Method for creating polyploidy fish by knocking out rnf212b gene

Abstract

The invention discloses a method for creating polyploidy fish by knocking out an rnf212b gene, and belongs to the field of animal genetic breeding. An rnf212b gene of zebra fish is edited by using a CRISPR / Cas9 system, rnf212b homozygous knockout individuals are obtained through genotype identification and breeding, and 100% inheritance controllable triploid offspring can be obtained by using the characteristic that rnf212b homozygous knockout diploid female can generate non-reduced ova. According to the invention, more gene editing targets are provided for artificially creating polyploidy fish, the gene editing efficiency is improved, and the sustainable development of the aquaculture industry is accelerated.

Description

Technical Field

[0001] The present invention belongs to the field of animal genetic breeding and relates to a method for creating polyploid fish through gene editing. Background Art

[0002] Polyploid fish have advantages over diploid fish, such as faster growth, larger size, and greater resistance to stress, demonstrating excellent industrial and application value. Furthermore, the sterility of triploid fish can effectively control the germplasm of farmed fish, preventing overbreeding and contamination of natural germplasm resources. Therefore, the development of polyploid fish is of great significance to the sustainable development of aquaculture.

[0003] Artificially creating polyploid fish has always been a research hotspot. Currently, the mainstream methods for creating polyploid fish include artificial induction and distant hybridization. Artificial induction of polyploidy includes temperature shock, hydrostatic pressure treatment, and chemical treatment. Among them, temperature shock and hydrostatic pressure treatment both double the number of chromosomes by inhibiting the formation of spindles, while chemical treatment uses reagents such as colchicine to double the number of chromosomes. Distant hybridization is the hybridization of two fish species from different species. The hybrid offspring have the ability to produce unreduced gametes. Although there are many options for inducing polyploidy, they all have problems such as low polyploidy induction rate, high embryonic deformity rate and low number of surviving fry, which seriously restricts the large-scale production and application of polyploid fish.

[0004] Existing studies have shown that the occurrence of polyploidy is closely related to abnormalities in the early stages of meiosis. RNF212B is a key E3 ubiquitin ligase in the meiotic recombination process. It is involved in regulating the location and number of crossover formation and is crucial for the correct pairing and separation of homologous chromosomes. [1, 2] Through rnf212b Gene editing is expected to artificially induce defects in the prophase of meiosis, thus providing feasibility for creating artificial polyploidy.

[0005] References: RNF212B E3 ligase is essential for crossover designation and maturation during male and female meiosis in the mouse. Proc Natl Acad Sci US A 2024, 121(25): e2320995121. 2. Ito M, Yun Y, Kulkarni DS, Lee S, Sandhu S, Nuñez B, Hu L, Lee K,Lim N, Hirota RM, Prendergast R, Huang C, Huang I, Hunter N. Distinct and interdependent functions of three RING proteins regulate recombination during mammalian meiosis. Proc Natl Acad Sci USA 2025, 122(2): e2412961121. Summary of the Invention The present invention aims to provide a method for rnf212b The method of genetically creating polyploid fish aims to provide more candidate genes and methods for the artificial creation of polyploid fish.

[0006] To achieve the above object, the present invention uses the following technical solutions: A knockout rnf212b The method for genetically creating polyploid fish comprises the following steps: 1) Using CRISPR / Cas9 system to modify wild-type diploid fish rnf212b The gene was edited and the F0 generation of gene knockout mutants of diploid fish were obtained through genotyping identification; 2) The F0 generation knockout mutants were hybridized with wild-type diploid fish, and when sexually mature, the F1 generation knockout heterozygous mutants were obtained by genotyping ( rnf212b + / - ); 3) The sexually mature F1 generation gene knockout heterozygous mutants ( rnf212b + / - ) were self-fertilized, and when sexually mature, F2 generation gene knockout homozygous mutants were obtained through genotyping identification ( rnf212b - / - ); 4) Gene knockout homozygous mutants in female F2 generation ( rnf212b - / - ) were crossed with wild-type diploid males, and when sexually mature, genotyping and ploidy analysis confirmed that the sexually mature offspring were all gene knockout heterozygous mutation triploids ( rnf212b + / - / - ), the surviving offspring of this triploid are only male individuals and are male sterile.

