Bacillus velezensis QJXW44 and application thereof in amorphophallus konjac soft rot

Abstract

The invention discloses bacillus velezensis QJXW44 and an application of the bacillus velezensis QJXW44 in amorphophallus konjac soft rot. The bacillus velezensis QJXW44 is preserved in China General Microbiological Culture Collection Center on May 10, 2024, and the preservation number of the bacillus velezensis QJXW44 is CGMCC No.30596. The invention further discloses an application of the bacillus velezensis QJXW44 in amorphophallus konjac soft rot. The bacillus velezensis QJXW44 provided by the invention has an antagonistic effect on various plant pathogenic fungi including Erwinia carotovora subsp. Carotovora, pectobacterium carotovora and botryosphaeria dothidea, has a remarkable antagonistic effect on the soft rot of the konjak, and also can induce the disease resistance of the konjak; the microbial community structure at the rhizosphere of the konjak is improved, the occurrence and spreading of the soft rot of the konjak can be effectively inhibited through a biological control mode, and the use of chemical pesticides is reduced.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms and microbial control, and in particular to a strain of Bacillus velezensis QJXW44 and application thereof in treating konjac soft rot. Background Art

[0002] In recent years, with the continuous growth of the konjac industry and the expansion of large-scale, intensively cultivated areas, konjac has experienced unprecedented development. At the same time, konjac diseases have become increasingly serious. Konjac soft rot is the most serious, largest-scale, highly contagious, and highest-fatality soil-borne bacterial disease, earning it the nickname "the cancer" of konjac. Konjac diseases, especially soft rot, have become the primary limiting factor in the development of the konjac industry. Currently, China primarily uses a combination of chemical and agricultural control methods to prevent the occurrence of soft rot. However, chemical pesticides are often highly toxic, produce high residues, and agricultural control measures are subject to environmental fluctuations, resulting in limited effectiveness.

[0003] Biological control refers to the use of beneficial organisms and their metabolites to prevent and control plant diseases. Unlike chemical control, its greatest advantage is its safety for humans and animals and its environmental friendliness. Therefore, green control methods using biocontrol microorganisms are gaining increasing attention and hold broad development prospects. A key foundation for biological control is the screening of effective biocontrol strains. Therefore, it is crucial to identify strains that exhibit strong antagonism against the pathogenic bacteria that cause konjac soft rot and can induce disease resistance in konjac. Summary of the Invention

[0004] The invention aims to provide a Bacillus velezensis QJXW44 with good biocontrol effect, and also provides application of the Bacillus velezensis QJXW44 in treating konjac soft rot.

[0005] In order to solve the problems of the prior art, the present invention provides a strain of Bacillus Velezii QJXW44, wherein the Bacillus Velezii ( Bacillus velezensis ) QJXW44 was deposited in the General Microbiology Center of China Culture Collection Administration on May 10, 2024, with the deposit number CGMCC No. 30596. The depository address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The depository telephone number is: 010-64807355.

[0006] The present invention provides a bacterial agent, the active ingredient of which comprises at least one of the bacterial suspension or sterile fermentation liquid of the Bacillus Velez subtilis QJXW44 according to claim 1.

[0007] The bacterial suspension of QJXW44 is prepared by culturing Bacillus velezensis QJXW44 on LB solid medium overnight, transferring the culture to sterile LB liquid medium, and culturing the culture at 28°C and 120 rpm for 24 hours. The fermentation broth is centrifuged at 5000 rpm for 5 minutes, the supernatant is removed, and the cells are resuspended in sterile water to prepare a bacterial suspension. The preparation method of the sterile fermentation broth of QJXW44 is as follows: after culturing Bacillus velezensis QJXW44 on LB solid culture medium overnight, transferring it to sterile LB liquid culture medium, culturing it at 28°C and 120 r / min for 24 hours, centrifuging the fermentation broth at 5000 r / min for 5 minutes, retaining the supernatant, and filtering the supernatant through a sterile filter membrane to obtain a sterile fermentation broth, i.e., the sterile fermentation broth.

[0008] The present invention relates to the use of Bacillus velez QJXW44 in the preparation of a novel bacterial strain for inhibiting Erwinia carrot soft rot subspecies carrot soft rot ( E. carotovora subsp.carotovora, Ecc. ), soft rot pectin bacteria ( Pectobacterium aroidearum ), Botrytis cinerea ( Botryosphaeria dothidea ), Fusarium oxysporum ( Fusariumoxysporum ), Fusarium solani ( Fusarium solani )、Panax notoginseng Fusarium solani( Panax notoginseng Fusarium solani )、Clodia spp.( Neofusicoccum parvum graminearum ( Fusarium graminearum ), Alternaria alternata ( Alternaria alternata ) and Fusarium equisetum ( Fusarium equiseti ) products.

[0009] The invention relates to application of Bacillus velez QJXW44 in preparing a product for preventing and treating konjac soft rot.

[0010] The invention relates to application of Bacillus velez QJXW44 in preparing a konjac growth promoter product.

[0011] The invention relates to application of Bacillus velez QJXW44 in preparing a konjac resistance inducer product.

[0012] The invention relates to application of Bacillus velez QJXW44 in preparing a product for regulating the microbial community structure of konjac rhizosphere soil.

[0013] Beneficial effects: The Bacillus Velezii strain QJXW44 provided by the present invention has a significant control effect on konjac soft rot. Through biological control, the occurrence and spread of konjac soft rot can be effectively inhibited, reducing the use of chemical pesticides.

[0014] Compared with the prior art, the present invention has the following advantages: (1) Environmentally friendly: Compared with chemical control, the biological control method adopted in the present invention is more environmentally friendly and reduces the negative impact of chemical pesticides on the soil and ecosystem.

[0015] (2) Safety for humans and animals: Biological control methods use natural microbial strains, which are safer for humans and animals and reduce the potential threat of chemical pesticide residues to human health.

[0016] (3) Promote the growth of konjac: Bacillus velezensis QJXW44 not only has the ability to prevent and control diseases, but also has the effect of promoting the growth of konjac, which can increase the growth rate and yield of konjac.

[0017] (4) Nitrogen fixation, phosphorus solubilization and iron production ability: Bacillus velezensis QJXW44 has the ability to fix nitrogen, solubilize phosphorus and produce iron carriers. These characteristics help to improve soil fertility and the nutritional status of konjac, and further improve the growth quality and yield of konjac.

[0018] (5) It has an inhibitory effect on a variety of pathogenic bacteria: the inhibition zone diameter of the Bacillus velezensis QJXW44 strain against Erwinia carotovora subsp. carotovora was (19.67±4.51) mm; the inhibition zone diameter of the QJXW44 sterile fermentation liquid was (16.05±0.25) mm; the inhibition zone diameter of the Bacillus velezensis QJXW44 strain against Pectobacterium spp. was (19.00±3.16) mm, and the inhibition zone diameter of the QJXW44 sterile fermentation liquid against Pectobacterium spp. was (16.07±0.31) mm. In addition, the strain QJXW44 can significantly inhibit the growth of a variety of pathogenic fungi and has antagonistic effects on a variety of plant pathogenic fungi. The highest inhibitory activity was against Botrytis cinerea, with an inhibition rate of 61.38%; the inhibition rate against Fusarium graminearum was 58.67%; and the lowest inhibitory activity was against Fusarium solani, with an inhibition rate of 36.77%. This indicates that Bacillus velezensis strain QJXW44 has potential biocontrol effects against a variety of plant pathogenic fungi, indicating that it has broad application potential in the field of plant disease control.

[0019] (6) Inducing effect on disease resistance of konjac plants: Bacillus velez QJXW44 can activate the disease resistance signal pathway of konjac and induce the increase of peroxidase and polyphenol oxidase activities of konjac. The relative protection effect of Bacillus velez QJXW44 suspension on soft rot disease is 46.62% when applied to the roots.

[0020] (7) Regulatory effect on the structure of rhizosphere microbial community of konjac: Root irrigation with suspension of Bacillus velezensis QJXW44 can dynamically reshape the structure of rhizosphere microbial community, significantly increase the abundance of beneficial bacteria of Proteobacteria, and inhibit the proliferation of pathogenic bacteria of Ascomycota, thus constructing a microecological environment that is beneficial to plant health.

