Application of primers, probes or kits targeting the effector protein HCP gene of T6SS of Citrobacter freundii

By designing specific primers and probes targeting the hcp gene of the T6SS effector protein of Citrobacter freundii, and combining RPA and LFD technologies, the problems of high equipment dependence, complex operation and high cost in existing technologies have been solved, and rapid, simple and highly specific detection of Citrobacter freundii in Procambarus clarkii has been achieved.

CN120738375BActive Publication Date: 2025-11-21HUNAN AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511220668.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-29
Publication Date
2025-11-21
Estimated Expiration
2045-08-29

AI Technical Summary

Technical Problem

Existing technologies for detecting Citrobacter freundii, a pathogen in Procambarus clarkii, suffer from problems such as high equipment dependence, complex operation, long detection time, insufficient specificity, and high cost, making it difficult to meet the needs of aquaculture farms for rapid, convenient, and economical testing.

Method used

We designed specific primers and probes targeting the hcp gene of the T6SS effector protein in Citrobacter freundii, and combined them with recombinase polymerase amplification (RPA) and lateral flow immunochromatographic strip (LFD) technologies to achieve a rapid and convenient detection solution.

Benefits of technology

It enables rapid detection of Citrobacter freundii at room temperature, with short reaction time, low equipment cost, and simple operation, making it suitable for on-site testing in farms. It significantly improves the specificity and sensitivity of the detection while reducing equipment and reagent costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120738375B_ABST
    Figure CN120738375B_ABST
Patent Text Reader

Abstract

The application relates to the technical field of biological detection, and particularly relates to the application of a primer, a probe or a kit targeting an effector proteinhcp gene of a T6SS of Citrobacter freundii, wherein the application first designs specific primers (SEQ ID NO: 1-2) and a probe (SEQ ID NO: 3) aiming at thehcp gene of the effector protein of the T6SS of the Citrobacter freundii, the target gene of the application has higher pathogenicity correlation, and the detection specificity is significantly improved. The application combines recombinase polymerase amplification (RPA) with a lateral flow immunochromatographic test strip (LFD), and realizes integration of "amplification-detection". The method only needs one pair of primers, and amplification can be completed at normal temperature (38 DEG C) for 20-30 minutes; combined with the LFD test strip, the result can be judged by naked eyes for 3-5 minutes, and no precise instrument is needed in the whole process, and the detection result is objective and reliable.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biodetection technology, specifically to the application of primers, probes, or kits targeting the hcp gene of the T6SS effector protein of Citrobacter freundii. Background Technology

[0002] The red swamp crayfish (Procambarus clarkii), as an important aquaculture species, is widely favored by farmers and consumers at home and abroad for its delicious meat, rich nutrition, and abundant unsaturated fatty acids, protein, free amino acids, vitamins, trace elements, etc. in its roe. It also has high medicinal value and is a major economic shrimp species in my country.

[0003] The HCP gene serves as a structural protein of T6SS: In bacteria possessing T6SS, HCP is a core component of T6SS, capable of forming hexammeric tubular structures. Homologous to phage tail proteins, it is a key component of the T6SS secretory apparatus. HCP also acts as a chaperone protein for effector proteins: HCP can act as a chaperone for effector proteins, assisting in their folding and transport. In some bacteria, HCP interacts with effector proteins, delivering them into host cells, thereby regulating the bacterial-host interaction. Furthermore, it participates in the regulation of bacterial virulence: In some bacteria, the deletion of the HCP gene leads to a significant reduction in bacterial virulence, indicating that this gene plays an important role in bacterial pathogenicity. Studies have found that decreased hcp gene expression levels lead to a decline in bacterial biofilm formation ability, resulting in reduced bacterial pathogenicity; studies have also found that hcp gene deletion significantly reduces motility (P < 0.01) and antiserum bactericidal ability (P < 0.05).