[0007] Among them, the rnf212b The gene knockout method includes the following steps: 1) According to the CRISPR / Cas9 knockout principle, rnf212b Design knockout target sites on the ORF sequence of the gene; 2) In rnf212b Upstream and downstream primers containing the knockout target site are designed on the gene sequence, PCR amplification is performed using cDNA as a template, and gRNA is obtained after in vitro transcription and purification; 3) Using the linearized Cas9 plasmid as a template, Cas9 mRNA was obtained by in vitro transcription and purification; 4) Microinject gRNA and Cas9 mRNA into fertilized eggs of wild-type diploid fish, incubate the fertilized eggs, and test the juvenile fish for gene mutations to obtain F0 generation gene knockout mutants.

[0008] Preferably, the knockout target site sequence is shown as SEQ ID NO: 2.

[0009] Further preferably, the upstream primer sequence is shown as SEQ ID NO: 3, and the downstream primer sequence is shown as SEQ ID NO: 4.

[0010] Preferably, the injection concentration of the gRNA is 100 ng / μL, the injection concentration of the Cas9 mRNA is 100 ng / μL, the injection dose is 2.5 nL, and the injection site is the animal pole.

[0011] The present invention also provides a reagent for creating polyploid fish, the reagent comprising a Cas9 gene editing protein or an expression vector thereof, and a protein that guides the Cas9 gene editing protein to specifically bind to a rnf212b gRNA of the gene or its expression vector.

[0012] The beneficial effects of the present invention are: The present invention is directed to rnf212b By editing the gene using the CRISPR / Cas9 system, genetically controllable triploid zebrafish were successfully obtained. As a vertebrate, zebrafish's genes, developmental mechanisms, and organ systems are highly conserved with those of other fish, making it an extremely important model species for studying gene function in fish. Therefore, the results of gene editing research in zebrafish conducted by the present invention are of great reference value for creating polyploid fish and understanding the gene function of other fish. The present invention provides more gene editing targets for artificially creating polyploid fish, which is conducive to improving gene editing efficiency and accelerating the sustainable development of the aquaculture industry.

[0013] The polyploid fish obtained by the present invention showed significant fertility changes, which indicated that artificial control rnf212b Gene mutations can achieve precise control of fish fertility, which is conducive to avoiding the contamination of natural germplasm resources and is of great significance to ensuring ecological security. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 for rnf212b -Sequencing peak diagram of target site mutation in F0 generation zebrafish.

[0015] Figure 2 for rnf212b -Sequencing peaks of heterozygous mutations in F1 generation zebrafish.

[0016] Figure 3 for rnf212b -Schematic diagram of homozygous mutation sites in F2 generation zebrafish. The knockout target site is located at rnf212b In the third exon region of the gene, the homozygous mutant lacked 5 bases at the knockout target site compared to the wild type.

[0017] Figure 4 This is the sequencing peak diagram of the homozygous mutation site in the rnf212b-F2 generation zebrafish.

[0018] Figure 5 for rnf212b Observation diagram of offspring embryos from mating of homozygous knockout diploid zebrafish females with wild-type males, peak diagram of ploidy detection of offspring and its proportion, and chromosome karyotype of triploid offspring.

[0019] Figure 6 Wild-type zebrafish (WT_ rnf212b+ / + )、 rnf212b Homozygous knockout zebrafish ( rnf212b - / - ), and its triploid offspring ( rnf212b + / - / - ) adult fish appearance and ploidy detection peak diagram.

[0020] Figure 7 Wild-type zebrafish females and rnf212b Observation of offspring embryos from mating of knockout triploid male fish. DETAILED DESCRIPTION

[0021] The technical solutions of the present invention are further described in detail below with reference to specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of protection of the present invention. Various modifications or equivalent substitutions made by those skilled in the art on the basis of the following examples should also be deemed to fall within the scope of protection of the present invention. The experimental methods for which specific conditions are not specified in the following examples are generally implemented according to conventional conditions or reference books such as "Molecular Cloning Laboratory Guide" (NewYork: Cold Spring Harbor Laboratory, 2017), or implemented according to the methods recommended in the operating manual provided by the manufacturer. The materials whose sources are not specified in the examples are all commonly used materials in the field and can be obtained through commercial channels.

[0022] The embodiments involved rnf212b Ploidy detection and chromosome karyotype analysis of knockout zebrafish are both routine operations in the field. The specific methods are as follows: 1. rnf212b Ploidy detection of knockout mutants For analysis rnf212b The ploidy composition of the mutant offspring is determined by using a ploidy analyzer to detect the ploidy of the knockout mutant offspring. The specific process is as follows: 1) Use a clean pipette to transfer the larvae to sterile EP tubes, one per tube. Add 500 μL of 1× PBS buffer (NaCl 137 mM, KCl 2.7 mM, Na₂HPO₄ 4.3 mM, KH₂PO₄ 1.4 mM) to the sample tube. Place the pestle into the EP tube containing the sample and rotate it left and right to thoroughly grind. Place the resulting cell suspension on ice until ready to use. 2) Ploidy determination was performed using the relative cellular DNA content method. Before ploidy determination, ploidy calibration was performed using wild-type juveniles that had reached the same developmental stage. Before loading the sample, 100 μL of DAPI dye was added to the ground cell suspension, the solution was mixed, and staining was performed in the dark for 5 minutes. The sample was loaded onto the ploidy analyzer for detection, and the peak value of the test sample was compared with the peak value of the wild-type sample as a control to determine the ploidy of the test fish.

