Mycobacterium suis and application thereof

Abstract

The invention relates to the technical field of microorganisms, and particularly discloses mycobacterium suis and application thereof. According to the present invention, the porcine mycobacterium strain is found through the research, and the preservation number of the porcine mycobacterium strain is CGMCC No. 33882; the strain has good antigen immune performance, can generate cross immune reaction with mycobacterium tuberculosis, can immunoinhibit proliferation of mycobacterium tuberculosis, and provides a new means for prevention and treatment of mycobacterium tuberculosis infection.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, in particular to a strain of Mycobacterium suis and application thereof. Background Art

[0002] Mycobacterium suis ( Mycobacterium porcinum ) belongs to nontuberculosis mycobacterium (NTM), which can exist in soil, drinking water and other environments. It is a fast-growing nontuberculosis mycobacterium. Reports show that it can cause local skin infections and can also be isolated from patients with lung infections.

[0003] The composition of nontuberculous mycobacteria is extremely complex and diverse, containing a variety of biologically active components. These active components may have potential applications in immunomodulation and antibacterial applications. Therefore, considering the development needs of various fields such as medicine and bioengineering, in-depth research on the efficacy of Mycobacterium suis, and indeed nontuberculous mycobacteria as a whole, is essential. This will not only help to better understand its immunological mechanisms, thereby providing more precise strategies for the prevention and treatment of related diseases, but also may provide new opportunities for the development of new drugs and vaccines. Summary of the Invention

[0004] One of the purposes of the present invention is to provide a new strain with good immune effect and the ability to immunosuppress the proliferation of Mycobacterium tuberculosis.

[0005] The present invention provides a strain of Mycobacterium suis ( Mycobacterium porcinum ) strain, whose deposit number is CGMCC NO. 33882.

[0006] The Mycobacterium suis of the present invention was deposited on March 27, 2025 at the General Microbiology Center of China Culture Collection Administration (CGMCC, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101), and was classified as Mycobacterium suis. Mycobacterium porcinum , the deposit number is CGMCC No.33882.

[0007] The suis mycobacterium strain of the present invention has a good immune effect, can promote the secretion of IFN-γ, IL-2, IL-4, IL-6, IL-10, and IL-17A cytokines, promote the proliferation of spleen lymphocytes, and can produce a cross-immune reaction with Mycobacterium tuberculosis. Splenic lymphocytes immunized with the suis mycobacterium of the present invention can significantly inhibit the proliferation of Mycobacterium tuberculosis.

[0008] The present invention also provides a bacterial agent containing the Mycobacterium suis strain.

[0009] The bacterial agent of the present invention may also contain other strains with similar or different functions from the above-mentioned Mycobacterium suis, and may be a solid bacterial agent or a liquid bacterial agent.

[0010] The present invention also provides the use of the above-mentioned Mycobacterium suis strain in preparing immune preparations, preparing products that promote lymphocytes to secrete IFN-γ, IL-2, IL-4, IL-6, IL-10, and IL-17A cytokines, or preparing products for resisting Mycobacterium tuberculosis infection.

[0011] The present invention also provides an immune preparation comprising an immune adjuvant and the whole bacterial protein of the Mycobacterium suis strain.

[0012] In the immune preparation of the present invention, the immune adjuvant includes DDA and PolyI:C.

[0013] The present invention also provides use of the Mycobacterium suis strain in preparing a product for promoting lymphocyte proliferation.

[0014] The lymphocytes are IFN-γ + CD4 + T lymphocytes, TNF-α + CD4 + T lymphocytes, IL-2 + CD4 + T lymphocytes and / or IL-2 + CD8 + T lymphocytes.

[0015] In the above application of the present invention, the product includes the whole bacterial protein of the above Mycobacterium suis strain.

[0016] The beneficial effects of the present invention are at least: The swine mycobacterium strain of the invention has good immune effect, can produce cross immune reaction with mycobacterium tuberculosis, and can immunosuppress the proliferation of mycobacterium tuberculosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the agarose gel electrophoresis diagram of PCR, where M is Marker and lane 1 is Mycobacterium suis 16s rRNA PCR amplification products.

