutions of the present invention will be described in further detail below with reference to specific embodiments. It should be understood that the following examples are merely illustrative and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above-mentioned contents of the present invention are encompassed within the scope that the present invention is intended to protect. It should be noted that, unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The experimental reagents in the examples, unless otherwise specified, can all be obtained commercially. The experimental methods in the examples, unless otherwise specified, are all conventional methods.

[0025] Example 1: Pan-genome construction and GWAS analysis to identify OsPTR genes

[0026] (1) Graphical pan-genome construction

[0027] Ten rice genomes (Table 1) and the reference genome MH63 were used to construct a graphical pan-genome, which was 581.7 Mb in size and contained 50,875 structural variants (SVs), of which 88.6% were diallelic.

[0028]

[0029]

[0030] Through TE annotation and alignment, 31,673 SVs containing transposons (TEs) were identified, and 30,316 high-confidence transposon polymorphism (TIPs) sites were obtained ( Figure 1a), and verification showed that most are driven by Gypsy elements. A pan-TE collection of rice was constructed, encompassing a total of 267.7 Mb of TE sequences. Further analysis revealed specific TE insertion patterns among different subspecies, with a particularly high insertion rate of pTEs in japonica rice, suggesting a possible role in indica-japonica differentiation. We defined 15,440 TIP genes in the pan-genome. Of the 24,376 TE insertion events near genes, nearly 37% occurred in promoter regions ( Figure 1 b) shows that TEs may affect gene expression by regulating promoter activity. MITE-type pTEs prefer to insert into upstream and downstream regions of genes.

[0031] Further population structure analysis of the TIP loci of 165 rice materials (Table 2) showed that the japonica, indica and Australian rice populations could be clearly distinguished ( Figure 1 c, d), showing similar classification ability as SNP, indicating that pTE is an important marker for revealing the differentiation of rice subspecies.

[0032]

[0033]

[0034]

[0035]

[0036] (2) Transcriptional regulation and epigenetic modification characteristics of polymorphic TEs

[0037] RNA-seq data were collected for 90 samples, including three biological replicates of 10 materials (Table 1) at three time points. Total RNA of the samples was extracted using TRIzol, and mRNA was purified from the total RNA using magnetic beads with poly-T oligonucleotides. According to the manufacturer's instructions, cDNA libraries of rice leaf tissue samples were prepared using the TruSeq Stranded mRNA Sample Prep Kit and 150bp double-end sequencing was performed on the HiSeq2500 platform. After filtering the raw sequencing data, the filtered RNA-seq data were aligned to the MH63 reference genome using HISAT2 (v2.2.1). Based on the RNA-seq alignment results, SAMtools (v1.21) was used to sort the BAM files and generate index files under default parameters. Transcript assembly was completed using StringTie (v2.2.0) under default parameters. Gene expression was calculated by StringTie in units of transcripts per kilobase per million aligned fragments (FPKM) and transcripts per kilobase per million (TPM).

[0038] Based on the above analysis, it was found that the expression level of TIP gene in samples without pTE was significantly lower than that in samples with pTE insertion, and different types of pTE had different effects on gene expression. DNA / Mutator, MITE / Tourist, DNA / Helitron and DNA / PIF-Harbinger had particularly significant effects under cold stress. In addition, the pTE insertion site also significantly affected gene expression. The genes with specific TE insertion were analyzed ( Figure 2 a), where pTE located in the upstream 2 kb and intron regions were significantly associated with lower expression levels ( Figure 2 b). Immunoprecipitation sequencing of H3K27me3 histone modification and whole-genome bisulfite sequencing were performed on leaf samples from normal and cold-treated (72h). The genome was classified into TE categories ( Figure 2 c), the results showed that the H3K27me3 and DNA methylation levels in the pTE region increased significantly under cold stress ( Figure 2 d), and are more likely to be enriched with H3K9me2 modification than consensus TE (cTE) regions ( Figure 2 e). In addition, there are also significant differences in the distribution of H3K9me2 modification between indica and japonica rice ( Figure 2 f), indicating that pTE may serve as a transcriptional regulatory element in the cold stress response of rice.