[0021] (8) Improve the sustainability of the konjac industry: By using Bacillus velezensis QJXW44 for biological control, it can induce konjac to produce disease resistance and enhance the sustainability of the industry, protecting the economic interests of konjac growers. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 Figure for the results of plate confrontation culture of QJXW44 strain and its sterile fermentation liquid against Pectobacterium carotovorum in Example 1; Figure 2 Figure for the culture morphology of QJXW44 strain on LB solid medium in Example 2; Figure 3 Phylogenetic tree of 16S rRNA of QJXW44 strain in Example 2; Figure 4 Phylogenetic tree of housekeeping gene gyrA of QJXW44 strain in Example 2; Figure 5 Phylogenetic tree of housekeeping gene rpoB of QJXW44 strain in Example 2; Figure 6 Figure for the antibacterial effect of QJXW44 on 8 kinds of pathogenic bacteria in Example 3; Figure 7 Figure for the experimental results of QJXW44 bacterial suspension against Erwinia carotovora subsp. carotovora infection of konjac tuber tissue in Example 4; Figure 8 Figure for the experimental results of QJXW44 bacterial suspension against Erwinia carotovora subsp. carotovora infection of the top of konjac stem in Example 5; Figure 9 Figure for the experimental results of QJXW44 sterile fermentation liquid against Erwinia carotovora subsp. carotovora infection of konjac tuber tissue in Example 6; Figure 10 Figure for the experimental results of QJXW44 bacterial suspension against Pectobacterium carotovorum infection of konjac tuber tissue in Example 7; Figure 11 Figure for the experimental results of QJXW44 sterile fermentation liquid against Pectobacterium carotovorum infection of konjac tuber in Example 8; Figure 12 Comparison chart of growth promotion results in Example 10; Figure 13 QJXW44 gene circle in Example 11; Figure 14 Column chart of peroxidase (POD) activity changes in Amorphophallus konjac leaves in Example 12; Figure 15 Column chart of polyphenol oxidase (PPO) activity changes in Amorphophallus konjac leaves in Example 12; Figure 16 The differentially expressed genes in the leaf and bulb tissues of Amorphophallus konjac in Example 13; Figure 17 This is a Venn diagram of differentially expressed genes in the Konjac leaf samples in Example 13; Figure 18 This is a Venn diagram of differentially expressed genes in the konjac corm samples in Example 13; Figure 19 This is a graph showing the KEGG enrichment analysis results of the Konjac leaf and corm samples in Example 13; Figure 20 This is a heat map of some significantly differentially expressed genes between AY3 and BY3 samples in Example 13; Figure 21 1 is a histogram showing the expression levels of some genes with significant differences between AY3 and BY3 samples in Example 13; Figure 22 This is a heat map of some significantly differentially expressed genes between AY5 and BY5 samples in Example 13; Figure 23 This is a bar graph showing the expression levels of some genes with significant differences between AY5 and BY5 samples in Example 13; Figure 24 This is a heat map of some significantly differentially expressed genes between AJ3 and BJ3 samples in Example 13; Figure 25 This is a bar graph showing the expression levels of some genes with significant differences between AJ3 and BJ3 samples in Example 13; Figure 26 This is a heat map of some significantly differentially expressed genes between AJ5 and BJ5 samples in Example 13; Figure 27 This is a bar graph showing the expression levels of some genes with significant differences between AJ5 and BJ5 samples in Example 13; Figure 28 This is a graph showing the experimental results of the QJXW44 bacterial suspension in Example 14 against Erwinia carotovora subsp. carotovora infection of konjac corms; Figure 29 This is a graph showing the experimental results of the QJXW44 bacterial suspension in Example 15 for preventing and controlling Erwinia carrotus subsp. carrotus from infecting konjac plants; Figure 30 This is a graph showing the experimental results of the QJXW44 bacterial suspension in Example 16 for preventing and controlling soft-rot pectin bacteria infection in konjac corms; Figure 31 This is a graph showing the experimental results of the QJXW44 bacterial suspension in Example 17 for preventing and controlling soft-rot pectin bacteria from infecting konjac plants; Figure 32 is the relative abundance of species at the soil bacterial phylum level in Example 18; Figure 33For soil bacteria genus level species relative abundance in Example 18; Figure 34 For soil fungi phylum level species relative abundance in Example 18; Figure 35 For soil fungi genus level species relative abundance in Example 18. DETAILED DESCRIPTION

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed to be used in the embodiments or prior art description will be briefly introduced as follows. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0024] In order to make the technical problems, technical solutions and beneficial effects of the present application more clear, the present application will be further described in detail in combination with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and not to limit the present application.

[0025] The present application provides a bacillus velezensis strain QJXW44, the bacillus velezensis (Bacillus velezensis) Bacillus velezensis The bacillus velezensis QJXW44 was deposited at the China General Microbiological Culture Collection Center on May 10, 2024, with a preservation number of CGMCC No. 30596, and the address of the preservation unit is No. 3, Beichen West Road, Chaoyang District, Beijing, and the telephone number of the preservation unit is 010-64807355.

[0026] The present application also provides a microbial agent, wherein the active ingredient at least contains one of a bacterial suspension or a sterile fermentation broth of the bacillus velezensis QJXW44.

[0027] Specifically, the preparation method of the bacterial suspension of QJXW44 is as follows: after the bacillus velezensis QJXW44 is cultured on LB solid medium overnight, it is transferred to sterile LB liquid medium, and cultured at 28°C and 120 r / min for 24 h. The fermentation broth is centrifuged at 5000 r / min for 5 min to remove the supernatant, and the bacterial body is resuspended with sterile water to obtain the bacterial suspension. The preparation method of the sterile fermentation broth of QJXW44 is as follows: after the bacillus velezensis QJXW44 is cultured on LB solid medium overnight, it is transferred to sterile LB liquid medium, and cultured at 28°C and 120 r / min for 24 h. The fermentation broth is centrifuged at 5000 r / min for 5 min to retain the supernatant, and the supernatant is filtered through a sterile filter membrane to obtain the sterile fermentation broth, i.e. the sterile fermentation broth.

[0028] The present invention relates to the use of Bacillus velez QJXW44 in the preparation of a novel bacterial strain for inhibiting Erwinia carrot soft rot subspecies carrot soft rot ( E. carotovora subsp.carotovora, Ecc. ), soft rot pectin bacteria ( Pectobacterium aroidearum ), Botrytis cinerea ( Botryosphaeria dothidea ), Fusarium oxysporum ( Fusariumoxysporum ), Fusarium solani ( Fusarium solani )、Panax notoginseng Fusarium solani( Panax notoginseng Fusarium solani )、Clodia spp.( Neofusicoccum parvum graminearum ( Fusarium graminearum ), Alternaria alternata ( Alternaria alternata ) and Fusarium equisetum ( Fusarium equiseti ) products.

[0029] The invention relates to application of Bacillus velez QJXW44 in preparing a product for preventing and treating konjac soft rot.

[0030] The invention relates to application of Bacillus velez QJXW44 in preparing a konjac growth promoter product.

[0031] The invention relates to application of Bacillus velez QJXW44 in preparing a konjac resistance inducer product.

[0032] The invention relates to application of Bacillus velez QJXW44 in preparing a product for regulating the microbial community structure of konjac rhizosphere soil.

[0033] The following is a detailed description of the Bacillus velezensis strain QJXW44 and its applications provided by the present invention in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0034] Materials and Methods 1 Experimental Materials Konjac materials for the test: Konjac bulbs were obtained from Yunnan Jingtian Konjac Agriculture Co., Ltd.

[0035] Biocontrol strain: Bacillus Velez QJXW44, isolated, purified and screened from the rhizosphere soil of plants such as konjac, tobacco and tomato.

[0036] Test pathogen: Erwinia carotovora subsp. carotovora ( E. carotovora subsp.carotovora, Ecc. ), soft rot pectin bacteria ( Pectobacterium aroidearum ), Botrytis cinerea ( Botryosphaeria dothidea ), Fusarium oxysporum ( Fusariumoxysporum ), Fusarium solani ( Fusarium solani )、Panax notoginseng Fusarium solani( Panax notoginseng Fusarium solani )、Clodia spp.(Neofusicoccum parvum graminearum ( Fusarium graminearum ), Alternaria alternata ( Alternaria alternata ) and Fusarium equisetum ( Fusarium equiseti The above 10 pathogens were provided by the Plant Protection Teaching and Research Section of Kunming University.

[0037] Culture media and reagents: LB solid medium (Qingdao Haibo), LB liquid medium (Qingdao Haibo), CAS solid culture medium (Qingdao Haibo), Ashby solid medium: KH2PO4 0.2 g, MgSO4·7H2O 0.2 g, NaCl 0.2 g, CaCO3 5.0 g, mannitol 10.0 g, CaSO4·2H2O 0.1 g, agar powder 18-20 g, distilled water 1 L, pH 7.0; Inorganic phosphorus solid medium: glucose 10 g, (NH4)2SO4 0.5 g, NaCl 0.3 g, MgSO4·7H2O 0.3 g, FeSO4·7H2O 0.03 g, MnSO4·4H2O 0.03 g, KCl 0.3 g, Ca 3 (PO4) 22.0 g, agar 20 g, add distilled water to 1000 mL, adjust pH to 7.2-7.4; Salkowski colorimetric reagent: concentrated H2SO4 150 mL, 7.5 mL of 0.5 mol / L FeCl3, 250 mL of sterile water), MKB medium (acid hydrolyzed casein 5 g, MgSO4·7H2O 2.5 g, KH2PO4 2.5 g, glycerol 15 mL, deionized water 1000 mL, pH = 7.2; CAS detection solution (Solution 1: weigh 0.07 g CAS (chrome azurol) and dissolve it in 50 mL deionized water, then add 10 mL of a 1 mmol / L FeCl3 solution dissolved in 10 mmol / L HCl; Solution 2: weigh 0.06 g hexadecyl trimethylammonium bromide (HDTMA) and fully dissolve it in 40 mL deionized water).

