Application of eicosenoic acid in prevention and / or treatment of BmNPV infection

By using drugs and feed additives prepared from eicosenoic acid and guarana extracts, the treatment problem of blood-type purulent disease in silkworms was solved, and effective inhibition of BmNPV and improvement of silkworm survival rate were achieved.

CN120754080APending Publication Date: 2025-10-10JIANGSU UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511226853.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-29
Publication Date
2025-10-10

AI Technical Summary

Technical Problem

There is currently a lack of effective drugs for the treatment of Bombyx mori blood-borne pus disease (BmNPV infection), and existing preventive measures are unlikely to have a significant therapeutic effect after infection.

Method used

Eicosenoic acid and guarana extract are used as main components and are used to prepare medicines, pharmaceutical compositions or feed additives at concentrations of 1-10 μM and 1-20 μM respectively for preventing and treating BmNPV infection.

Benefits of technology

Eicosenoic acid and guarana extracts can significantly inhibit the replication and gene transcription of BmNPV, improve the survival rate of silkworms, and have significant therapeutic and preventive effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120754080A_ABST
    Figure CN120754080A_ABST
Patent Text Reader

Abstract

The invention discloses an application of eicosenoic acid in prevention and / or treatment of BmNPV infection. The eicosenoic acid is taken as a main effective component and can be used for preparing the medicine for preventing and treating the bombyx mori pyohematosis. When the final use concentration of eicosenoic acid is 10 mu M, replication of the BmNPV can be remarkably inhibited, replication of the BmNPV can be continuously inhibited after cell infection of the BmNPV is completed, and the eicosenoic acid has a treatment effect. The invention can be used for research, development and production of medicines for preventing and treating silkworm blood pyosis, and has application and popularization values.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to application of eicosenoic acid in preventing and / or treating BmNPV infection, and belongs to the field of BmNPV infection treatment. Background Art

[0002] Blood-borne pustule in the silkworm is the most serious of the three major viral diseases affecting the silkworm industry. It is highly contagious and has become a common occurrence in silkworm production in recent years, with occasional cases of complete crop failure in some households or certain silkworm-raising areas. The pathogen behind blood-borne pustule in the silkworm is the Bombyx mori nucleopolyhedrovirus (BmNPV), a double-stranded DNA virus belonging to the family Baculoviridae and the genus Nucleopolyhedrovirus. During viral replication, BmNPV forms two types of virions: inclusion-derived virions and budding virions. The inclusion-derived virions enter the silkworm's midgut along with food and infect some midgut cells. The infected midgut cells produce a large number of budding virions, which then infect other tissues, leading to cell lysis and eventual death. The corpses and pus of diseased silkworms, pupae, and moths, as well as the silkworm feces, silkworm tools, and cocoons contaminated with these virions, carry large quantities of the virus and are highly contagious, making them the primary source of blood-borne pustule.

[0003] Currently, there is no specific treatment for BmNPV. Production efforts primarily rely on strict disinfection during the silkworm rearing period to prevent infection with BmNPV. Disinfectants primarily contain chlorine and formaldehyde. However, BmNPV has a short incubation period and rapid onset, making infection difficult to detect with the naked eye. When it is detected, it is often in the late stages or outbreak stage. Once the virus infects the silkworm and disease develops, effective treatment and recovery are difficult to achieve. Therefore, the development of a treatment for BmNPV is a pressing need for silkworm farmers and technicians.

[0004] Experimental studies have shown that chemicals such as beta-propiolactone and nalidixic acid have a certain inhibitory effect on the development of BmNPV-infected silkworms, but their effectiveness is primarily preventive rather than therapeutic. Eicosenoic acid is an omega-7 fatty acid found in various plants and is important for brain function, growth, and development. Research suggests that these acids may reduce inflammation and lower the risk of chronic diseases such as cancer, heart disease, and arthritis. Summary of the Invention

[0005] Purpose of the invention: The technical problem to be solved by the present invention is to provide the use of eicosenoic acid in preventing and / or treating BmNPV infection.

[0006] Technical solution: In order to solve the above technical problems, the present invention provides a drug, a pharmaceutical composition or a feed additive for preventing and / or treating BmNPV infection, wherein the drug contains eicosenoic acid or guarana extract.

[0007] Wherein, the concentration of eicosenoic acid is 1 to 10 μM.

[0008] The concentration of the guarana extract is 1 to 20 μM.

[0009] The concentration of the guarana extract is 10 to 20 μM.

[0010] The present invention also provides the use of eicosenoic acid in preparing a medicine, a pharmaceutical composition or a feed additive for preventing and / or treating BmNPV infection.