[0018] Figure 2 This is the SDS-PAGE detection result of the whole cell protein of Mycobacterium suis strain after ultrasonic fragmentation, where M is Marker and lane 1 is the whole cell protein of Mycobacterium suis strain.

[0019] Figure 3 is the serum antibody titer of mice after immunization.

[0020] Figure 4Results of GO functional analysis of Mycobacterium tuberculosis proteins that produce cross-immune reactions.

[0021] Figure 5 Results of KEGG pathway analysis of Mycobacterium tuberculosis proteins that produce cross-immune reactions.

[0022] Figure 6 These are the results of homologous gene analysis between Mycobacterium suis strains, Mycobacterium tuberculosis H37Rv and BCG.

[0023] Figure 7 The results show the effect of whole cell protein of Mycobacterium suis strain on cytokine secretion of mouse spleen lymphocytes. represent P <0.05.

[0024] Figure 8 The results show the effect of whole cell protein of Mycobacterium suis strain on the proliferation of mouse spleen lymphocytes. represent P <0.05.

[0025] Figure 9 MGIA colony counting results. DETAILED DESCRIPTION

[0026] The preferred embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that the following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0027] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following examples are all commercially available or prepared according to conventional methods in the art.

[0028] Example 1 Isolation and purification of Mycobacterium suis and preparation of antigens 1.1 Isolation and purification of Mycobacterium suis Pipette 100µl of the isolated and preserved Mycobacterium suis bacterial solution from the bacterial preservation tube and add it to the Roche culture tube. After bacteria grow on the surface, elute it with 1.0mL 7H9 medium. Take an appropriate amount and ultrasonically disperse it in an ultrasonic tube for a total of 30 seconds, that is, start for 5 seconds, stop for 5 seconds, and repeat for 30 seconds. Take 100 μL and add it to an EP tube pre-filled with 900 μL (containing 0.5% Tween 20) sterile 0.01M pH7.2 PBS, and perform 10-fold gradient dilution of the sample in sequence. Take the liquid of each dilution, filter it through a sterile 0.45 μm filter, and take 100 μL of each dilution to spread on a 7H10 plate. Culture it in a constant temperature incubator at 37°C (containing 5% CO2). When single colonies of appropriate size grow out, pick several single colonies of uniform size and good growth state and culture them in 5 mL 7H9 liquid culture medium. Then expand the culture in 25 mL 7H9 liquid culture medium, take a part and store it in a bacteria-preserving screw-capped tube, and extract DNA from the other part for sequencing and identification.

[0029] 1.2 Genome Sequencing and Identification Genomic DNA from the sample was extracted using the CTAB method as follows. 50-100 mg of fresh culture from a M. suis Rosenbaum tube was scraped and collected in a screw-cap tube containing 700 μL of saline. The tube was sealed with parafilm and inactivated in an 80°C waterbath for 30 minutes. The tube was aspirated and transferred to a fresh Eppendorf tube. Centrifuged at 12,000 rpm for 5 minutes, the supernatant discarded, and the pellet was spun down in 400 μL of sterile TE. 50 μL of lysozyme (10 mg / mL) was added and mixed thoroughly by pipetting. The tube was incubated in a 37°C incubator for 16-20 hours. A mixture of CTAB and NaCl (preheated to a final concentration of 0.1 g / mL) was added to each tube in a 65°C waterbath. A mixture containing 70 μL of 10% SDS and 5 μL of 20 mg / mL proteinase K was added to each tube. The mixture was mixed thoroughly by pipetting, and the tube was incubated at 65°C for 10 minutes. Then, add 100 μL of 5M NaCl and 100 μL of the aforementioned CTAB / NaCl mixture. Vortex mix until the liquid turns milky white. Incubate at 65°C for 10 min. Add 750 μL of chloroform / isoamyl alcohol (24:1), mix by inversion, and centrifuge at 12,000 rpm for 10 min. Carefully aspirate the supernatant into another Eppendorf tube. Add 0.6 volumes (450 μL) of isopropanol to precipitate the DNA. Incubate at -20°C overnight. Centrifuge at 12,000 rpm for 15 min at 4°C, discard the supernatant, and wash the DNA pellet with 1 ml of ice-cold 70% ethanol. Centrifuge at 12,000 rpm for 5 min. Pipette out all liquid and discard. Dry in a metal bath at 37°C for 10 min. Dissolve the DNA pellet in 50 μL of TE, determine the concentration, and store at -80°C until use.