[0039] (3) GWAS identification of the rice cold-tolerance gene OsPTR

[0040] 165 Illumina sequencing data sets were aligned to the MH63 genome using BWA (v2.2.1) with default parameters. Genomic variant detection was performed using the HaplotypeCaller and GenotypeGVCFs functions in the Genome Analysis Toolkit (GATK, v4.2.6.1). VCF files were then merged using BCFtools (v1.19) with default parameters. SNP detection results were further filtered using the "--maf 0.05 --max-missing 0.9" parameters.

[0041] The phenotype analyzed in this study was the survival rate of 165 rice accessions after a 5-day low-temperature treatment and a 3-day recovery period. These 165 rice varieties represent major global rice subgroups and include 14 Aus, 23 Indica I, 9 Indica II, 27 Indica III, 21 Indica intermediate, 3 Intermediate, 12 Japonica intermediate, 27 Temperate Japonica, 28 Tropical Japonica, and 1 VI / Aromatic. To assess the cold tolerance of these rice varieties, 30-day-old seedlings were placed in an artificial climate chamber at 6–8°C (day / night), 12,000 Lux (model GC400 / 230NG, Gavita, China), and 70% relative humidity for 5 consecutive days. The plants were then transferred to room temperature for 3 days of recovery, and their phenotypes were recorded (Table 2).

[0042] All VCF files generated after SV typing of the Illumina data were merged using BCFtools. The VCF files were first indexed and then merged using the parameters "-0 -lvcf_gz_file.list -L 2 -m id -O v". The merged VCF files were converted using PLINK (v2.2.9) with default settings for subsequent analysis. The VCF files were filtered using "--recode 12 --output-missing-genotype 0 -transpose". To investigate the relationship between SVs and phenotypes, a GWAS was performed using a mixed linear model in EMMAX with the parameter "-vd 10", and significant TIP sites were selected based on SVID. Genes near pTEs were obtained from the RAP database for further analysis.

[0043] According to the above method, TIP-GWAS identified a new rice cold-tolerant gene OsPTR ( Figure 3 a, b), the nucleotide sequence is shown in SEQ ID No. 1. The OsPTR gene exhibits significant structural variation among different rice materials, particularly in japonica rice, which contains a 7,734-bp allelic insertion sequence, the nucleotide sequence of which is shown in SEQ ID No. 2. This insertion is composed of three transposon types (DNAnona / Mutator, DNA / Helitron, and DNAauto / Mutator). Further analysis revealed that different alleles exhibited significant differences in survival rate and gene expression levels after cold treatment ( Figure 3 c), in which the accessions without pTE insertion showed lower OsPTR expression levels under cold stress conditions ( Figure 4a). RNA-seq results showed that OsPTR expression was significantly upregulated after 72 hours of cold treatment, suggesting that it may be involved in the later stages of the cold stress response. In addition, the pTE insertion is located in the intron region of OsPTR, which may affect post-transcriptional processing and lead to the generation of different splicing isoforms. Iso-seq data also confirmed that there are differences in transcript structure between different haplotypes ( Figure 4 b) These differences may be due to the influence of pTE insertion, which further affects the expression regulation and function of genes.

[0044] Example 2 Functional verification of the cold-tolerant gene OsPTR

[0045] To verify the biological function of OsPTR, qRT-PCR and RNA-seq analysis revealed that the gene was significantly upregulated under cold stress ( Figure 5 a, b), indicating that it is a cold-responsive gene. Further, OsPTR knockout mutants (OsPTR-KO) and overexpression materials (OsPTR-OE) were constructed in japonica rice varieties as follows:

[0046] (1) Construction of OsPTR knockout mutant (OsPTR-KO)