[0038] Preparation of bacterial suspension: After the target bacteria (third generation) were cultured overnight on LB solid medium, they were transferred to sterile LB liquid medium and cultured at 28°C and 120 rpm for 24 h to obtain the fermentation broth. The fermentation broth was centrifuged at 5000 rpm for 5 min to remove the supernatant, and the bacteria were resuspended in sterile water. The concentration of the bacterial suspension was OD 600=0.3. (The amount of bacterial suspension used is reflected in the specific experimental method) Preparation of sterile fermentation broth: After the target bacteria (third generation) were cultured overnight on LB solid medium, they were transferred to sterile LB liquid medium and cultured at 28°C and 120 rpm for 24 h. The concentration of the fermentation broth was adjusted to OD 600 =0.3, centrifuge the fermentation broth at 5000 r / min for 5 minutes, and retain the supernatant. Filter the supernatant through a sterile filter membrane to prepare sterile fermentation broth. (The amount of sterile fermentation broth used is indicated in the specific experimental method.) Example 1 Isolation, Purification, Identification and Preservation of Bacillus velezensis QJXW44 1.1 Isolation and purification of QJXW44 Plant rhizosphere soil samples were separated by dilution plate method. 2 g soil sample was added with 18 g sterile water, shaken at 28°C and 120 rpm for 20 min, ultrasonicated in ultrasonic instrument for 1 min, and then the supernatant was diluted to 10 -2 , 10 -3 , 10 -4 Three gradients were prepared. 100 μL of each gradient was evenly spread on LB solid medium. Each treatment was repeated three times and incubated upside down at 37°C for 24 hours. Single colonies were selected based on colony morphology, size, color, and wetness, inoculated into LB medium, cultured and purified, and stored in 30% glycerol in a -80°C refrigerator for future use.

[0039] 1.2 Primary screening and secondary screening of QJXW44 1.21 The pathogen is Erwinia carotovora subsp. Using the plate standoff method, the isolated bacteria were tested for their antagonistic effects against Erwinia carotovora subsp. carotovora. Using a pipette, 150 μL of a suspension of Erwinia carotovora subsp. carotovora (OD600 = 0.3) was added to 150 mL of sterilized LB agar at 35°C. The mixture was shaken and poured into sterile Petri dishes, which were then cooled to form plates. Separate plates were inoculated with the isolated bacteria and 20 μL of the sterile fermentation broth to identify strains with antagonistic effects against the soft rot pathogen. The strains identified in the initial screening were rescreened for antagonistic effects against the soft rot pathogen, and the size of the inhibition zone was measured using the cross-hatch method.

[0040] Test results: The plate confrontation experiment showed that the diameter of the inhibition zone of Bacillus velezensis strain QJXW44 against Erwinia carrotus subsp. carrotus was (19.67±4.51) mm; the diameter of the inhibition zone of QJXW44 sterile fermentation liquid was (16.05±0.25) mm.

[0041] 1.22 the pathogenic bacteria is Pectobacterium carotovorum subsp. carotovorum The isolated bacteria were subjected to the determination of the antagonistic effect on Pectobacterium carotovorum by means of plate confrontation. 150 uL of Pectobacterium carotovorum bacterial suspension (OD600=0.3) was taken by a pipette gun and added to 150 mL of sterilized LB agar medium with a temperature of 35°C, which was shaken and poured into a sterile culture dish to cool into a plate. The isolated bacteria and 20 uL of bacterial sterile fermentation broth were inoculated in different plates respectively to screen out the strains with antagonistic effect on Pectobacterium carotovorum. The strains screened out by the primary screening were subjected to the re-screening of the antagonistic effect on Pectobacterium carotovorum, and the size of the inhibition zone was measured by means of cross method, as shown in FIG. 1. Figure 1

[0042] Experimental results: the inhibition zone diameter of Bacillus velezensis strain QJXW44 on Pectobacterium carotovorum subsp. carotovorum reached (19.00±3.16) mm (A, B), and the inhibition zone diameter of the sterile fermentation broth of QJXW44 on Pectobacterium carotovorum subsp. carotovorum reached (16.07±0.31) mm (C, D). Figure 1 Figure 1

[0043] Example 2 Identification and preservation of Bacillus velezensis QJXW44 2.1 Morphological identification The target strain was inoculated in LB solid medium and incubated at 28°C for 24 h, and the shape, size, color and moisture of the colony were observed.

[0044] Bacillus velezensis strain QJXW44 presented a milky white, semi-transparent, edge-creased colony on LB plate, as shown in FIG. 2. Figure 2

[0045] 2.2 Physiological and biochemical identification The target strain was subjected to the determination of gram staining, contact enzyme, malonic acid, glucose oxidation fermentation, methyl red, starch hydrolysis and gelatin liquefaction ability, and reference was made to the Common Bacteria System Identification Manual.

[0046] Gram staining Reference was made to the instruction of Bimanch biological gram staining solution. The slide was wiped with alcohol, dried on the alcohol lamp, and then a ring of sterilized deionized water was picked up on the slide with an inoculation ring, and a small amount of pure culture was picked up and smeared on the water droplet to be evenly dispersed, and the smear was inactivated and fixed on the alcohol lamp flame. 1-2 drops of crystal violet staining solution were added, and the staining was performed for 1 min, and the remaining dye was washed away with distilled water. After drying, gram iodine solution was added, and the action was performed for 1 min, and the remaining dye was washed away with distilled water. The decolorizing solution was added for 30 s, and then washed with water. The counterstaining solution was added, and the counterstaining was performed for 1 min, and the remaining dye was washed away with distilled water. After the slide was dried, it was observed and photographed under a microscope.​​​​

[0047] Malonic acid determination After the culture medium is prepared, dispense it into test tubes and sterilize at 121°C for 15 minutes. A blank control without malonic acid should also be prepared. Inoculate with a young bacterial strain and incubate at an appropriate temperature for 1-2 days. A positive result is if the culture medium changes from green to blue; a negative result is if the culture medium does not change color.

[0048] Catalase assay Take a small loop of the slant cultured for 24 hours with a platinum wire inoculation loop and smear it on a glass slide with 3% hydrogen peroxide. If bubbles are produced, it is positive; if no bubbles are produced, it is negative.

[0049] Methyl red assay After the culture medium is prepared, aliquot 4-5 mL into each tube and sterilize at 115°C for 30 minutes. Inoculate the test bacteria into the culture medium in duplicate and incubate at the appropriate temperature for 2 to 6 days. Finally, add one drop of methyl red reagent to the culture medium. A red color indicates a positive methyl red test reaction, while a yellow color indicates a negative reaction.

[0050] starch hydrolysis Spot a fresh slant culture onto a starch hydrolysis plate and incubate at an appropriate temperature. After 2-5 days of incubation, when distinct colonies have formed, add iodine solution to the plate. If the plate turns blue-black and a transparent circle around the colony remains, it indicates a positive starch hydrolysis result; if it remains blue-black, it indicates a negative result.

[0051] Gelatin liquefaction After the culture medium is prepared, dispense it into test tubes to a height of approximately 4-5 cm and steam sterilize at 115°C for 20 minutes. Inoculate the slant culture 18-24 hours old, and maintain two uninoculated blank controls. Incubate in a 20°C incubator for 2, 7, 10, 14, and 30 days. Observe growth and gelatin liquefaction at room temperature below 20°C. If bacterial growth is present, the gelatin surface is stable and there are no depressions, indicating a negative gelatin hydrolysis test. If the gelatin clot partially or completely becomes a fluid at temperatures below 20°C, it indicates a positive gelatin hydrolysis test. If bacterial growth is present but the gelatin has not liquefied, but small depressions appear beneath the bacterial moss on the gelatin surface (this should be compared to an uninoculated control tube, as gelatin cultured for extended periods may also become concave due to water loss), this also indicates mild hydrolysis and is recorded as positive. If bacterial growth is absent, it indicates either that the gelatin medium is not suitable for growth or that the basal medium is inappropriate.

[0052] Glucose oxidative fermentation The prepared culture medium is divided into test tubes, the medium height is about 4.5 cm, and the culture medium is sterilized at 115°C for 20 min. The 18-24 h young strain is used as a seed, and is inoculated by puncturing, 4 branches per plant. Among them, 2 branches are covered with sterilized vaseline liquid paraffin (1 / 3 liquid paraffin is added to 2 / 3 melted vaseline, and is autoclaved) with a thickness of about 0.5-1 cm to isolate air and close the tube. The other 2 branches are not sealed with oil as open tubes, and there are also unseeded closed and open tubes as controls. The results are observed after 1, 2, 3, 7 and 14 days of suitable temperature culture. The result inspection: only the open tube with acid production and yellowing is the oxidation type; the open tube and the closed tube with acid production and yellowing are the fermentation type.