[0030] PCR was performed using upstream primer F: AGAGTTTGATCCTGGCTCAG (SEQ ID No. 1) and downstream primer R: GGTTACCTTGTTACGACTT (SEQ ID No. 2) to amplify 16s rRNA The sequence was analyzed and agarose gel electrophoresis was performed. Samples with correct and uniform band sizes were sent to the company for sequencing. The samples with correct sequencing were sent to the company for whole genome framework sequencing for further comparison.

[0031] After the above operations, the cloned bacterial culture was successfully isolated and obtained. 16s rRNA and whole genome sequencing identified it as Mycobacterium suis (electrophoresis pattern see Figure 1 ). This strain 16s rRNA The sequence is shown in SEQ ID No. 3. The isolated, purified and identified strain was deposited in the General Microbiology Center of China Culture Collection of Microorganisms with the deposit number: CGMCC No. 33882.

[0032] 1.3 Preparation of whole cell protein of Mycobacterium suis CGMCC No. 33882 Use 200mL 7H9 liquid medium to inoculate an appropriate amount of the original strain of Mycobacterium suis. When Mycobacterium suis is cultured in a 37℃ incubator (containing 5% CO2) and grown to OD 600 When the pH value is ≈1.2, the culture flask was inactivated at 80°C for 30 minutes, and then centrifuged at 5000 rpm for 10 minutes to collect the bacterial precipitate and discard the supernatant. The precipitate was resuspended with 25 mL of sterile PBS, centrifuged again at 5000 rpm for 10 minutes, the supernatant was discarded, and the washing was repeated for a total of three times. The precipitate was resuspended with 5 mL of PBS for the last time. The ultrasonic parameters were 250 W, with the ultrasound turned on for 10 seconds and off for 10 seconds, for a total of 80 minutes on ice. The sonicated liquid was centrifuged at 12000 rpm for 5 minutes, the supernatant was aspirated and filtered with a 0.22 μm filter to obtain sterile whole-cell protein of Mycobacterium suis, which was identified by protein electrophoresis using SDS-PAGE ( Figure 2 The protein concentration was determined using the BCA method and stored at -20°C until use.

[0033] Example 2 Cross-immune reaction with Mycobacterium tuberculosis proteins 2.1 Preparation of whole-cell protein antigen immunogenic preparations of Mycobacterium suis CGMCC No. 33882 Poly I:C powder was diluted to a concentration of 1 mg / mL with sterile PBS and sterilized by filtration through a 0.22 μm filter. Cationic liposome dimethyl tridecyl ammonium bromide (DDA) was prepared at a concentration of 2.5 mg / mL in sterile PBS, incubated in an 80°C water bath for 10 minutes, and then cooled to room temperature. The DDA and Poly I:C solutions were combined with the whole bacterial protein solution prepared in Example 1. A large system (an integral multiple of each preparation) was prepared, with each mixture containing 250 μg DDA, 50 μg Poly I:C, and 50 μg bacterial protein (to facilitate subsequent mouse immunization, the total volume of each preparation was ≤ 200 μl). Emulsification was performed using a small emulsifier or pipette for 5 minutes to obtain the Mycobacterium suis whole bacterial protein-DDA / Poly I:C immune preparation, hereafter referred to as the Mycobacterium suis immune preparation.