[0011] Wherein, the concentration of eicosenoic acid is 1 to 10 μM.

[0012] The present invention also provides use of the guarana extract in preparing a medicine, a pharmaceutical composition or a feed additive for preventing and / or treating BmNPV infection.

[0013] The concentration of the guarana extract is 1 to 20 μM.

[0014] The concentration of the guarana extract is 10 to 20 μM.

[0015] The specific prevention and control methods are:

[0016] Eicosenoic acid prevents infection of BmNPV carrying eGFP reporter gene

[0017] About 10 6 After the Bombyx mori cells adhered, BmNPV (budding form) was added to the culture dish containing the adherent cells at an Moi of 5. After half an hour, the dish was washed to remove free virus from uninfected cells and 1 mL of TC100 medium was added. Different concentrations of eicosenoic acid were added to the cells, and an equal volume of DMSO was used as a control for incubation. After incubation, the cells were observed under a fluorescence microscope, and the viral titer was determined.

[0018] These include reducing the copy number of the BmNPV genome and inhibiting the gene transcription of BmNPV.

[0019] The present invention also provides use of the guarana extract in preparing a medicine, a pharmaceutical composition or a feed additive for preventing and / or treating BmNPV infection.

[0020] Beneficial Effects: Compared with existing technologies, the present invention has the following significant advantages: Eicosenoic acid, with its main active ingredient, can be used to prepare a drug for preventing and treating blood-type pustosis in silkworms. When used at a final concentration of 10 μM, eicosenoic acid significantly inhibits the replication of BmNPV and continues to inhibit BmNPV replication even after BmNPV has completed cell infection, demonstrating a therapeutic effect. The present invention can be used for the development and production of drugs for preventing and treating blood-type pustosis in silkworms, and has application and promotional value. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of the BmNPV recombinant virus BmBac-eGFP carrying the green fluorescent protein gene;

[0022] Figure 2 Fluorescence images of virus-infected cells after cells were treated with different concentrations of eicosenoic acid;

[0023] Figure 3 The viral genome copy number after cells were treated with different concentrations of eicosenoic acid;

[0024] Figure 4 To investigate the transcription of viral genes after cells were treated with different concentrations of eicosenoic acid;

[0025] Figure 5 This is the viral growth curve after cells were treated with 10 μM eicosenoic acid;

[0026] Figure 6 To investigate the enterovirus genome copy number and viral gene transcription level in silkworms fed with mulberry leaves treated with different concentrations of guarana extract.

[0027] Figure 7 To investigate the survival rate of silkworms infected with BmNPV after feeding them with mulberry leaves treated with guarana extract at different concentrations. DETAILED DESCRIPTION

[0028] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0029] Example 1

[0030] 1. Construction of BmNPV carrying the eGFP reporter gene

[0031] The eGFP (GenBank: OQ870305.1) fragment was cloned into the EcoRI (Takara) and XhoI (Takara) sites of pFastBac1 (Invitrogen) to construct the donor plasmid pFastBac-eGFP. After pFastBac-eGFP was transformed into DH10Bac (BmNPV) competent cells (Beijing Huayueyang Biological), BmBac-eGFP was transfected into BmN (Bombyx mori ovary cells) cells, green fluorescence expression was observed under a fluorescence microscope ( Figure 1 The cell supernatant was used to reinfect BmN cells for 2-3 rounds to obtain the BmBac-eGFP recombinant virus. The virus was stored at 4°C in the dark until use.

[0032] 2. Cell Inoculation and Preparation of Eicosenoic Acid Storage Solution

[0033] (1) Inoculate approximately 10 cells in each 35 mm cell culture dish. 6 Each dish was cultured with 1 mL of TC100 insect cell culture medium containing 10% FBS.

[0034] (2) Culture at 27°C for about 12-24 hours. After the cells adhere to the wall, use them for the following experiments.

[0035] (3) Prepare a 100 μM eicosenoic acid stock solution using DMSO.

[0036] 3. Inhibition of BmNPV replication by eicosenoic acid

[0037] (1) Add BmBac-eGFP recombinant virus at an MOI of 5 to a culture dish containing adherent cells. After half an hour, wash the dish to remove free virus from uninfected cells and add 1 mL of TC100 medium (Shanghai Yuanpei Biotechnology Co., Ltd.). Dilute eicosenoic acid into multiple gradients (1 μM, 10 μM), take 10 μL of each dilution and add it to the virus-infected cells. Incubate at 27°C for 72 hours.