[0004] In recent years, frequent outbreaks of bacterial diseases in the farming of red swamp crayfish have caused huge losses to the industry. Among these bacterial pathogens, Citrobacter freundii is an important pathogen. After crayfish are infected with Citrobacter freundii, they will exhibit sluggish activity, weak claws, reduced or stopped feeding, blackening of the body surface, and pale color of the hepatopancreas and lack of food in the intestines during dissection. It will also seriously affect the quality of the crayfish meat and food safety.

[0005] In recent years, the field of molecular biology has witnessed significant technological leaps, with techniques such as reverse transcription (RT)-PCR, nested PCR, real-time quantitative PCR (qPCR), reverse transcription real-time quantitative PCR (RT-qPCR), and reverse transcription droplet digital PCR (RT-ddPCR) all reaching a highly mature stage. Studies have found that RT-PCR can be used to identify *Citrobacter freundii* strains resistant to class A β-lactamases, carbapenemases, and plasmids and colistin; MALDI-TOF mass spectrometry and automated microbial identification systems based on biochemical methods can identify *Citrobacter freundii* from California bass; multiplex PCR can be used to screen for *Citrobacter freundii*; and reverse transcription quantitative PCR has demonstrated the presence of Enterobacteriaceae in Japanese adults. However, the widespread application of these technologies is limited by multiple factors: they require not only specialized and sophisticated equipment but also highly skilled technicians; the high cost of thermal cyclers and reagents also hinders their widespread use, especially in environments outside the laboratory.

[0006] Furthermore, molecular detection techniques for this pathogen largely rely on universal genes such as 16S rRNA and gyrB, or well-known virulence genes such as OMPA, OMPX, ureD, and cfa. Existing technology CN117025802A discloses an RPA primer combination for detecting *Citrobacter freundii* in sturgeon. This primer design utilizes the *Citrobacter freundii* colonization factor cfa gene as a template, enabling visual detection of *Citrobacter freundii* within 30 minutes. However, currently, this gene is mostly used to detect *Citrobacter freundii* in other species (such as sturgeon, Chinese mitten crab, Chinese soft-shelled turtle, and swimming crab). The cfa gene is used to detect *Citrobacter freundii* pathogen in swimming crab; in Chinese soft-shelled turtle; and in Chinese mitten crab to detect virulence-related genes. Meanwhile, this technology lacks specificity experiments for closely related species of *Citrobacter freundii*. Existing technology CN118006814A discloses a primer combination and kit for LAMP detection of *Citrobacter freundii*, which uses the OMPA gene of *Citrobacter freundii* as a template to design primers for visual LAMP detection. However, this LAMP technology requires complex experimental conditions, necessitates a large number of primer pairs, is complex to design, and has a high failure rate. It also requires a long reaction time, needing a constant temperature device to maintain the reaction at 60-65℃ for 30-60 minutes. Furthermore, this experiment uses ion indicators for result observation, which is susceptible to subjective factors and lacks precise judgment criteria.

[0007] Compared with the existing technologies, this invention utilizes the HCP gene of Citrobacter freundii T6SS effector protein for primer design, and is innovative in gene selection. The detection method used in this invention is recombinase polymerase amplification combined with lateral flow chromatography (LFD) test strip technology, which features simple primer design (usually only one pair of primers and probes is needed), low failure rate, and short reaction time. At the same time, this invention combines lateral flow chromatography (LFD) test strip technology to rapidly detect amplification products within 3 to 5 minutes, and the results can be observed with the naked eye. It is easy to operate and suitable for rapid on-site detection. Summary of the Invention

[0008] This invention aims to address the problems existing in the prior art by developing specialized primers and probes for detecting the hcp gene of the T6SS effector protein in Citrobacter freundii, as well as an innovative kit combining recombinase polymerase amplification (RPA) technology with a lateral flow device (LFD) test strip, to achieve a more efficient and accurate detection solution.

[0009] To achieve the above-mentioned objectives, the present invention employs the following technical solution:

[0010] An RPA primer combination for rapid detection of the T6SS effector protein hcp gene of Citrobacter freundii includes an upstream primer containing the nucleotide sequence shown in SEQ ID NO:1 and a downstream primer containing the nucleotide sequence shown in SEQ ID NO:2, wherein the 5' end of the downstream primer is labeled with biotin.