[0034] 2.2 Mouse immunization Subcutaneous immunization was performed three times, with 14 days between immunizations. Ten mice were randomly divided into two groups of five: the immune preparation group and the PBS control group. The immune preparation group received one portion of the immune preparation prepared in 2.1 above, administered subcutaneously to each mouse at each immunization. The PBS control group received an equal volume of PBS. Blood was collected from the eye sockets 14 days after the three immunizations. After standing at room temperature for 2 hours, the blood was centrifuged at 5000 rpm for 10 minutes. Serum was collected and stored at -20°C until further use.

[0035] 2.3 Serum antibody determination in immunized mice Antibody titers in the mouse sera were determined using ELISA. The whole-cell protein of Mycobacterium suis prepared in Example 1 was diluted to 10 μg / mL in coating solution (2.93 g NaHCO₃, 1.5 g Na₂CO₃, 1000 mL H₂O, pH 9.6). 100 μL / well of the solution was plated and incubated overnight at 4°C. The plates were washed with PBST and immediately blocked with 200 μL / well of 5% skim milk powder in PBST in an incubator at 37°C for 2 h. The plates were washed with PBST and serially diluted mouse serum (100 μL / well) was added and incubated at 37°C for 1 h. The plates were washed with PBST and HRP-conjugated goat anti-mouse IgG (H+L), IgG1, and IgG2a antibodies (100 μL / well diluted 1:5000 in PBS) were added and incubated at 37°C for 1 h. The plates were washed with PBST and TMB enzymatic reaction substrate (100 μL / well) was added and incubated at 37°C for 45 min. Finally, add 50 μL of stop solution in the order indicated. Read the sample at 450 nm on a microplate reader. Positive results were determined if the ratio of the immune group to the PBS group was > 2.1. Data are expressed as mean ± SD.

[0036] The results showed that the titers of serum antibodies IgG, IgG1 and IgG2 reached 6.52, 5.84±0.04 and 5.25±0.09 respectively after immunization, indicating a good immune effect. Figure 3 .

[0037] 2.4 Cross-immune reactions with Mycobacterium tuberculosis proteins The three sera with the highest antibody titers were selected and mixed in equal volumes for determination of cross-immune reaction with Mycobacterium tuberculosis proteins. The MtbProt® Mycobacterium tuberculosis whole proteome chip (Guangdong Tibikang Biotechnology) was removed from -80°C, added with blocking solution, and placed on a side-swing shaker for blocking at room temperature for 3 h. The blocking solution was discarded, and serum incubation solution (serum was diluted 200-fold with incubation solution) was quickly added. The chip was placed on a side-swing shaker and incubated overnight at 4°C. The chip was placed on a horizontal shaker and washed three times with washing solution at room temperature for 10 min each time. The chip was placed on a side-swing shaker and incubated with secondary antibody incubation solution (secondary antibody was diluted 1000-fold with incubation solution) at room temperature for 1 h (from this step on, pay attention to protect the operation from light). The chip was placed on a horizontal shaker and washed three times with washing solution at room temperature for 10 min each time. After completion, it was washed twice with ddH2O at room temperature for 10 min each time. Finally, after drying and scanning, proteins with IgG-SNR ≥ 1.5 and IgM-SNR ≥ 3 were selected as positive proteins, and protein functions were analyzed based on the KEGG database and Gene Ontology database.

[0038] Protein chip analysis showed that there were 460 proteins in the serum of the mice immunized with the whole bacterial protein of Mycobacterium suis of the present invention that could produce cross-immune reactions with the protein core of Mycobacterium tuberculosis, of which 208 proteins produced IgG positive reactions, 252 proteins produced IgM positive reactions, and 59 proteins could produce both IgG positive reactions and IgM positive reactions.

[0039] GO analysis showed that the main functions involved include cell wall, translation elongation factor activity, bacterial nucleoid, growth, etc. ( Figure 4 ).

[0040] KEGG pathway analysis showed that the main pathways include metabolic pathways, biosynthesis of secondary metabolites, microbial metabolism in diverse environments, and biosynthesis of antibiotics. Figure 5 ).