[0023] To obtain a large population of offspring to serve as parents for polyploid zebrafish, the mutant line was bred multiple times and raised to sexual maturity (3 months of age). Surviving adult fish were subjected to ploidy testing, using the same sample preparation method as for juveniles. The sample type was the caudal fin of an adult fish, and the ploidy calibration sample was the caudal fin of a wild-type adult fish that had grown to sexual maturity. A 0.3 cm clipping of each caudal fin was sufficient for testing.

[0024] 2. Chromosome Karyotype Analysis of Offspring Embryos The specific steps for preparing embryonic chromosomes of mutant offspring and analyzing their karyotype are as follows: 1) When the embryos begin to accumulate eye pigment, select 10-15 embryos as a replicate, and prepare three replicate treatment groups for statistical analysis. Before processing, carefully remove the zygote with a syringe to avoid damaging the embryos. 2) Using a clean pipette, transfer the embryos to a Petri dish containing 0.1% colchicine solution and soak at room temperature for 45 minutes. 3) Use a syringe to remove the colchicine solution from the culture dish and add 0.8% sodium citrate solution to submerge the embryos. Incubate in hypotonic solution for 20 minutes, changing the hypotonic solution once during this period. 4) After hypotonicity, fix the embryos in pre-chilled Carnoy's fixative (methanol: glacial acetic acid = 3:1) for 15 minutes each, for a total of three fixation cycles. 5) After fixation, transfer the embryos to a 2.0 mL EP tube filled with fresh fixative and store at -20°C overnight. 6) The next day, discard the fixative solution in the tube and add 1-2 drops of 50% glacial acetic acid to dissociate the sample. Use a syringe to tear the embryo into a single-cell suspension. Add an appropriate amount of freshly prepared Carnoy's fixative and prepare chromosome sections by drop-slide preparation. The slides are then fire-fixed and allowed to air-dry at room temperature. 7) Wright-Giemsa staining, observation and photography under a microscope, and counting of embryonic chromosome numbers.

[0025] Example 1 Zebrafish rnf212b Gene knockout 1. Design of CRISPR / Cas9 knockout target sites Zebrafish was obtained from the NCBI database (Gene ID: 108179942). rnf212b The nucleic acid sequence of the gene (SEQID NO.1), referring to the basic design principles of target sites, in zebrafish rnf212b The target site is designed in the third exon region of the gene. The knockout target site sequence of the present invention is GAAGCTTGTTCAGACTCGACT (SEQ ID NO. 2). Primers are designed around the knockout target site. rnf212b-F / R amplifies the fragment containing the target site sequence, where the upstream primer rnf212b -F sequence is TATTATTAGTTAGAGAACAAGTGTA (SEQ ID NO.3), downstream primer rnf212b The -R sequence is TGTAGCACTGGTCACGGACT (SEQ ID NO. 4).

[0026] The enzyme-containing PCR premix of Shanghai Yisheng Biotechnology Co., Ltd. was used for rnf212b For PCR amplification of the target gene site fragment, the following reaction system was prepared in a centrifuge tube (total volume 20µL): 2×Hieff® PCR MasterMix 10.0µL; PCR-Grade Water 7.0µL; upstream primer rnf212b -F (10μM) 1.0µL; downstream primer rnf212b -R (10μM) 1.0µL; genomic DNA template 1.0µL.

[0027] The PCR amplification program was set as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 26 s, 35 amplification cycles; and final extension at 72°C for 10 min.

[0028] The amplified product was sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for Sanger sequencing. The obtained amplified product sequence information was compared with the sequence in NCBI, and the results were found to be the same, indicating that the target site was available and the subsequent steps could be continued.