[0053] The experimental results are as follows: purple red is found by Gram staining, and Gram negative; bubbles are produced by contact enzyme experiment, and positive; transparent discoloration circles around the colonies are found by starch hydrolysis, and starch hydrolysis positive; the bacterial solution is yellow by methyl red experiment, and negative; glucose oxidation fermentation, the open tube and the closed tube both produce acid and turn yellow, which is the fermentation type; gelatin is liquefied and becomes a flowable liquid, and gelatin hydrolysis positive; the culture medium changes from green to blue in malonic acid utilization, and positive.

[0054] 2.3 16S rRNA sequence analysis identification The B. velezensis strain QJXW44 is sent to Beijing Chengke Biological Technology Co., Ltd. for 16S rRNA sequencing, and the primers 16S-27F (AGAGTTTGATCCTGGCTCAG) and 16S-1492R (TACGGCTACCTTGTTACGACTT) are used. The sequencing results are compared by BLAST in NCBI, and the strain sequences with high similarity are screened out, and the MEGA.7.0.26 software is used to construct a phylogenetic tree. The 16S rRNA sequencing results show that QJXW44 and B. velezensis strain FZB42 (NR_075005.2) are clustered in the same branch, as shown in Figure 3 .

[0055] The measured 16S rRNA sequence of QJXW44 is as follows: 2.4 Identification by housekeeping gene gyrA and rpoB sequence analysis The B. velezensis strain QJXW44 was sent to Shenzhen Huada Gene Company Limited for housekeeping gene gyrA and rpoB sequence sequencing. The primers used were gyrA-42F (CAGTCAGGAAATGCGTACGTCCTT) and gyrA-1066R (CAAGGTAATGCTCCAGGCATTGCT), rpoB-2292F (AGGTCAACTAGTTCAGTATGGAC) and rpoB-3354R (AAGAACCGTAACCGGCAACTT). The sequencing results were subjected to BLAST comparison in NCBI, and the sequences of strains with high similarity were screened. The MEGA.7.0.26 software was used to construct a phylogenetic tree. The gyrA gene sequencing results showed that QJXW44 and B. velezensis strain Sneb2562 (PV089818.1) were clustered in the same branch, as shown in FIG. 2A. The rpoB gene sequencing results showed that QJXW44 and B. velezensis strain TF1 (OQ569544.1) were clustered in the same branch, as shown in FIG. 2B. Figure 4 Figure 5

[0056] The sequence of gyrA of QJXW44 determined is as follows: ​​GCGTTATCGTATCCCGGGCGCTTCCGGATGTGCGTGACGGTCTGAAGCCGGTTCACAGGCGGATTCTGTACGCAATGAATGATTTAGGCATGACCAGTGACAAACCATATAAAAAATCTGCCCGTATCGTCGGTGAAGTTATCGGTAAGTACCACCCGCACGGTGACTCAGCGGTTTACGAATCGATGGTCAGAATGGCGCAGGATTTTAACTACCGCTACATGCTTGTTGACGGACACGGCAACTTCGGTTCGGTTGACGGCGACTCAGCGGCCGCGATGCGTTACACAGAAGCGAGAATGTCAAAAATCGCAATGGAAATCCTCCGGGACATTACGAAAGATACGATTGATTATCAAGATAACTATGACGGCGCAGAAAGAGAACCTGTCGTCATGCCTTCGAGATTTCCGAATCTGCTCGTAAACGGAGCTGCCGGTATTGCGGTCGGAATGGCGACAAATATTCCTCCGCATCAGCTTGGGGAAGTCATTGAAGGCGTGCTTGCCGTAAGTGAGAATCCTGAGATTACAAACCAGGAGCTGATGGAATACATCCCGGGCCCGGATTTTCCGACTGCAGGTCAGATTTTGGGCCGGAGCGGCATCCGCAAGGCATATGAATCCGGACGGGGATCCATCACAATCCGGGCTAAGGCTGAAATCGAAGAGACATCATCGGGAAAAGAAAGAATTATTGTCACAGAACTTCCTTATCAGGTGAACAAAGCGAGATTAATTGAAAAAATCGCAGATCTTGTCCGGGACAAAAAAATCGAAGGAATTACCGATCTGCGTGACGAATCCGACCGTAACGGAATGAGAATCGTCATTGAGATCCGCCGTGACGCCAATGCTCACGTCATTTTGAATAACCTGTACAAACAAACGGCCCTGCAGACGTCTTTCGGAATCAACCTGCTGGCGCT The sequence of rpoB of QJXW44 determined is as follows: CAGTATGGACGACACCGCCAGCGCAGAAGCTATGCTCGCATTAGCGAAGTGTTAGAATTACCAAATCTCATTGAAATTCAAACCTCTTCTTATCAGTGGTTTCTTGATGAGGGTCTTAGAGAGATGTTTCAAGACATATCACCAATTGAGGATTTCACTGGTAACCTCTCTCTAGAGTTCATTGACTACAGTTTAGGAGATCCTAAGTATCCCGTTGAAGAGTCAAAAGAACGTGATGTGACTTACTCAGCTCCGCTGAGAGTGAAGGTTCGTTTAATTAACAAAGAAACTGGAGAGGTAAAAGACCAGGATGTCTTCATGGGTGATTTCCCTATTATGACAGATACCGGTACTTTTATCATCAACGGTGCAGAACGTGTTATCGTATCTCAGCTTGTTCGGTCTCCAAGTGTATATTTCAGTGGTAAAGTAGACAAAAACGGTAAAAAAGGTTTTACCGCGACTGTCATTCCAAACCGTGGCGCATGGTTAGAATACGAAACTGATGCGAAAGATGTTGTGTATGTCCGCATTGATCGCACACGTAAGTTG The Bacillus velezensis strain QJXW44 was identified as Bacillus velezensis by 16sRNA and housekeeping genes gyrA and rpoB determination.

[0057] 2.5 Preservation of the strain The Bacillus velezensis (Bacillus velezensis) Bacillus velezensis ) QJXW44 has been preserved in the China General Microbiological Culture Collection Center on May 10, 2024, with the preservation number CGMCC No. 30596, and the address of the preservation unit is: No. 3, Beichen West Road, Chaoyang District, Beijing, and the telephone number of the preservation unit is: 010-64807355.

[0058] Example 3 Inhibition of QJXW44 on other 8 kinds of pathogenic bacteria The inhibition effect of Bacillus velezensis strain QJXW44 on Botryosphaeria dothidea, Fusarium oxysporum, Fusarium solani, Fusarium solani f. pisi, Neofusicoccum parvum, Fusarium graminearum, Alternaria alternata and Fusarium equiseti was determined by flat plate confrontation method. The preserved eight pathogenic fungi (the third generation) were inoculated on PDA plates for activation. Bacillus velezensis strain QJXW44 (the third generation) was inoculated on LB solid medium for activation. The specific operation method is as follows: QJXW44 and pathogenic fungi were inoculated on PDA plates at the same time, pathogenic fungi were inoculated at the center of the plate, the diameter of the fungus cake was 6 mm, and QJXW44 was inoculated at a distance of 2.5 cm from the center of the fungus cake with a sterile toothpick, three repeats per dish. Cultured at 28°C, according to the growth of fungi, the inhibition rate of the target strain on pathogenic fungi was determined.

[0059] Inhibition rate = [(control colony diameter - treatment colony diameter) / control colony diameter] x 100% Experimental results: after 7 days of confrontation culture, Bacillus velezensis strain QJXW44 inhibited the growth of the above eight pathogenic fungi, and obvious inhibition zones appeared in the culture dishes during the confrontation culture, as shown in Figure 6 (A: Botryosphaeria dothidea; B: Fusarium solani f. pisi; C: Fusarium oxysporum; D: Fusarium equiseti; E: Alternaria alternata; F: Neofusicoccum parvum; G: Fusarium graminearum; H: Fusarium solani). The calculated inhibition rate is shown in Table 1: Table 1 Inhibition rate of QJXW44 on eight pathogenic fungi

[0060] The above results show that strain QJXW44 can significantly inhibit the growth of multiple pathogenic fungi, and has antagonistic effect on multiple plant pathogenic fungi. The inhibition activity on Botryosphaeria dothidea is the highest, with an inhibition rate of 61.38%; the inhibition rate on Fusarium graminearum is 58.67%; and the inhibition activity on Fusarium solani is the lowest, with an inhibition rate of 36.77%. It shows that Bacillus velezensis strain QJXW44 has potential biocontrol effect on multiple plant pathogenic fungi.