[0011] The sequence of the upstream primer is:

[0012] SEQ ID NO:1:

[0013] 5'-TCCGGATAGCCGTGTGCTGGCAGCATTTCACCGT-3';

[0014] The sequence of the downstream primer is:

[0015] SEQ ID NO:2:

[0016] 5'-Biotin-AATCGGCCAGATGAACTTCAAAGTGATGAGC-3';

[0017] The probe sequence is shown in SEQ ID NO:3; and the 5' end is labeled with carboxyfluorescein FAM, the 3' end has an extension blocking group C3 Spacer added, and a tetrahydrofuran is added between the 30th and 31st bases. The probe sequence is as follows:

[0018] SEQ ID NO:3:

[0019] [5'FAM]-TCCGGATAGCCGTGTGCTGGCAGCATTTCA[THF]CCGTGGGTATAAACGT-[3'C3spacer]

[0020] The above-mentioned RPA-specific primer-probe combination was designed based on the HCP gene, a key effector protein of Citrobacter freundii T6SS. Its target gene sequence is as follows:

[0021] atgatgcagttagaagtcatcacgattgggccagggaagcgggcgaattcaacctgctggttctgccagccgctgccgtagttaccgattaggtgtttgaacttacgcagttccggatagccgtgtg ctggcagcatttcaccgtgggtataaacgttaacaccggtgccttcagtctgctcaagcaggttgtagagatctttcaggtcgtgaccggagatcaggatgcacttaccttcggttgcttttacgtt gacctgagtcggggtcgggtgaccgtatttagtggtttcaccggcgtccagaatgctcatcactttgaagttcatctggccgatttccattgaacactccagcagagcgttcatatcggaaggccag gtacccagccacgccatgattttgtggtactgagcatagatatcgttgtcgtactgaccaagaacgtgggcgtgctccatgtaagctgccgcacctttcaggccgtacagacacagcagacgca (seq ID NO:4);

[0022] The primer combination and probes described above can be used to prepare a kit for on-site detection of Citrobacter freundii in Procambarus clarkii.

[0023] The present invention provides an RPA-LFD kit for rapid detection of Citrobacter freundii, comprising at least one of the following reagents: the above-described RPA primer combination or RPA probe.

[0024] In addition to the primer-probe combination described above, the test strip also includes at least one of the following reagents: RPA amplification reagent and lateral flow chromatography test strip. The lateral flow chromatography test strip is preferably a colloidal gold test strip or a rainbow-type test strip.

[0025] Furthermore, the RPA-LFD kit also includes a positive control and a negative control.

[0026] Furthermore, the positive control was the genomic DNA of *Citrobacter freundii* from *Procambarus clarkii*, and the negative control was sterilized ddH2O.

[0027] Furthermore, the RPA-LFD kit also includes a nucleic acid release agent, a recombinase that binds to single-stranded nucleic acids, a single-stranded DNA binding protein, a strand displacement DNA polymerase, a reaction system buffer, and magnesium acetate.

[0028] This invention also provides a method for detecting Citrobacter freundii based on RPA-LFD, comprising the following steps:

[0029] (1) Extract total DNA from the sample to be tested.

[0030] (2) Using the total DNA of the sample to be tested as a template, amplification was performed using the above-mentioned RPA primer-probe combination and recombinase polymerase;

[0031] (3) Add the amplified product onto the colloidal gold test strip and observe the detection line and control line.

[0032] Furthermore, the amplified product can be diluted and then loaded onto colloidal gold test strips.

[0033] Generally, the control line and test line are recorded within 5-10 minutes, and the test results are determined (interpreted).

[0034] If the control line is visible but the test line is not, this is a negative result; that is, it means that the analyte corresponding to the DNA template does not contain Citrobacter freundii.

[0035] If both the test line and the control line are visible, this is a positive result; that is, it indicates that the analyte corresponding to the DNA template contains Citrobacter freundii.

[0036] If neither the detection line nor the control line is visible, the result is invalid.