[0047] Sequencing primers were synthesized based on the OsPTR sequence. Using the sequencing primer 5'-TCCCAGTCACGACGTTGTAA-3', the gRNA target sequences were designed as UP: 5'-TGTGTGCCCCTCGGACCTCTCCTCC; LOW: 5'-AAACGGAGGAGAGGTCCGAGGGGCA. Oligo dimers were prepared by dissolving the synthesized oligo in water to 10 μM. After mixing according to the following reaction system, the oligo was heated at 95°C for 3 minutes, then slowly cooled to 20°C at approximately 0.2°C / second. The oligo dimer was constructed into the CRISPR / Cas vector. The components were mixed on ice according to the following reaction system, mixed thoroughly, and reacted at room temperature (20°C) for 1 hour. Escherichia coli was transformed according to standard procedures for plant genetic transformation. Add 5 μl of the reaction solution to at least 50 μl of competent cells, mix well, and place on ice for 30 minutes (do not shake during this period, and keep it strictly still); gently remove the cells, heat shock them at 42°C for 60 seconds, and immediately place them on ice for 2 minutes; add 500 μl of SOB / LB, and incubate them at 37°C at 200 rpm for 1 hour; spread an appropriate amount of the bacterial solution on an LB plate containing kanamycin and incubate them inverted at 37°C overnight.

[0048] (2) Construction of OsPTR overexpression material (OsPTR-OE)

[0049] First, synthesize the following target gene amplification primer 1: D11221_0S1 primer:

[0050] D11221_0S1(+):AACACGGGGGACTTTGCAACatgagcatgaataatatgatgggtagtccacc,

[0051] D11221_0S1(-):TGAAGACAGAGCTAGTTACActagggatgagaagaagaatgcggtg,

[0052] The target gene sequencing primers were D11221(572C):gatacaagcgtcccggccac, D11221(1144C):caccaccaccagcacacgc.

[0053] Next, perform PCR amplification. Once verified, recombinate with the vector. Purify the vector digest using a PCR purification kit (the purified product is labeled pBWA(V)HS-ccdB(D)) for use in the next in vitro or in vivo recombination reaction. Transform the ligation product into competent cells. Transform 5-10 μL of the ligation product into competent E. coli (see standard methods for competent E. coli transformation) onto a kan-resistant plate, incubate at 37°C for 12 hours, and perform plaque PCR analysis. Pick 10 plaques for simultaneous inoculation and PCR analysis in a 1.5 ml EP tube. Primers: pBWA(V)HS-ccdB identification primer (HS) 35seq: tTCATTTGGAGAGAACACGGGggac (2861 bp) D11226(476C): gccgaacatgagcgcgtt (3503 bp).

[0054] The steps of genetic transformation experiments are as follows:

[0055] 1. Agrobacterium Preparation

[0056] 1.1 Plasmid transformation

[0057] Take 1 μL of plasmid and add it to 50 μL of EHA105 Agrobacterium competent cells, mix thoroughly and then transfer it to an electroporation cup. After electroporation, add 1 mL of LB liquid medium, mix thoroughly and then transfer it to a 1.5 mL centrifuge tube. Incubate on a shaker at 30°C and 180 rpm for 30 minutes. Pipette 50 μL of the activated Agrobacterium liquid and inoculate it on LB solid medium. Incubate in the dark at 30°C for 48 hours.

[0058] 1.2 Agrobacterium detection

[0059] 1.2.1 Synthesize the corresponding detection primers;

[0060] 1.2.2 Prepare the PCR amplification system, mix thoroughly, and perform amplification using a PCR instrument.

[0061] 1.2.3 Gel electrophoresis: Prepare 1% agarose gel (weigh 1.5 g agarose powder and dissolve it in 150 mL 1× TAE buffer. Heat in a microwave oven for about 3 minutes until the liquid becomes transparent. Add EB to the gel plate and pour the dissolved agarose liquid into the gel plate. Mix thoroughly, insert a comb, and let it stand for 40 minutes until the gel turns milky white). Apply the sample and complete the electrophoresis process.

[0062] 1.2.4 Check the PCR amplification results. If the electrophoresis bands of the positive control and sample are clear and of the correct size, and there are no bands in the negative control, it indicates that the sample can proceed to the next step.