[0061] Example 4-8 is the in vivo antagonistic effect test of Bacillus velezensis strain QJXW44 on konjak soft rot disease Example 4 Experiment of QJXW44 bacterial suspension antagonizing Erwinia carotovora subsp. carotovora infection of konjak tuber tissue Healthy konjac bulbs were cut into pieces with a length of 2 cm, a width of 2 cm, and a height of 1.5 cm. The tissues were surface-disinfected with 75% ethanol and sodium hypochlorite and then washed 3-4 times with sterile water. Two cross cuts were made on the tissue surface with a sterile blade under a sterile environment. The bacterial solution was dripped into the center of the konjac piece with a sterile pipette tip and then placed in a culture dish with sterile filter paper. 20 μL of sterile water was added to the CK group; 20 μL (OD 2) of Erwinia carotovora subsp. carotovora suspension was added to the soft rot bacteria liquid group. 600 =0.3); the biocontrol liquid group was added with Erwinia carotovora subsp. carotovora suspension (OD 600 =0.3): Bacillus Velez strain QJXW44 bacterial suspension (OD 600 =0.3) 20 µL of a 1:1 mixture was added. Seven days after inoculation, the konjac corm tissue was observed for disease progression.

[0062] Grading standard: Level 0: no rot or discoloration; Level 1: rot and discoloration severity <20%; Level 2: rot and discoloration severity 20%-50%; Level 3: rot and discoloration severity 50%-80%; Level 4: rot and discoloration severity >80%.

[0063] Disease index = [∑(number of infections at each level × corresponding level)] / (total number of surveys × highest level) × 100%; Preventive effect = (control disease index - treatment disease index) / control disease index × 100%; Experimental results: The konjac corm tissue of the CK group had no discoloration and the disease severity was level 0; the konjac corm tissue of the soft rot bacteria liquid group had a more serious overall disease severity, with serious surface discoloration, a disease severity level of 2-4, and a disease index of 25.00%; the corm tissue of the biocontrol bacteria liquid group had a less serious overall disease severity, with a less serious surface discoloration, a disease severity level of 1-3, and a disease index of 13.89%, which was 11.11% lower than the disease index of the soft rot bacteria liquid group, and the relative control efficiency was 44.44%. Figure 7 As shown (A is CK group, B is soft rot fungus liquid group, C is biocontrol fungus liquid group).

[0064] Example 5 Antagonistic effect of QJXW44 bacterial suspension on Erwinia carotovora subsp. carotovora infection of konjac stem tips In the greenhouse, the planting substrate is sterilized soil, organic soil, and vermiculite at a ratio of 1:2:2. The thumb-sized konjac seed balls are planted in sterilized plastic pots with a bottom diameter of 7.6 cm, a height of 9 cm, and an inner diameter of 10 cm. Normal water and fertilizer management is performed. After the planted konjac leaves are fully unfolded, the experiment begins. Healthy konjac plants with similar growth conditions are selected, with one plant per pot. A 10 uL bacterial suspension is inoculated into the top of the konjac stem using a syringe. Two groups are set up, with the CK group inoculated with a bacterial suspension of Pectobacterium carotovorum subsp. carotovorum (OD 600 =0.3); and the biocontrol bacterial liquid group inoculated with a 1:1 mixed liquid of Pectobacterium carotovorum subsp. carotovorum and Bacillus velezensis strain QJXW44 (OD 600 =0.3) bacterial suspension, with 10 pots per group. Normal water and fertilizer management is performed during the experiment. The incidence of disease is counted 30 days after treatment, and the disease index and relative control effect are calculated.

[0065] Classification criteria: 0 level, normal whole plant, no disease site; 1 level, 1 / 3 leaf blackening and rotting, leaf stalk base not rotting and drooping, 1 / 5 stem rotting and discoloring; 2 level, 1 / 3-1 / 2 leaf blackening and rotting, leaf stalk base drooping, 2 / 5 stem rotting and discoloring; 3 level, more than 1 / 2 leaf blackening and rotting, leaf stalk base rotting and drying, 3 / 5 stem rotting and discoloring; 4 level, 4 / 5 stem rotting and blackening, stem bending; 5 level, corm rotting and blackening, plant lodging, whole plant rotting and drying.

[0066] Disease index = [∑(number of each level of infection x corresponding level)] / (total number of surveys x highest level) x 100%; Control effect = (disease index of control - disease index of treatment) / disease index of control x 100%; Experimental results: The konjac plant antagonism experiment showed that Bacillus velezensis strain QJXW44 had a certain control effect on konjac soft rot. The disease index of the CK group was 24.44%, and the disease index of the biocontrol bacterial liquid group was 17.78%, which was 6.66% lower than that of the CK group, and the control effect reached 27.25%. Compared with the CK group, the number of diseased konjac leaves and the area of diseased konjac leaves in the biocontrol bacterial liquid group were significantly reduced, or the degree of konjac stem disease was significantly reduced, as shown in Figures 1 and 2 (A and B are the CK group, and C and D are the biocontrol bacterial liquid group). Figure 8

[0067] Examples 4 and 5 showed that whether the konjac tubers were inoculated or the konjac plants were inoculated, the bacterial suspension of Bacillus velezensis strain QJXW44 had good antagonistic effect on Pectobacterium carotovorum subsp. carotovorum.

[0068] Example 6 ​Experiment of QJXW44 sterile fermentation broth antagonizing Erwinia carotovora subsp. carotovora infection of konjac cormel tissue The konjac cormel was cut in half, and a sterile puncher was used to punch holes on the surface of the konjac cormel. 20 μL of sterile water was added to the holes in the CK group; 20 μL of sterilized LB liquid medium was added to the LB culture liquid group; 20 μL of Erwinia carotovora subsp. carotovora fermentation broth was added to the soft rot bacteria liquid group; and 20 μL of a mixture of Erwinia carotovora subsp. carotovora fermentation broth and Bacillus velezensis strain QJXW44 sterile fermentation broth at a ratio of 1:1 was added to the biocontrol bacteria liquid group. Sterile water was used to keep the filter paper moist during the process. After 7 days of incubation, the disease incidence was observed, and the disease index and control effect were calculated.

[0069] Classification criteria: 0 level: no rotting discoloration; 1 level: rotting discoloration severity <20%; 2 level: rotting discoloration severity 20%-50%; 3 level: rotting discoloration severity 50%-80%; and 4 level: rotting discoloration severity >80%.

[0070] Disease index = [∑ (number of infections at each level x corresponding level)] / (total number of surveys x highest level) x 100%; Control effect = (disease index of the control - disease index of the treatment) / disease index of the control x 100%; Experimental results: The konjac cormel tissue in the CK group had no rotting discoloration, and the disease level was 0; the konjac cormel tissue in the LB culture liquid group had no overall rotting discoloration, and the disease level was 0; the konjac cormel tissue in the soft rot bacteria liquid group had a high overall disease level, rotting discoloration, and a foul odor, with a disease level of 2-4 and a disease index of 20.14%; and the konjac cormel tissue in the biocontrol bacteria liquid group had a low overall disease level, with a rotting discoloration degree and a disease level of 1-3, and a disease index of 11.80%, which was 8.34% lower than that of the soft rot bacteria liquid group, with a relative control effect of 41.41%, as shown in FIG. 1 (A is the CK group, B is the LB culture liquid group, C is the soft rot bacteria liquid group, and D is the biocontrol bacteria liquid group). Figure 9

[0071] Example 7 Experiment of QJXW44 bacterial suspension antagonizing Pectobacterium carotovorum infection of konjac cormel tissue Healthy flower konjac cormels were washed and cut into flower konjac cormel tissues with a size of about 2 cm x 2 cm x 1.5 cm. Sterile blades were used to cross two wounds on the surface of the flower konjac cormel tissues, and 75% ethanol and sodium hypochlorite were used for surface sterilization. The flower konjac cormel tissues were placed in a culture dish with sterile filter paper, and sterile water was used to keep the filter paper moist. 20 μL of bacterial suspension was inoculated in the center of the flower konjac cormel tissues using a pipette, and the culture dish was incubated in a 28°C constant temperature incubator. After 5 days, the disease incidence was observed and recorded.

[0072] ​Group A1, A2, A3 were set up, and the details of grouping treatment were as follows: Group A1: 20 μL sterile water was inoculated per dish.

[0073] Group A2: 20 μL P. carotovorum suspensions were inoculated per dish, wherein 10 μL P. carotovorum suspensions (OD 600 = 0.3) + 10 μL sterile water.

[0074] Group A3: 20 μL pathogenic bacteria and biocontrol bacteria mixed solution were inoculated per dish, wherein 10 μL P. carotovorum suspensions (OD 600 = 0.3) + 10 μL QJXW44 suspensions (OD 600 = 0.3).