[0037] Preferably, the amplification conditions in step (2) are a reaction at 33-42℃ for 10-60 min. More preferably, the reaction is carried out at 37-42℃ for 20-40 min. More preferably, the reaction is carried out at 39℃ for 25-30 min.

[0038] This invention employs a method combining RPA with lateral flow immunochromatographic test strips. The reaction principle involves a specific probe labeled with carboxyfluorescein (FAM) binding with a primer labeled with biotin to form a double-labeled nucleic acid amplification product. When the sample end of the test strip is immersed in the amplification product, it binds to a colloidal gold-labeled anti-FAM antibody, forming a ternary complex. Upon diffusion to the detection line, the ternary complex is captured by the biotin ligand, forming a colored detection line. This method offers advantages such as visually interpretable results, convenient detection, a reaction time within 10 minutes, and portability.

[0039] Compared with the prior art, the present invention has the following beneficial effects:

[0040] (1) Innovative breakthrough in target gene. For the first time, specific primers (SEQ ID NO:1-2) and probes (SEQ ID NO:3) were designed for the hcp gene (C-terminal functional domain, nucleotide sites 450-600) of the T6SS effector protein of Citrobacter freundii. As a core component of T6SS, the hcp gene directly participates in bacterial virulence regulation and host interaction. Compared with existing technologies that rely on universal genes such as 16S rRNA and gyrB or common virulence genes such as cfa and OMPA, the target gene of this invention has higher pathogenicity relevance and significantly improves detection specificity. Through multiple sequence alignment (hcp genes of 7 closely related strains such as CP140972.1 in GenBank), the intraspecific conservation and interspecific differences of the primers and probes were verified, effectively avoiding cross-reaction with common aquatic pathogens such as Aeromonas versicolor and Aeromonas hydrophila, and solving the deficiency of insufficient specificity in existing technologies.

[0041] (2) Recombinant polymerase amplification (RPA) is combined with lateral flow immunochromatographic strips (LFD) to achieve integrated amplification and detection. Compared to LAMP technology, which requires temperature control equipment (60-65℃) and complex primer design (4-6 pairs of primers), this method only requires one pair of primers. Amplification can be completed in 20-30 minutes at room temperature (38℃), and the results can be visually interpreted in 3-5 minutes using the LFD strip. No sophisticated instruments (such as a real-time PCR instrument) are required throughout the process. Compared to LAMP methods based on ion indicators in similar studies (which have strong subjectivity in result interpretation), this technology uses the specific binding of FAM-biotin dual-labeled probes and colloidal gold antibodies to provide objective and reliable detection results.

[0042] (3) The RPA kit for detecting Citrobacter freundii in Procambarus clarkii of this invention is fast, easy to operate, sensitive, and time-saving. The RPA amplification process only requires a constant temperature of 38°C and a reaction time of 10-30 minutes. The color development of the test strip can be directly observed with the naked eye. If both the test line and the control line are colored, it can be qualitatively determined that Procambarus clarkii is positive for Citrobacter freundii. This time is much shorter than that of PCR. The equipment cost is lower than that of traditional PCR or real-time PCR, so it can be used for on-site testing in aquaculture sites, and can quickly, easily, and specifically detect Citrobacter freundii in Procambarus clarkii.

[0043] (4) Eliminating the reliance on expensive equipment such as thermal cyclers and fluorescence detectors, the reagent cost is reduced by more than 60%, and the operation steps are simplified to "one-step amplification - test strip interpretation", which can be completed by non-professionals after simple training. Compared with traditional molecular detection technology (equipment cost > 50,000 yuan), this kit can achieve "hundred-yuan-level single detection", providing an economical and feasible solution for small and medium-sized aquaculture farmers and helping to carry out large-scale monitoring and precise prevention and control of aquatic diseases. Attached Figure Description

[0044] Figure 1 The effect of different reaction temperatures on RPA-LFD amplification is shown in the figure. N is the negative control, and 25℃, 30℃, 35℃, 38℃, 40℃, and 45℃ represent the experimental groups with reaction temperatures of 25℃, 30℃, 35℃, 38℃, 40℃, and 45℃, respectively.