[0029] 2. Preparation of gRNA First, according to the rnf212b The gRNA upstream primer and its matching downstream primer (SEQ ID NO. 3 and SEQ ID NO. 4) of the gene target site sequence were prepared as follows in a sterile PCR tube (total volume 50 μL): PCR-Grade Water 32.0 μL; 10xPCR Bufer 5.0 μL; dNTP Mixture 5.0 μL; rTaq 0.5 μL; upstream primer gRNA-F (10 mmol / L) 2.5 μL; downstream primer gRNA-R (10 mmol / L) 2.5 μL; cDNA template 2.5 μL.

[0030] The PCR amplification reaction conditions were as follows: pre-denaturation at 94°C for 5 min; 30 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 52 s; and a final extension at 72°C for 10 min.

[0031] The amplified gRNA fragments were cleaned and recovered using the AxyPrep PCR Cleanup Kit from AXYGEN. After obtaining the purified gRNA, the gRNA was transcribed in vitro using the T7Kit from Ambion. The specific steps are as follows: 1) Prepare the following reaction system in a sterile EP tube (total volume 20.0 μL): 4.0 μL 2.5 mmol / L NTP; 2.0 μL 10x Reaction Buffer; 5.0 μL Linear Template DNA; 2.0 μL T7 Enzyme Mix; 7.0 μL DEPC H2O. Mix thoroughly and incubate at 37°C in a water bath for 1 hour. 2) Add 1.0 μL of TURBO DNase to the tube and treat in a 37°C water bath for 15 minutes to remove excess DNA template. TM The miRNA Isolation Kit recovers in vitro transcribed gRNA.

[0032] 3. Cas9 mRNA Preparation The pSP6-2sNLS-spCas9 vector was linearized using XbaI digestion (digestion in a 37°C waterbath for at least 4 hours). Agarose gel electrophoresis was performed to confirm complete linearization of the vector. The digested vector was cleaned and recovered using the AXYGEN AxyPrep PCR Cleanup Kit. Cas9 mRNA was then transcribed in vitro using the purified vector as a template. The transcribed product was purified and collected to obtain a Cas9 mRNA solution. After concentration determination, the solution was frozen at -80°C at a concentration of 900 ng / μL until use.

[0033] 4. In vitro microinjection of zebrafish embryos The night before injection, wild-type zebrafish with well-developed glands and distinct secondary sexual characteristics were selected as parents in a 1:2 ratio of male to female. They were placed in a breeding tank separated by a partition and kept in the dark overnight. The next morning, the partition was removed, and light stimulation was applied to encourage the male and female parents to chase and lay eggs. After the parents laid eggs, fertilized eggs were transferred to a microinjection plate using a clean pipette. Microinjection was performed on one-cell fertilized eggs using a microinjector. Before microinjection, Cas9 mRNA and gRNA were mixed to final concentrations of 100 ng / μL and 100 ng / μL, respectively. The injection volume for each fertilization was 2.5 nL, and the injection site was the animal pole of the embryo. After injection, the fertilized eggs were incubated in aerated water at 28°C until the embryos emerged from the membrane.

[0034] 5. F0 generation knockout efficiency detection When the juvenile fish grow to a suitable size, the tail fin is cut, and the tail fin genomic DNA is extracted using the ammonium acetate method. rnf212b -F / R was used for PCR amplification. The PCR amplification system and reaction conditions were the same as in step 1. The amplified products were sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for Sanger sequencing. rnf212b The individuals with double peaks at the knockout target site and the double peaks extending to the end of the sequence are F0 individuals with effective mutations ( Figure 1 ).

[0035] Example 2 Breeding of polyploid zebrafish 1. Screening of positive individuals in the F1 generation After the F0 generation zebrafish with effective mutations develop to sexual maturity, they are mated with wild-type zebrafish to obtain F1 generation embryos. The F1 generation is raised to sexual maturity, the tail fin of the adult fish is cut, and the genomic DNA of the tail fin is extracted by ammonium acetate method as a PCR template. rnf212b -F / R was used for PCR amplification, and the amplified products were sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for Sanger sequencing. rnf212b Double peaks appeared at the target site, which was different from the wild type rnf212b The sequence alignment of the gene showed that the individuals with non-triplicate insertion / deletion mutations were F1 generation individuals. The F1 generation heterozygotes obtained were heterozygous mutant zebrafish with a 5bp deletion. Compared with the wild type, the knockout target site lacked 5 bases of CGACT ( Figure 2 ).

[0036] 2. Screening of F2 homozygotes After the F1 generation heterozygous zebrafish develop to sexual maturity, select the F1 with the same mutation type for self-fertilization to obtain F2 generation embryos. After the F2 generation individuals reach sexual maturity, the genotype test is performed using the same test method as the F1. According to the test results, the individuals with a single peak in the peak graph are wild type or homozygous. By comparing with the wild type in the NCBI database rnf212b Gene sequences were compared to exclude wild-type individuals. The remaining individuals were homozygous F2 generation individuals, i.e., homozygous zebrafish with a 5bp deletion ( Figure 3 and Figure 4 ).