[0041] The results of genome comparison analysis and antigen cross-immunity analysis of the Mycobacterium suis of the present invention and Mycobacterium tuberculosis showed that the Mycobacterium suis of the present invention has 2383 homologous genes with Mycobacterium tuberculosis H37Rv and 2351 homologous genes with BCG ( Figure 6 ).

[0042] Example 3 Application and in vitro evaluation of whole cell protein preparation of Mycobacterium suis CGMCC No. 33882 3.1 Isolation of mouse splenic lymphocytes Fourteen days after the final immunization of the mice in Example 2, the spleens were aseptically removed and ground according to the instructions for use of Dakoway Mouse Lymphocyte Isolation Medium to isolate splenic lymphocytes. Briefly, the spleen suspension was transferred to a 15 ml centrifuge tube after grinding. Overlaid with 1000 μl of RPMI1640 medium, the suspension was centrifuged horizontally at 800 g for 30 min, the supernatant was aspirated, and 10 ml of RPMI1640 medium was added again. The tube was inverted for washing and the cells were collected by centrifugation at 250 g for 10 min. The supernatant was discarded, and the cells were resuspended in complete cell culture medium and counted for later use.

[0043] 3.2 Levels of cytokine secretion by induced mouse splenic lymphocytes Mouse splenic lymphocytes were stimulated with tuberculin (PPD) and the whole cell protein of Mycobacterium suis prepared in Example 1. Luminex technology and the Bio-Plex Pro Mouse Cytokine Kit were used to detect the secretion levels of IL-2, IL-4, IL-6, IL-10, IL-17A, IFN-γ, and TNF-α in mouse splenic lymphocytes stimulated with PPD and whole cell protein of Mycobacterium suis. The following is a brief description: The number of splenic lymphocytes in mice immunized with PBS and whole cell protein preparation was adjusted to 1×10 5Plate cells into a 96-well cell culture plate. Stimulate with PBS, Mycobacterium suis whole bacterial protein (5µg / well), and PPD (5µg / well). Bring the total volume of liquid to 200µL / well with 1640 medium containing 10% FBS. After 24 hours of incubation, aspirate all the liquid from the plate and centrifuge at 300g for 10 minutes at 4°C. Transfer the supernatant to a new Eppendorf tube and centrifuge again at 3000g for 10 minutes at 4°C. Collect the supernatant and store at -80°C until assayed.

[0044] Cytokine assays were performed on the samples according to the Luminax assay protocol. The kit was equilibrated at room temperature for 30 minutes. Standards and wash buffer were prepared. Beads, detection antibodies, and PE-streptavidin were also prepared. The assay was completed through sample incubation, reaction, and instrument reading. In this experiment, the BioPlex 200 instrument was used for instrument reading.

[0045] The results showed that compared with the unstimulated group, the splenic lymphocytes of the immunized mice stimulated with PPD and Mycobacterium suis bacterial protein could promote the secretion of IFN-γ, IL-2, IL-4, IL-6, IL-10, and IL-17A cytokines ( Figure 7 )( P <0.05, but the effect on TNF-α secretion was not significant ( P >0.05).

[0046] 3.3 Flow cytometry detection of mouse spleen lymphocyte proliferation The concentration of the spleen lymphocyte suspension was adjusted to 2×10 6 100 μL of cell suspension and 100 μL of a mixture of stimulators and blockers were added to a 96-well plate to a final concentration of 10 μg / mL antigen (PPD or the whole cell protein of Mycobacterium suis prepared in Example 1), 1 μg / mL CD28 antibody, 1 μg / mL CD49d antibody, and 0.2 μL BFA blocker. The cells were stimulated and cultured in a 37°C incubator with 5% CO2 for 8 hours. The cells in the wells were collected, and a cell death and viability stain was added. After washing, the cells were collected and labeled with fluorescent antibodies against cell surface antigens CD3, CD4, and CD8. After the reaction, the cells were washed and fixed with fixative (Bio Legend). Then, a membrane permeabilization solution (Bio Legend) was added. After washing, fluorescent-labeled antibodies against cytoplasmic antigens IFN-γ, TNF-α, and IL-2 were added. The labeled cells were detected by a flow cytometer (16V-14B-8R; Cytek NL-CLC3000). Data were analyzed using SpectroFloCLC1.0 software.