[0063] 2. Rice genetic transformation

[0064] 2.1 Induction

[0065] Select rice grains without mold spots and normal buds, disinfect them with 75% alcohol for 1 minute, wash them with sterile water for 1 minute each time; disinfect them with 15% sodium hypochlorite for 20 minutes, wash them with sterile water 3 times for 1 minute each time; the disinfected rice grains are inoculated into induction culture medium and cultured under light at 26℃ for 20 days.

[0066] 2.2 Agrobacterium infection

[0067] Pick up Agrobacterium in the infection solution and prepare OD 600 = 0.2 Agrobacterium resuspension, pick the callus into a triangular flask, add the Agrobacterium resuspension, infect for 10-15 minutes and then discard the bacterial solution. Inoculate the callus into the co-cultivation medium and co-cultivate at 20℃ for 48-72 hours.

[0068] 2.3 Callus screening

[0069] Inoculate the callus from 2.2 into the screening medium and culture it in the dark at 26°C for 20-30 days; inoculate the positive callus into the secondary screening medium. During the callus picking process, be sure to pick a single clone of callus and culture it in the dark at 26°C for 7-10 days;

[0070] 2.4 Differentiation and rooting

[0071] The positive callus was inoculated into differentiation medium and cultured at 25-27℃ for 15-20 days. After the buds of 2-5 cm were differentiated, it was inoculated into rooting medium and cultured at 30℃ for 7-10 days.

[0072] 2.5 Positive seedling detection

[0073] The rice genomic DNA was extracted by CTAB method and PCR detection was performed. The detection method was the same as that of Agrobacterium tumefaciens.

[0074] The transgenic plants obtained by the above method were verified and all were positive plants ( Figure 6At room temperature, there was no significant phenotypic difference between the OsPTR knockout mutant and the overexpression mutant and the wild-type ZH11. However, after 5 days of cold treatment at 4°C, the survival rate of the OsPTR knockout mutant was significantly reduced (only 15%), indicating cold sensitivity. The overexpression material showed stronger cold tolerance at the four-leaf stage ( Figure 5 c, d). The results of ion leakage rate measurement showed that the cell membrane damage of OsPTR knockout mutants was aggravated with the extension of cold treatment time ( Figure 5 e). ROS staining results showed that the OsPTR knockout mutant accumulated more reactive oxygen species and was more severely damaged under cold stress ( Figure 5 f). In summary, OsPTR can enhance the cold tolerance of rice seedlings.

[0075] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. All modifications, equivalent substitutions, improvements, etc. within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of the rice cold-tolerant gene OsPTR in improving the cold tolerance of rice, characterized in that: The nucleotide sequence of the rice cold-tolerant gene OsPTR is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that The application is to improve the cold tolerance of rice by overexpressing the rice cold tolerance gene OsPTR in rice.

3. Application of the rice cold-tolerant gene OsPTR, an expression cassette containing the rice cold-tolerant gene OsPTR, an expression vector, and a recombinant bacterium in improving rice cold-tolerant germplasm resources, characterized in that: The nucleotide sequence of the rice cold-tolerant gene OsPTR is shown in SEQ ID No.

1.

4. Use of the rice cold-tolerant gene OsPTR, an expression cassette containing the rice cold-tolerant gene OsPTR, an expression vector, and a recombinant bacterium in cultivating cold-tolerant rice, characterized in that: The nucleotide sequence of the rice cold-tolerant gene OsPTR is shown in SEQ ID No.

1.

5. A method for improving the cold tolerance of rice, characterized in that: The method is to overexpress the rice cold-tolerant gene OsPTR in rice through transgenic, hybridization, backcrossing, selfing or asexual reproduction to improve the cold tolerance of rice. The nucleotide sequence of the rice cold-tolerant gene OsPTR is shown in SEQ ID No.

1.

6. A transposon of the rice cold-tolerance gene OsPTR, characterized in that: The transposon is located in the intron region of the rice cold-tolerant gene OsPTR, and its nucleotide sequence is shown in SEQ ID NO.

2. The transposon has insertion polymorphism.

7. Use of the transposon according to claim 6 in improving cold-tolerant rice germplasm resources.

8. Use of the transposon according to claim 6 in cultivating cold-tolerant rice.

Images