[0075] Classification criteria: 0 level: normal, no disease; 1 level: 0 < disease area ≤ 20%; 2 level: 20% < disease area ≤ 50%; 3 level: 50 < disease area ≤ 80%; 4 level: disease area > 80%.

[0076] Disease index = [∑ (number of each level of infection × corresponding level number)] / (total number of investigation × highest level number) × 100%; Relative control efficiency = (control disease index - treatment disease index) / control disease index × 100%; Experimental results: QJXW44 suspensions had good antagonistic effect on soft rot. After 5 days of inoculation of P. carotovorum alone, the tissue of Z. aethiopica was obviously diseased, and was accompanied by strong odor. Compared with the control, the disease degree of Z. aethiopica mixed with QJXW44 suspensions (group A3) was significantly reduced, and there was no odor, as shown in FIG. 1 (A is group A1, B is group A2, and C is group A3). The relative control efficiency of QJXW44 suspensions on P. carotovorum was 49.39%. Figure 10

[0077] Table 2 Disease index of QJXW44 antagonistic experiment on Z. aethiopica in vitro tissue

[0078] Example 8 Antagonistic experiment of QJXW44 sterile fermentation broth on P. carotovorum infected Z. aethiopica corm tissue Healthy Z. aethiopica corms were taken, washed clean, and then the corms were cut in half. A sterile puncher was used to punch holes on the surface of the Z. aethiopica corms, and 75% ethanol and sodium hypochlorite were used for surface disinfection. The corms were placed in a culture dish with sterile filter paper, and sterile water was used to keep the filter paper moist. 20 μL of fermentation broth was inoculated into the hole of the corm using a pipette, and the culture was incubated in a 28°C constant temperature incubator. Groups B1, B2, and B3 were set up, and the details of grouping treatment were as follows: ​Group B1: Each dish was inoculated with 20 μL of sterilized LB liquid medium.

[0079] Group B2: Each dish was inoculated with 20 μL of soft-rot pectinobacterium fermentation broth, including 10 μL of soft-rot pectinobacterium fermentation broth + 10 μL of sterilized LB liquid medium.

[0080] Group B3: Each dish was inoculated with 20 μL of a mixture of pathogens and biocontrol bacteria, including 10 μL of fermentation broth of Pectinobacterium spp. and 10 μL of sterile fermentation broth of QJXW44.

[0081] After 5 days, the disease status was observed and recorded. The grading criteria, disease index, and relative control efficacy were calculated as above.

[0082] Experimental results: The sterile filtrate of QJXW44 showed a strong antagonistic effect against soft rot. Five days after inoculation with the soft rot pathogen alone, the konjac tissue showed significant disease, accompanied by a strong odor. Compared with the control, the konjac tissue inoculated with the sterile fermentation broth (Group B2) showed significantly less disease and no odor. The relative efficacy of the sterile fermentation broth of QJXW44 against the soft rot pathogen was 46.52%. Figure 11 As shown (D is group B1, E is group B2, and F is group B3).

[0083] Table 3 Disease index of QJXW44 antagonistic test on isolated tissues of Amorphophallus konjac

[0084] In general, both the bacterial suspension and sterile fermentation broth of Bacillus velezensis strain QJXW44 have good in vivo antagonistic effects on Erwinia carrotus subsp. carrotus and Pectobacterium soft rot, and can effectively reduce the disease index of konjac soft rot.

[0085] Examples 9 and 10 are experiments on the growth-promoting ability of Bacillus velezensis QJXW44.

[0086] Example 9 Experiment on Growth-Promoting Properties of Bacillus Velezii QJXW44 9.1 Determination of nitrogen-fixing ability of strains Take 10 μL of bacterial solution (OD 600 =0.3) was dropped onto the center of an Axubei solid culture medium plate, incubated upside down at 28-30°C for 5 days, and the colonies were observed to see whether they could grow normally.

[0087] 9.2 Determination of Phosphate Solubilization Ability of Strain A hole with a diameter of 6 mm was punched on the inorganic phosphorus solid culture medium, and the target strain suspension (OD 600 = 0.3) was dropped into the hole and cultured at 27℃ for several days. The formation of transparent zone was observed and the diameter of the phosphate-dissolving zone of the strain was measured.

[0088] Test results: Bacillus velezensis strain QJXW44 can grow normally on Azotobacter solid nitrogen culture medium, indicating that the strain has nitrogen fixation ability. On inorganic phosphorus solid medium, a phosphorus-dissolving ring (11.67±0.58) mm appeared, indicating that it has the ability to dissolve phosphorus.

[0089] 9.3 Determination of the ability of the strain to produce siderophores Qualitative determination: The activated test strain was cultured overnight in LB liquid medium, and the bacterial cells were collected by centrifugation at 5,000 r / min for 5 min, then washed with 1×PBS buffer for 3 times to prepare a bacterial suspension (about 10 8 cfu / mL), and 50 μL of the bacterial suspension was inoculated onto CAS medium plates and cultured at 28°C in the dark for 5 days. Strains that produced orange-yellow halos around the colonies were able to produce siderophores. The larger the halo, the stronger the ability to produce siderophores.

[0090] Quantitative determination: The strain with the ability to produce siderophores was inoculated into MKB medium and cultured at 37°C for 48 h at 180 r / min. The supernatant was then centrifuged at 100 rpm for 10 min, and CAS detection solution was added at a volume ratio of 1:1. The control was prepared by mixing CAS detection solution and deionized water at a volume ratio of 1:1. After 1 h, the absorbance of the sample was measured at 630 nm and recorded as A, and the absorbance of the control was recorded as Ar. A / Ar represents the relative content of siderophores.

[0091] Test results: An orange-yellow halo was produced on the CAS solid medium, indicating the ability to produce siderophores, and the A / Ar value was (0.60±0.61) determined quantitatively.

[0092] 9.4 Determination of the ability of the strain to produce IAA Qualitative determination: The isolated and purified strain was inoculated into LB liquid medium (with the addition of L-tryptophan to a final concentration of 0.5 g / L) and cultured at 28°C and 180 r / min for 48 h. After centrifugation, 50 μL of the supernatant was added to an equal volume of Salkowski colorimetric reagent and observed after color development for 30 min in the dark on a white porcelain plate. If pink color appeared, it was positive, indicating that the strain could secrete IAA.

[0093] Quantitative determination: Quantitative determination of IAA-secreting bacteria identified in the initial screening was performed. Centrifuge 10 mL of the bacterial suspension at 10,000 rpm for 10 minutes, and collect 2.5 mL of the supernatant for later use. Prepare IAA standard solutions with concentrations of 0, 10, 20, 30, 40, and 50 mg / L using analytically pure IAA. Mix with the Salkowski colorimetric reagent at a 1:1 volume ratio, incubate at room temperature in the dark for 30 minutes, and measure the OD 530 (using a 1:1 mixture of uninoculated liquid culture medium and the Salkowski colorimetric reagent as a blank control). Calculate the IAA concentration in the test solution using the standard curve (y = 0.0069x + 0.0057 R² = 0.9988).

[0094] Test results: After qualitative determination of IAA, the test solution turned pink, indicating that it had the ability to produce IAA. After quantitative detection of IAA, the concentration of IAA produced was calculated according to the IAA standard curve to be (47.48±0.58) mg / L.

[0095] The above experimental results show that Bacillus velez QJXW44 has significant growth-promoting properties, including the ability to fix nitrogen, solubilize phosphate, produce siderophores and produce IAA.

[0096] Example 10 Experiment on promoting the growth of konjac plants by Bacillus velez QJXW44 Sterilized soil was used as the cultivation medium. Sterilized soil and organic soil were mixed in a 1:1 ratio. Healthy konjac bulbs of uniform size were selected and planted in sterilized plastic pots with a bottom diameter of 7.6 cm, a height of 9 cm, and an inner diameter of 10 cm, with one plant per pot. After the konjac leaves emerged, the roots were irrigated with a suspension of Bacillus Velezii strain QJXW44 (once every 3 days, irrigated 10 times, OD 600 =0.3). The CK group consisted of 10 pots, each receiving 50 mL of water for root irrigation. The biocontrol liquid group consisted of 10 pots, each receiving 50 mL of a suspension of Bacillus velezensis strain QJXW44 for root irrigation. After root irrigation, the konjac plants were removed and measured, and their plant height, stem length, stem diameter, root length, number of taproots, fresh weight, and dry weight were recorded.