[0047] The results showed that immune preparations could affect the proliferation of mouse spleen lymphocytes. After PPD was used to stimulate the spleen cells of the immunized mice, IFN-γ + CD4 + T lymphocytes, TNF-α + CD4 + T lymphocytes, IFN-γ + CD8 + T lymphocytes, TNF-α + CD8 + T lymphocytes and IL-2 + CD8 + T lymphocytes increased significantly ( P <0.05). After stimulating mouse spleen lymphocytes with whole cell protein of Mycobacterium suis, IFN-γ + CD4 + T lymphocytes, TNF-α + CD4 + T lymphocytes, IL-2 + CD4 + T lymphocytes and IL-2 + CD8 + T lymphocytes increased significantly ( P <0.05). Figure 8 .

[0048] 3.4 In vitro growth inhibition of Mycobacterium tuberculosis Take the mouse spleen lymphocyte fluid separated aseptically above and adjust the cell concentration to 1×10 6 100 CFU of the logarithmically growing Mycobacterium tuberculosis standard strain H37Rv were added to each well of a 48-well plate. The plate was then aspirated to adjust the volume per well to 500 μL. The cells were incubated in a 37°C cell culture incubator (5% CO₂) for 72 hours. After the incubation period, an equal volume of 2% Triton-X100 in sterile PBS was added to each well, mixed by pipetting, and incubated at 4°C for 10 minutes. 100 μL of the cell lysate was aspirated and diluted 10-fold in sterile PBS. The cells were then plated onto a 7H10 plate and counted when distinct colonies were present.

[0049] The results showed that compared with the spleen lymphocytes of the mice in the PBS control group, the spleen lymphocytes of the mice immunized with the Mycobacterium suis immune preparation of the present invention could significantly inhibit the proliferation of Mycobacterium tuberculosis ( P <0.05), see Figure 9 .

[0050] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. A strain of Mycobacterium suis ( Mycobacterium porcinum ) strain, characterized in that The preservation number is CGMCC NO. 33882.

2. A bacterial agent, characterized in that Containing the Mycobacterium suis according to claim 1 ( Mycobacterium porcinum ) strain.

3. Mycobacterium suis according to claim 1 ( Mycobacterium porcinum ) strains in the preparation of immune preparations.

4. An immune preparation, characterized in that comprising an immune adjuvant and the Mycobacterium suis according to claim 1 ( Mycobacterium porcinum ) strain's whole-body proteins.

5. The immune preparation according to claim 4, characterized in that The immune adjuvant includes DDA and PolyI:C.

6. Mycobacterium suis according to claim 1 ( Mycobacterium porcinum ) strain in the preparation of products that promote lymphocytes to secrete IFN-γ, IL-2, IL-4, IL-6, IL-10, and IL-17A cytokines.

7. Mycobacterium suis according to claim 1 ( Mycobacterium porcinum ) strain in the preparation of products that promote lymphocyte proliferation.

8. The use according to claim 7, characterized in that The lymphocytes are IFN-γ + CD4 + T lymphocytes, TNF-α + CD4 + T lymphocytes, IL-2 + CD4 + T lymphocytes and / or IL-2 + CD8 + T lymphocytes.

9. The Mycobacterium suis according to claim 1 ( Mycobacterium porcinum ) strain in the preparation of anti-Mycobacterium tuberculosis infection products.

10. The use according to any one of claims 6 to 9, characterized in that: The product comprises the Mycobacterium suis according to claim 1 ( Mycobacterium porcinum ) strain's whole-body proteins.

Images