[0038] (2) After 72 hours, place the culture dish on a fluorescent inverted microscope to observe the expression of green fluorescent protein. Figure 2 .

[0039] The results showed that when the cells were treated with the control group, the BmNPV-infected cells produced a large amount of fluorescence, and the fluorescence was greatly reduced after treatment with 10 μM eicosenoic acid.

[0040] Example 2

[0041] Effect of eicosanoic acid on viral genome copy number 72 hours after infection:

[0042] The cell culture supernatant taken 72 hours after infection was detected for the number of genome copies of mature infectious virions BV in the cell supernatant by an absolute quantitative method using quantitative PCR technology. The specific method was as follows: Genomic DNA was extracted and quantified using the Genomic DNA Small Amount Preparation Kit of Shenguo Bioengineering (Shanghai) Co., Ltd. ChamQ SYBR qPCR Master Mix (Nanjing Novozyme Biological Technology Co., Ltd.) reagent was used for qPCR detection on a 7300 real-time fluorescence quantitative PCR system according to the manufacturer's instructions. The 10 μL reaction system included 5 μL 2x ChamQ SYBR qPCR Master Mix (High ROX Premixed), 0.5 μL upstream and downstream primers (for BmNPV ie-1 gene, Gene ID: 1488755. Upstream primer: ATTTGCACGGTCGCTTCAAC; Downstream primer: CGTACACCACATTGCTCACG), 1 μL template DNA, and 3 μL ddH2O. The reaction program of absolute quantitative PCR was as follows: 95°C pre-denaturation for 30 seconds; 95°C for 5 seconds, 60°C for 30 seconds, for a total of 40 cycles; the melting curve stage was 95°C for 15 seconds, 60°C for 60 seconds, and 95°C for 15 seconds. A standard curve was generated using a series of standard dilutions of known concentrations, and the template copy number was plotted against the Ct value (Y axis) to obtain the standard linear equation of the ie-1 gene: Y = -2.726lgX + 38.43 (R 2 = 0.999), which met the quantitative requirements. Y represents the sample Ct value, and X represents the target gene copy number. The number of genome copies of BmNPV in each sample was calculated according to the standard curve.

[0043] The results showed that when the cells were treated with 1 and 10 μM eicosanoic acid, the number of viral genome copies was significantly reduced, and the infection of the virus was significantly inhibited. Figure 3

[0044] Example 3

[0045] Effect of eicosanoic acid on viral gene transcription after 48 hours of infection:

[0046] ​Quantitative PCR was used to analyze the effect of 10 μM eicosanoic acid on the transcription of genes including vp39 (Gene ID: 1488704, upstream primer: TTTTTCGACGTGACCAACGC; downstream primer: ACCAGACCCGTTTCGTCAAT), lef11 (Gene ID: 1488659, upstream primer: GGAAAGACGACGGTGTCACT; downstream primer: ATTTGTTGAGCGGCACGATG), and pe38 (Gene ID: 1488760, upstream primer: ACGGAGCGTGATTAGTGTCG; downstream primer: TCACCTGACGCTGCAATTCT) 48 hours after BmNPV infection. Total RNA was extracted and quantified using Trizol reagent and then reverse transcribed into cDNA using HiScript II QRT SuperMix for qPCR (Nanjing Novozymes Biotech Co., Ltd.). Relative quantitative PCR was performed using cDNA as template and BmGAPDH (Gene ID: 692786. Upstream primer: TTCATGCCACAACTGCTACA; downstream primer: AGTCAGCTTGCCATTAAGAG) as internal reference. The reaction system and procedure were the same as those for absolute quantitative PCR. 2 -ΔΔ C The t method was used to analyze the qPCR data, and the relative expression levels of each gene compared with the control group were calculated.

[0047] The results showed that eicosenoic acid had a significant inhibitory effect on BmNPV gene transcription ( Figure 4 ).

[0048] Example 4

[0049] Effect of eicosanoic acid on viral growth curve:

[0050] During the virus infection process (0 h, 12 h, 24 h, 48 h, 72 h, and 96 h), we took the cell culture supernatant of the 10 μM eicosine-treated group and the control group to measure the virus titer and draw the virus growth curve.

[0051] The results showed that the growth curve of BmNPV virus in the 10 μM eicosine treatment group was significantly inhibited ( Figure 5 ).

[0052] Example 5

[0053] Inhibitory effect of guarana extract on oral infection of silkworms with BmNPV:

[0054] We researched eicosanoids, an omega-7 fatty acid found in various plants, and found in abundance in guarana (Paullinia cupana), where they can be extracted in large quantities. Therefore, we tested the effects of feeding silkworm larvae a guarana extract on BmNPV. Guarana extract was purchased from Hunan Tairen Pharmaceutical Co., Ltd.