[0097] Experimental results: In the konjac plant growth promotion experiment, after the roots were irrigated with the bacterial suspension of Bacillus Velez strain QJXW44, it was found that the plant height, stem length, stem diameter, root length, number of main roots, fresh weight and dry weight were increased. The plant height of the CK group was 33.50 cm, the stem length was 9.3 cm, the stem diameter was 2.47 cm, the root length was 12.21 cm, the number of main roots was about 14, the fresh weight was 10.53 g and the dry weight was 1.48 g. The biocontrol liquid group had a plant height of 39.25 cm, a stem length of 10.03 cm, a stem diameter of 2.66 cm, a root length of 16.20 cm, about 17 main roots, a fresh weight of 12.96 g, and a dry weight of 1.77 g. Compared with the CK group, the plant height increased by 5.75 cm, or 17.16%, the stem length increased by 0.73 cm, or 7.85%, the stem diameter increased by 0.19 cm, or 7.69%, the root length increased by 3.99 cm, or 32.68%, the main root number increased by 3, or 18.37%, the fresh weight increased by 2.43 g, or 23.08%, and the dry weight increased by 0.29 g, or 19.59%. Figure 12 As shown (A is CK group, B is biocontrol liquid group). This shows that the strain can promote the growth and development of konjac.

[0098] In summary, Bacillus velez QJXW44 has good growth-promoting properties and can effectively promote the growth of konjac plants.

[0099] Example 11 The whole genome sequencing of QJXW44 revealed the antagonistic and growth-promoting abilities of Bacillus velezensis QJXW44 at the molecular level.

[0100] Bacillus velezensis strain QJXW44 was inoculated into LB liquid medium and cultured overnight at 28°C and 120 rpm. The cells were then centrifuged at 4°C and 8,000 rpm for 10 min. The cells were harvested, the supernatant discarded, and the suspension was washed three times with PBS buffer. The resulting cells, along with the centrifuge tube, were immersed in liquid nitrogen and completely frozen for 1 h. The cells were then sealed with dry ice and sent to Shanghai Meiji Biopharmaceutical Technology Co., Ltd. for whole-genome sequencing. Sequencing results were analyzed using the Meiji Bio Cloud Platform.

[0101] Whole genome sequencing results Whole-genome sequencing results showed that the chromosome size of strain QJXW44 was 3,922,452 bp, with an average GC content of 46.54%. The genome encodes 3,723 genes, including 27 rRNA genes, 86 tRNA genes, and 85 sRNA genes. According to NR, Swiss-Prot, Pfam, COG, GO, and KEGG functional annotations, the number of annotated genes was 3,718, 3,515, 3,320, 3,056, 2,274, and 2,361, respectively.Figure 13 as shown.

[0102] Different secondary metabolites with antibacterial activity are important biocontrol active factors of Bacillus, which can effectively inhibit harmful microorganisms in the rhizosphere of plants, induce the host plants to produce systemic resistance, and thus control the spread of plant diseases. Using Antismash, 13 secondary metabolite gene clusters were co-predicted, among which cluster4, cluster5, cluster6, cluster10 and cluster 13 had 100% similarity with the gene clusters of B. velezensis FZB42, and cluster 12 had 100% similarity with the gene clusters of B. subtilis subsp. subtilis str. 168. The similarity of cluster 1 gene cluster in strain QJXW44 with B. velezensis FZB42 was only 78%. While cluster 2 gene cluster had 7% similarity with B. circulans, and 5 un-predicted gene clusters (cluster 3, 7, 8, 9, 11) were found. It is speculated that there may be new antagonistic related gene clusters in strain QJXW44, which need to be further studied. In summary, QJXW44 can inhibit the growth of pathogenic substances by expressing functional genes of bacteriostatic related substances, indirectly promote plant growth, and has great application potential in later agricultural production.

[0103] Table 4 Details of QJXW44 secondary metabolite synthesis gene cluster analysis

[0104] Analysis of QJXW44 growth-promoting related genes Nitrogen, phosphorus, iron and IAA (indole acetic acid) are essential for plant growth and development. Nitrogen is mainly involved in the synthesis of nitrogen-containing compounds such as proteins, amino acids, nucleic acids, enzymes, chlorophyll, vitamins and alkaloids in plants, which has a significant impact on the quality and yield of plants. Phosphorus is an essential component of nucleic acids, proteins, phospholipids, auxins, ATP and phosphorus-containing enzymes, and actively participates in physiological processes such as photosynthesis, sugar metabolism, nitrogen metabolism and fat metabolism in plants. Iron plays a crucial role in plant growth and development, and is involved in respiration, chlorophyll biosynthesis, photosynthesis and other life processes. IAA (indole acetic acid) is a plant hormone that promotes root growth, increases absorption surface area and root length, and further promotes the absorption of mineral elements. We found genes such as nirB, narG, gudB, phoA, phoD, aroE, entA, trpA and trpB in the whole genome sequencing results, which may be related to nitrogen fixation, phosphorus dissolution, iron carrier production and IAA production. The discovery of these genes indicates that QJXW44 has the ability to fix nitrogen, dissolve phosphorus, produce iron carriers and produce IAA from a molecular level.

[0105] Table 5 Genes related to promoting activity in the genome of QJXW44

[0106] In summary, the whole genome sequencing results show that the strain has enzymes, proteins and genes related to nitrogen fixation, phosphorus dissolution, iron carrier production and IAA production. At the same time, 13 secondary metabolite gene clusters related to antagonism are predicted by antiSMASH software, which explains the ability of strain QJXW44 to promote growth and antagonism from a molecular level.

[0107] Examples 12-17 are the resistance induction effect of Bacillus velezensis strain QJXW44 on konjac plants and the greenhouse prevention and control effect on soft rot.

[0108] Example 12 Determination of konjac leaf peroxidase and polyphenol oxidase activity 12.1 Detection of peroxidase (POD) activity Konjac plants growing to about 20 cm were used as test materials, and QJXW44 bacterial suspension (OD 600 = 0.3) was used to irrigate the roots. Konjac leaves were collected at 0, 1, 3, 5, 7 and 9 days for experiments.

[0109] Enzyme solution preparation Weigh 5.0 g of konjac leaves and place them in a mortar. Add 5.0 mL of extraction buffer and grind into a homogenate under ice bath conditions. Centrifuge at 4°C, 12000 r / min for 30 min. Collect the supernatant as the enzyme extract and store at low temperature for future use.

[0110] Activity determination Take a test tube, add 3.0 mL of 25 mmol / L guaiacol solution and 0.5 mL of enzyme extract, and then add 200 μL of 0.5 mol / L H2O2 solution to start the reaction quickly, and at the same time, start timing immediately. Pour the reaction mixture into a colorimetric cup and place it in the sample chamber of the spectrophotometer. With distilled water as the reference, record the absorbance value of the reaction system at a wavelength of 470 nm at 15 s after the reaction as the initial value, and then record it every 1 min, continuously measure, and obtain at least 6 points of data. Repeat three times. Record the absorbance value of the reaction system at 470 nm, and plot the OD 470 value versus time curve, and calculate the absorbance change value OD 470 per minute according to the initial linear part of the curve.

[0111] Absorbance change value per minute of the reaction mixture; Absorbance termination value of the reaction mixture; Absorbance initial value of the reaction mixture; t p Reaction termination time, min; t I Reaction initial time, min; Then take 1 peroxide enzyme activity unit when the absorbance change value per gram of konjac leaf (fresh weight) per minute increases by 1, and the unit is .

[0112] The calculation formula is: ; In the formula, V represents the total volume of the sample extract, mL; Vs represents the volume of the sample extract taken for measurement, mL; and m represents the sample mass, g. The calculated POD activity results are shown in Table 1. Figure 14

[0113] 12.2 Polyphenol oxidase (PPO) activity detection Enzyme solution preparation Weigh 5.0 g of konjac leaves and place them in a mortar, add 5.0 mL of extraction buffer, and grind into a homogenate under ice bath conditions. Transfer the homogenate liquid into a centrifuge tube, centrifuge at 12000 r / min for 30 min at 4℃, collect the supernatant, and store it at low temperature for later use.

[0114] Activity determination ​​Take one test tube, add 4.0 mL of 50 mmol / L, pH 5.5 acetic acid-sodium acetate buffer and 1.0 mL of 50 mmol / L catechol solution, and finally add 100 μL of enzyme extract, and immediately start timing. Pour the reaction mixture into a colorimetric cup and place it in the sample chamber of the spectrophotometer. With distilled water as the reference, record the absorbance value of the reaction system at a wavelength of 420 nm at 15 s after the reaction begins as the initial value, and then record it every 1 min, continuously measuring, and obtain at least 6 points of data. Repeat three times.

[0115] Calculation results Record the absorbance value of the reaction system at 420 nm to make an OD 420 value-time curve, and calculate the absorbance change value per minute, △OD 420 , according to the initial linear part of the curve (from time I to time F).

[0116] ; In the formula △OD 420 is the absorbance change value per minute of the reaction mixture; OD 420F is the final absorbance value of the reaction mixture; OD 420I is the initial absorbance value of the reaction mixture; t F is the reaction termination time, min; t I is the reaction initial time, min; Take 1 unit of peroxidase activity when the absorbance change value per gram of konjac leaf (fresh weight) per minute increases by 1, and the unit is . The calculation formula is: ; In the formula: V represents the total volume of the sample extract, mL; Vs represents the volume of the sample extract taken for measurement, mL; and m represents the sample mass, g.