[0037] 3. rnf212b Obtaining heterozygous knockout triploid zebrafish There are male and female individuals in the F2 generation. rnf212b - / - female, rnf212b - / - males) mated with wild-type males and found rnf212b - / -Although males can produce embryos with wild-type females, the offspring are not viable, i.e. rnf212b - / - Male sterility.

[0038] by rnf212b - / - When females and wild-type males are used as parents, a large number of embryos can be obtained after breeding. Figure 5 As shown, the embryonic development process of this breeding combination was intermittently observed at three time points: 24 hpf (hours post fertilization), 48 hpf, and 72 hpf. Some embryos developed relatively quickly, and the surviving normal offspring of this breeding combination were able to grow and develop normally. A flow cytometer was used to detect the ploidy composition of the offspring of this breeding combination, and it was found that the ploidy detection peaks of these surviving normal juveniles all appeared near triploid (100%). At the same time, analysis of the chromosome karyotype of the embryos of this breeding combination revealed that the chromosome number of normal offspring embryos was triploid (3N=75).

[0039] The above findings confirm that rnf212b - / - The female fish's oocytes have an abnormality during the prophase of meiosis, resulting in the formation of unreduced eggs. The triploid offspring generated by the unreduced eggs and the sperm of wild-type male fish can survive normally. The only surviving triploid offspring obtained from this breeding combination are male individuals ( Figure 6 ).

[0040] Further, the male triploid ( rnf212b + / - / - ) were mated with wild-type females and found rnf212b + / - / - Although they can produce embryos with wild-type females, the vast majority of embryos fail to develop normally, and the few that do emerge are unable to survive due to severe deformities. rnf212b + / - / - Male sterility ( Figure 7 ).

Claims

1. A knockout rnf212b A method for genetically creating polyploid fish, characterized in that The following steps are involved: 1) Using CRISPR / Cas9 system to modify wild-type diploid fish rnf212b The gene was edited and the F0 generation of gene knockout mutants of diploid fish were obtained through genotyping identification; 2) The F0 generation knockout mutants are hybridized with wild-type diploid fish, and when sexually mature, the F1 generation knockout heterozygous mutants are obtained by genotyping. rnf212b + / - ; 3) Gene knockout heterozygous mutants of sexually mature F1 generation rnf212b + / - Self-pollination, and when sexually mature, F2 generation gene knockout homozygous mutants were obtained through genotyping identification. rnf212b - / - ; 4) Gene knockout homozygous mutants in female F2 generation rnf212b - / - Cross with wild-type diploid males, and when sexually mature, confirm through genotyping and ploidy analysis that the sexually mature offspring are all gene knockout heterozygous mutation triploids. rnf212b + / - / - The surviving offspring of this triploid are only male individuals and are male sterile.

2. The method for producing polyploid fish according to claim 1, wherein: described rnf212b The gene knockout method includes the following steps: 1) According to the CRISPR / Cas9 knockout principle, rnf212b Design knockout target sites on the ORF sequence of the gene; 2) In rnf212b Upstream and downstream primers containing the knockout target site are designed on the gene sequence, PCR amplification is performed using cDNA as a template, and gRNA is obtained after in vitro transcription and purification; 3) Using the linearized Cas9 plasmid as a template, Cas9 mRNA was obtained by in vitro transcription and purification; 4) Microinject gRNA and Cas9 mRNA into fertilized eggs of wild-type diploid fish, incubate the fertilized eggs, and test the juvenile fish for gene mutations to obtain F0 generation gene knockout mutants.

3. The method for producing polyploid fish according to claim 2, wherein: The knockout target site sequence is shown in SEQ ID NO:

2.

4. The method for producing polyploid fish according to claim 2, wherein: The upstream primer sequence is shown in SEQ ID NO: 3, and the downstream primer sequence is shown in SEQ ID NO:

4.

5. The method for producing polyploid fish according to claim 2, wherein: The injection concentration of the gRNA was 100 ng / μL, the injection concentration of the Cas9 mRNA was 100 ng / μL, the injection dose was 2.5 nL, and the injection site was the animal pole.

6. A reagent for creating polyploid fish, characterized in that: The reagent includes: Cas9 gene editing protein or its expression vector, and a vector that guides the Cas9 gene editing protein to specifically bind rnf212b gRNA of the gene or its expression vector.

Images