[0055] Silkworms (Qiufeng×Baiyu) were raised with mulberry leaves until the 5th instar, 30 silkworms were selected for each group, and 3 replicates were set for each group. 7 Mulberry leaves were smeared with wild-type T3 BmNPV at a concentration of PFU / mL and then fed to silkworms (a single layer). 24 hours later, guarana extract solutions at concentrations of 1, 10, 15, or 20 mg / mL were prepared and soaked in the mulberry leaves for 10 minutes. After drying, the leaves were divided into groups and fed to the silkworms. A control group was fed normal mulberry leaves twice daily. After 72 hours, the effects of different concentrations of guarana extract on BmNPV gene copy number and gene transcription were examined. Silkworm mortality was also recorded daily throughout the experiment, and survival curves were plotted.

[0056] The results showed that guarana extracts above 10 mg / mL could significantly reduce the number of BmNPV viral gene copies ( Figure 6 A) and gene transcription levels ( Figure 6 B), significantly improved the survival rate of silkworms ( Figure 7 ).

[0057] Example 6

[0058] Toxicity test of guarana extract at different concentrations:

[0059] Silkworms (Qiufeng x Baiyu) were reared on mulberry leaves until the fifth instar. Each group of 1,000 silkworms was fed mulberry leaves soaked in 0, 10, 20, or 100 mg / mL guarana extract solutions for 10 minutes once daily. The remaining feeding time was normal mulberry leaves. The silkworms were reared until they matured, mounted cocoons, and spun cocoons. During the rearing period, the silkworms' growth was recorded daily, along with vital indicators such as the number of dead or diseased silkworms, number of cocoons laid, number of moths that emerged, and number of dead cages. Economic indicators such as total cocoon yield, cocoon layer count, and cocoon layer rate were also recorded. After the pupae emerged, the male and female moths were allowed to mate and lay eggs. Egg yield and egg hatchability were then measured. The results are shown in Table 1.

[0060] Table 1 Investigation of the toxic effects of guarana extract on silkworms

[0061]

[0062] As shown in the experimental data in Table 1, the use of the guarana extract of the present invention to soak mulberry leaves for feeding silkworms does not significantly affect the normal growth of silkworms when compared with a control group (0 mg / mL) at an effective concentration (10-20 mg / mL). There are no significant differences in the pupal life rate (number of cocoons and number of moths formed), cocoon quality (total cocoon volume and cocoon layer rate), and egg quality (egg volume and hatchability) of the silkworms. However, at a concentration of 100 mg / mL, the extract has significant toxicity to the silkworms, so it is necessary to control the concentration when used, or use it in combination with other drugs at low concentrations.

[0063] Finally, it should be noted that the concentrations of eicosenoic acid and guarana extracts and treatment times described in the above examples and embodiments are for illustrative purposes only and are not limiting. However, those skilled in the art should understand that slight differences in cell status or physicochemical properties of cell culture media, such as pH, etc., may lead to various changes in form and details without departing from the spirit and scope of the present invention as defined in the appended claims, and are included within the spirit and scope of this application.

Claims

1. A drug, pharmaceutical composition or feed additive for preventing and / or treating BmNPV infection, characterized in that: The medicine contains eicosenoic acid or guarana extract.

2. The drug, pharmaceutical composition or feed additive according to claim 1, characterized in that The concentration of eicosenoic acid is 1 to 10 μM.

3. The drug, pharmaceutical composition or feed additive according to claim 1, characterized in that The concentration of guarana extract is 1 to 20 μM.

4. The drug, pharmaceutical composition or feed additive according to claim 1, characterized in that The concentration of guarana extract is 10-20 μM.

5. Use of eicosenoic acid in the preparation of a drug, pharmaceutical composition or feed additive for preventing and / or treating BmNPV infection.

6. The application according to claim 5, characterized in that The concentration of eicosenoic acid is 1 to 10 μM.

7. The use according to claim 5, characterized in that Including reducing the copy number of BmNPV genome and inhibiting BmNPV gene transcription.

8. Use of guarana extract in the preparation of a medicament, pharmaceutical composition or feed additive for preventing and / or treating BmNPV infection.

9. The application according to claim 8, characterized in that: The concentration of guarana extract is 1 to 20 μM.

10. The use according to claim 8, characterized in that: The concentration of guarana extract is 10-20 μM.