[0045] Figure 2 To illustrate the effect of different reaction times on RPA-LFD amplification, N in the figure represents the negative control, and 1-6 represent the experimental groups at 10 min, 15 min, 20 min, 25 min, 30 min, and 40 min, respectively.

[0046] Figure 3 The results of RPA-LFD detection of different concentrations of Citrobacter freundii are shown in the figure. N is the negative control, and 10ng, 1ng, 100pg, 10pg, and 1pg represent the experimental groups with concentrations of 10ng / μL, 1ng / μL, 100pg / μL, 10pg / μL, and 1pg / μL, respectively.

[0047] Figure 4 The results of amplification of different concentrations of Citrobacter freundii genomic DNA using conventional PCR primers are shown. M represents DL2000, and N represents the negative control. 10ng, 1ng, 100pg, 10pg, 1pg, 100fg, 10fg, and 1fg represent experimental groups with concentrations of 10ng / μL, 1ng / μL, 100pg / μL, 10pg / μL, 1pg / μL, 100fg / μL, 10fg / μL, and 1fg / μL, respectively.

[0048] Figure 5 The figure shows the detection results of RPA-LFD on different concentrations of Citrobacter freundii. N is the negative control; 1-8 represent concentrations of 10 CFU / ml, 10 CFU / ml, and 10 CFU / ml, respectively. 2 cfu / ml, 10 3 cfu / ml, 10 4 cfu / ml, 10 5 cfu / ml, 10 6 cfu / ml, 10 7 cfu / ml and 10 8 The experimental group was cfu / ml.

[0049] Figure 6 The results of PCR detection of different concentrations of Citrobacter freundii are shown. M represents DL2000, N represents the negative control, and 10 8 10 7 10 6 10 5 10 4 10 3 10 2 10 and 10 represent a concentration of 10 8 cfu / ml, 10 7 cfu / ml, 10 6 cfu / ml, 10 5 cfu / ml, 10 4 cfu / ml, 10 3 cfu / ml, 10 2 The experimental groups were 10 cfu / ml and 10 cfu / ml.

[0050] Figure 7 The results show the specificity of *Citrobacter freundii*. The specificity of *Citrobacter freundii* was detected by RPA-LFD. N is the negative control; 1 is *Aeromonas verrucosa*; 2 is *Aeromonas hydrophila*; 3 is *Acinetobacter johnsonii*; 4 is *Lactococcus gasseri*; 5 is *Illicium mirabilis*; 6 is *Aeromonas salmonicida*; 7 is *Citrobacter bromide*; 8 is *Citrobacter freundii*.

[0051] Figure 8 The results of clinical sample testing for RPA-LFD are shown in Figures 1-2, which are tissue DNA extracted from the hepatopancreas and gill filaments of healthy red swamp crayfish No. 1, respectively; and Figures 3-4 are tissue DNA extracted from the hepatopancreas and gill filaments of diseased red swamp crayfish, respectively.

[0052] Figure 9The results are from clinical PCR tests. M represents DL2000. 1-2 are the hepatopancreas and gill filament tissues of healthy red swamp crayfish No. 1, respectively; 3-4 are the hepatopancreas and gill filament tissues of healthy red swamp crayfish No. 2, respectively; 5-6 are the hepatopancreas and gill filament tissues of diseased red swamp crayfish No. 1, respectively; 7-8 are the hepatopancreas and gill filament tissues of diseased red swamp crayfish No. 2, respectively. Detailed Implementation

[0053] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods.

[0054] The pathogens and reagents used in the following experimental examples are as follows:

[0055] (1) Test pathogens: Citrobacter freundii; Citrobacter braakii; Aeromonas hydrophila; Lactococcus lactis; Acinetobacter johnsonii; Aeromonas veronii; Elizabethkingia miricola; Aeromonas salmonicida. The above pathogens were provided by Professor Wang Xiaoqing's research group of the College of Fisheries, Hunan Agricultural University.

[0056] (2) Reagents: The DNA Rapid Amplification Kit (Basic Type WLB8201 KIT) and Rainbow Lateral Flow Test Strips (LFD) were purchased from Weifang Anpu Future Biotechnology Co., Ltd., China; the Micro Sample Genomic DNA Extraction Kit DP316 and the Bacterial Genomic DNA Extraction Kit (DP302-02) were purchased from Aikerui Biotechnology Co., Ltd., and Premix Taq. TM (ExTaq™ Version 2.0) was purchased from Takara.

[0057] Example 1: Effect of different RPA reaction conditions on RPA-LFD amplification of Citrobacter freundii in red swamp crayfish.

[0058] (1) Extraction of bacterial genomic DNA

[0059] Extraction method of the kit: Take 1 mL of the activated strain into a 1.5 mL centrifuge tube, extract genomic DNA according to the instructions, measure the purity and concentration of DNA with Nanodrop2000, and store the obtained DNA at -20℃.

[0060] (2) Primer and probe design

[0061] The invention designs primers and probes based on the hcp gene of the T6SS effector protein of *Citrobacter freundii*. Simultaneously, by comparing and analyzing the nucleic acid sequences of the HCP gene from GenBank (CP140972.1, CP056314.1, CP033744.1, CP167050.1, CP099128.1, CP071834.1, and CP038656.1), the C-terminal functional domain of the *Citrobacter freundii* HCP gene in *Procambarus clarkii* was further clarified. Primers were designed using Primer Premier 6.0 software, based on the conserved region of the *Citrobacter freundii* HCP gene, with primer size set to 30-35 bp, product size set to 100-500 bp, and GC content set to 20-80%. The probe design was based on optimal upstream and downstream RPA primers between suitable target sequences. The probe length was at least 46 nt, with a FAM label at the 5' end, a C3 spacer at the 3' end, and a THF base substitution in the middle of the probe, with the THF site located at least 30 nt before and 15 nt after. All primers and probes were synthesized by Shanghai Sangon Biotech Co., Ltd. The primer sequences are as follows:

[0062] SEQ ID NO: 1: 5'-TCCGGATAGCCGTGTGCTGGCAGCATTTCACCGT-3';

[0063] SEQ ID NO:2:

[0064] 5'-Biotin-AATCGGCCAGATGAACTTCAAAGTGATGAGC-3';

[0065] SEQ ID NO:3:

[0066] [5'FAM]-TCCGGATAGCCGTGTGCTGGCAGCATTTCA[THF]CCGTGGGTATAAACGT-[3'C3spacer]

[0067] The specific conserved sequence of the *Citrobacter freundii* T6SS effector protein hcp gene described in this embodiment is as follows:

[0068] SEQ ID NO:4:

[0069] Atgatgcagttagaagtcatcacgattgggccagggaagcgggcgaattcaacctgctggttctgccagccgctgccgtagttaccgattaggtgtttgaacttacgcagttccggatagccgtgt gctggcagcatttcaccgtgggtataaacgttaacaccggtgccttcagtctgctcaagcaggttgtagagatctttcaggtcgtgaccggagatcaggatgcacttaccttcggttgcttttacgt tgacctgagtcggggtcgggtgaccgtatttagtggtttcaccggcgtccagaatgctcatcactttgaagttcatctggccgatttccattgaacactccagcagagcgttcatatcggaaggcc aggtacccagccacgccatgattttgtggtactgagcatagatatcgttgtcgtactgaccaagaacgtgggcgtgctccatgtaagctgccgcacctttcaggccgtacagacacagcagacgca.

[0070] (3) Preparation of RPA reaction system

[0071] DNA extracted from *Procambarus clarkii* was used as a template for amplification experiments. The basic RPA amplification reaction was performed according to the following composition and ratio: 2 μL upstream primer (10 μM), 2 μL downstream primer (10 μM), 29.4 μL reaction buffer A, 2 μL DNA, and 12.1 μL ddH₂O, for a total volume of 47.5 μL. After thorough mixing, this mixture was added to a reaction tube containing lyophilized enzyme powder and slowly pipetted several times to mix. Finally, 2.5 μL of reaction buffer B was added to initiate the reaction. After thorough mixing, the tube was centrifuged at low speed and immediately placed in a 38°C incubator for 30 min. After the reaction, an equal volume of phenol-chloroform was added to purify the RPA. Finally, the above solution was mixed and centrifuged at 12000 rpm for 3 min. The supernatant was the obtained RPA product, which could be visualized by 1.5% agarose gel electrophoresis. A negative control was set up using water as a template.

[0072] (4) PCR was performed using a 25 μL reaction system, specifically: 1 μL Primer F, 1 μL Primer R, 9.5 μL ddH2O, 1 μL DNA, and 12.5 μL Premix Taq. TM (Ex Taq TM Version 2.0). The amplification program was 94℃ for 3 min pre-denaturation, 94℃ for 30 s denaturation, 55℃ for 30 s annealing, 72℃ for 30 s extension, for 30 cycles.

[0073] (5) Reaction temperature

[0074] The genomic DNA of *Citrobacter freundii* extracted from *Procambarus clarkii* in Example 1 was amplified by RPA-LFD using the primers and probes described above. The reaction temperatures were set to 25℃, 30℃, 35℃, 38℃, 40℃, and 45℃, with N as the negative control; the reaction time was 30 min. The results are shown below. Figure 1 As shown, a weak band appears on the test strip at 30℃, a relatively clear band appears at 25℃, and a distinct band appears between 35-40℃. However, compared to 35℃, the test strip's color is darker at 38℃-40℃. These results indicate that the optimal reaction temperature for this experiment is 38℃-40℃, and we selected 38℃ as the optimal reaction temperature for our subsequent experiments.

[0075] (6) Reaction time

[0076] The genomic DNA of *Citrobacter freundii* extracted from *Procambarus clarkii* in Example 1 was amplified by RPA-LFD using the primers and probes described above. The reaction times were set to 10 min, 15 min, 20 min, 25 min, 30 min, and 40 min, respectively. The detection results are shown below. Figure 2 As shown, the longer the reaction time, the more obvious the test strip's detection line becomes. Results can be observed after 20 minutes of reaction, and the detection line is quite obvious after 25 minutes. However, the best results are achieved at reaction times of 25 minutes and 30 minutes. Based on the stability of the reaction, we selected 25 minutes as the optimal reaction time for subsequent experiments.

[0077] Example 2: Sensitivity detection of Citrobacter freundii RPA-LFD in Procambarus clarkii

[0078] (1) Sensitivity detection using genomic DNA

[0079] The concentration of extracted *Citrobacter freundii* genomic DNA from *Procambarus clarkii* was measured using a Nanodrop-2000 spectrophotometer and diluted to 10 ng / μl. The 10 ng / μl *Citrobacter freundii* genomic DNA was serially diluted tenfold, and eight concentrations ranging from 10 ng / μl to 1 fg / μl were selected as templates. RPA-LFD amplification was performed using the aforementioned primer and probe combination at 38℃ for 25 min. No template was added to the negative control; the template volume was made up with water. The minimum detection concentration of RPA-LFD was determined, and sensitivity analysis was performed. The results were compared with those of PCR.

[0080] The nucleotide sequences of the primer pairs used in the PCR method are shown below.

[0081] Upstream primer: 5'-CGTGGGTATAAACGTTAACAC-3' (SEQ ID NO:5);

[0082] Downstream primer: 5'-CCTGGCCTTCCGATATGAAC-3' (SEQ ID NO:6);

[0083] The amplification conditions were: 94℃ pre-denaturation for 10 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles; and 72℃ extension for 10 min.

[0084] Test results as follows Figures 3-4 As shown, the lowest detection concentrations for RPA-LFD and PCR amplification of different concentrations of Citrobacter freundii genomic DNA using the selected optimal primers were 100 pg / μL and 1 ng / μL, respectively. The results indicate that the RPA-LFD method has the highest sensitivity and is the fastest.

[0085] (2) Sensitivity detection using pure bacterial culture concentration

[0086] Citrobacter freundii was inoculated into BHI broth and cultured to the logarithmic growth phase. The bacterial concentration was determined to be 2.3 × 10⁻⁶ using the plate count method. 9 The concentration was initially determined to be cfu / mL, and then serially diluted tenfold to obtain a concentration of 10. 8 CFU / mL ~10 1 CFU / mL pure bacterial cultures were prepared, corresponding to serial numbers 8-1. 1 mL of different concentrations of *Citrobacter freundii* pure bacterial cultures were placed in clean centrifuge tubes, and DNA was extracted using a DNA extraction kit. 1 μL of the extracted DNA was used for RPA-LFD detection, and the results were compared with those obtained by PCR. The detection results are as follows: Figures 5-6 As shown, Figure 5The results of the RPA-LFD assay show that the pure bacterial suspension of *Citrobacter freundii* showed no reaction at sequence number 2, indicating that the minimum bacterial suspension sensitivity of the RPA-LFD method is 2.3 × 10⁻⁶. 3 CFU / mL. Figure 6 The results of the PCR test indicate that the PCR method can only detect 2.3 × 10⁻⁶. 6 CFU / mL of Citrobacter freundii. The results showed that the RPA-LFD method was 1000 times more sensitive than the PCR method in detecting pure Citrobacter freundii culture.

[0087] Example 3: Specificity detection of Citrobacter freundii RPA-LFD in Procambarus clarkii

[0088] RPA-LFD amplification was performed using genomic DNA from *Citrobacter freundii*, *Aeromonas hydrophila*, *Lactococcus gasseri*, *Elizabeth Miltiorrhiza*, *Aeromonas vernalis*, *Acinetobacter johnsonii*, *Aeromonas salmonicida*, and *Citrobacter baumannii* as templates. The negative control did not include a template and was replaced with ddH2O. Results are as follows: Figure 7 As shown, the RPA-LFD method only showed good amplification of Citrobacter freundii and no cross-reaction with other bacteria, indicating that this method has strong specificity for detecting Citrobacter freundii in Procambarus clarkii.

[0089] Example 4: Detection of clinical samples by *Citrobacter freundii* RPA-LFD in *Procambarus clarkii*.

[0090] Tissue DNA was extracted from the hepatopancreas and gill filaments of healthy *Procambarus clarkii* infected with *Citrus freundii* using a micro-sample genomic DNA extraction kit. This DNA was then used as a template for RPA-LFD detection, and parallel PCR experiments were performed using standard PCR primers. The results of the sample detection are as follows: Figures 8-9 As shown, Figure 8 The results of RPA-LFD detection are as follows: Results 1-2 indicate red swamp crayfish without *Citrobacter freundii*, and results 3-4 indicate red swamp crayfish with *Citrobacter freundii*. PCR detection was performed on their DNA nucleic acid templates, and the results are as follows. Figure 9 In the figure, there are no bands in 1-4, and the target bands are present in 5-8, which is consistent with the RPA-LFD detection results. This indicates that the RPA-LFD detection method established in this study can effectively detect Citrobacter freundii in diseased Procambarus clarkii.

[0091] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for detecting Citrobacter freundii in Procambarus clarkii, characterized in that, The method is for non-diagnostic purposes and includes the following steps: (1) Extract nucleic acid samples from the object to be tested; (2) RPA-LFD detection was performed using primers and probes targeting the hcp gene of the T6SS effector protein of Citrobacter freundii; The primers are shown in SEQ ID NO:1-SEQ ID NO:2; the probe is shown in SEQ ID NO:3, and the 5' end of the probe is modified with FAM, the 3' end of the probe is modified with c3spacer, and the interior of the probe is modified with THF.

Citation Information

Patent Citations

  • PCR (polymerase chain reaction) rapid detection kit and detection method for quasipaa boulengeri infected citrobacter freundii

    CN105734163A

  • RPA primer combination, probe and kit for detecting citrobacter freundii of sturgeon and application of RPA primer combination, probe and kit

    CN117025802A