[0117] Experimental results: The calculated PPO activity results are shown in Figure 15 .

[0118] The determination results of POD and PPO enzyme activities of the leaves of the flower taro showed that the POD enzyme activity of the plant after the QJXW44 bacterial suspension was irrigated was significantly higher than that of the control, reached a peak at 7 d, and then decreased, and the POD activity of the leaves of the flower taro at 9 d showed a downward trend, but was still higher than that at 0, 1, 3 and 5 d. The PPO content of the leaves of the flower taro after the QJXW44 bacterial suspension was irrigated was significantly higher than that of the control group, and reached a maximum at 5 d, and the PPO activity of the leaves of the flower taro at 7 and 9 d showed a gradual downward trend, but was still higher than that at 0, 1 and 3 d. The results showed that the irrigation of QJXW44 could induce the increase of the activities of POD and PPO in the leaves of the flower taro.

[0119] Example 13 Transcriptome sequencing of taro leaf and corm samples Transcriptome analysis experimental method The flower taro planting method was the same as that in Example 5, and the experiment was carried out after the flower taro leaves were pulled out. Normal water and fertilizer management was carried out during the experiment. CK-3, CK-5, QJXW44-3 (OD 600 = 0.3) and QJXW44-5 (OD 600 = 0.3) groups were set, and each pot was irrigated with 50 mL. According to the sampling requirements, the leaf and corm epidermis tissue of the flower taro was taken, placed in a pre-cooled cryopreservation tube, and frozen in liquid nitrogen for 0.5 h before being transferred to a -80°C refrigerator for storage. Dry ice was stored and sent to Shanghai Meiji Biomedicine Technology Co., Ltd. for transcriptome analysis of the flower taro.

[0120] (1) The forceps, blades, beakers, glass culture dishes and the like were wiped clean with alcohol cotton, then wrapped in tin foil, and sterilized at 180°C for 4 h.

[0121] (2) The workbench was wiped with alcohol cotton, and then wiped again with non-woven fabric dipped in 75% alcohol.

[0122] (3) Tin foil was laid on the table, the tin foil was wiped with alcohol cotton, and subsequent operations were carried out on the tin foil laid table.

[0123] (4) The beakers, tin foil, forceps, dissecting scissors, blades and the like were washed with anhydrous ethanol, and then wiped with non-woven fabric dipped in 75% alcohol. Disposable masks and gloves were worn throughout the experiment, and the gloves were changed frequently.

[0124] (5) Young, well-growing, and representative plants were selected first. They were quickly washed with 1× PBS water to remove surface dirt, etc., and the residual water was absorbed with filter paper. Then, the plants were cut into 0.5 cm square pieces (the size of soybeans). The pieces were placed in pre-cooled Corning cryovials, the lids were tightened, and the pieces were quickly frozen in liquid nitrogen for 0.5 h. After being taken out, they were placed in self-sealing bags and transferred to a -80°C refrigerator for storage. The pieces were sealed with dry ice and sent to Shanghai Meiji Biotechnology Co., Ltd. for konjac transcriptome analysis.

[0125] Table 6 Transcriptome experimental processing details

[0126] Results: A total of 8,570 differentially expressed genes were analyzed using DESeq2. Among them, 987 genes were found in samples BY3 vs. AY3 (436 upregulated, 551 downregulated); 710 genes were found in samples BY5 vs. AY5 (263 upregulated, 447 downregulated); 3,256 genes were found in samples BJ3 vs. AJ3 (1,388 upregulated, 1,868 downregulated); and 2,934 genes were found in samples BJ5 vs. AJ5 (1,673 upregulated, 1,261 downregulated). The highest number of differentially expressed genes was observed on the third day of leaf and bulb growth, while the lowest number was observed on the fifth day. Figure 16 shown.

[0127] The Venn diagram analysis revealed that there were 2098 differentially expressed genes in the leaf samples, such as Figure 17 There are 5018 differentially expressed genes in the bulb samples, as shown in Figure 18 Among the differentially expressed genes in each combination, BY3 vs AY3 and BJ3 vs AJ3 have the largest number of genes, which are 1252 and 2670 respectively. Figure 20 Functional annotation and enrichment analysis of the differentially expressed gene sets in each sample can provide insights into the molecular mechanism by which QJXW44 root irrigation protects konjac plants from disease.

[0128] KEGG enrichment analysis of differentially expressed genes revealed that 27 genes were enriched in plant-pathogen interaction, 22 genes were enriched in MAPK signaling pathway - plant, 21 genes were enriched in plant hormone signal transduction, 18 genes were enriched in starch and sucrose metabolism, and 15 genes were enriched in protein processing in the endoplasmic reticulum in samples BY3 vs AY3; 23 genes were enriched in plant-pathogen interaction, 17 genes were enriched in photosynthesis -antenna proteins, 16 genes were enriched in photosynthesis, 15 genes were enriched in sphingolipid metabolism, and 14 genes were enriched in biotin metabolism in samples BY5 vs AY5; AJ3 had 42 enriched in hormone signal transduction, 38 enriched in phenylpropanoid metabolism (Phenylpropanoid biosynthesis), 35 enriched in glycolysis / gluconeogenesis (Glycolysis / Gluconeogenesis), 33 enriched in protein processing in the endoplasmic reticulum, and 31 enriched in starch and sucrose metabolism; BJ5 vs AJ5 had 38 enriched in plant hormone signal transduction, 33 enriched in protein processing in the endoplasmic reticulum, 30 enriched in plant-pathogen interaction, 28 enriched in phenylpropanoid metabolism, and 27 enriched in MAPK signaling pathway-plant, such as Figure 19 shown.

[0129] Compared with AY3 sample (root irrigated with water), up-regulated expression of CML 、 CALM 、 WRKY22 、 WRKY33 、 PR1 , peroxidase gene ( POD )and IAA ,like Figure 20 、 Figure 21 The expression levels of these genes in sample BY3 were significantly higher than those in sample AY3. CALM The expression level was upregulated most significantly.

[0130] Compared with the AY5 sample (root irrigation with water), up-regulated expression of CPK 、 4CL 、 POD 、 IAA 、 SAUR and down-regulated expression of JAZ were found in the BY5 sample (root irrigation with QJXW44), as shown in Figure 22 、 Figure 23 . The expression amount of JAZ gene in BY5 was significantly lower than that in AY5, while the expression amount of other genes except JAZ was significantly higher in BY5 than in AY5, among which POD was most obviously up-regulated in expression amount.

[0131] Compared with the AJ3 sample (root irrigation with water), up-regulated expression of RBOH 、 CML 、 NPR1 、 PR1 、 POD 、 IAA 、 SAUR and down-regulated expression of JAZ were found in the BJ3 sample (root irrigation with QJXW44), as shown in Figure 24 、 Figure 25 . The expression amount of JAZ in BJ3 was significantly lower than that in AJ3, while the expression amount of other genes except JAZ was significantly higher in BJ3 than in AJ3, among which IAA was most obviously up-regulated in expression amount.

[0132] Compared with the AJ5 sample (root irrigation with water), up-regulated expression of CALM 、 WRKY2 、 PR1 、 4CL 、 PAL 、 POD 、 SAUR and down-regulated expression of JAZ were found in the BJ5 sample (root irrigation with QJXW44), as shown in Figure 26 、 Figure 27 . The expression amount of JAZ in BJ5 was significantly lower than that in AJ5, while the expression amount of other genes except JAZ was significantly higher in BJ5 than in AJ5, among which JAZ was most obviously down-regulated in expression amount, POD and most obviously up-regulated in expression amount.

[0133] In summary, the interaction between plants and pathogens triggers the production of ROS (reactive oxygen species), activates the MAPK signaling pathway, regulates the accumulation of plant hormones, and promotes the synthesis of phenylpropanoid pathway in plants, forming a multi-level and multi-level disease resistance network.

[0134] In the present invention, significantly differentially upregulated genes were also annotated in leaf or bulb samples. RBOH, CML, CPK and CML, WRKY33, WRKY22 and WRKY2 , indicating that Bacillus velez QJXW44 induced the defense mechanism of Amorphophallus konjac. NPR1, PR1 and down-regulated expression JAZ It is speculated that QJXW44 may activate the jasmonic acid pathway after root irrigation, and may also enhance the response of konjac to salicylic acid signals, triggering a systemic acquired resistance defense response. PAL and 4CL It is speculated that root irrigation with QJXW44 may promote the accumulation of lignin in konjac, which is beneficial for resisting the invasion of pathogens.

[0135] At the same time, the transcriptome data were also annotated Aux / IAA and SAUR The upregulation of genes indicated that the QJXW44 strain activated the auxin signal transduction pathway in the konjac by secreting IAA.

[0136] Transcriptome sequencing revealed that peroxidase genes were upregulated in both leaves and bulbs, verifying at the genetic level that root irrigation with QJXW44 can increase the activity of POD in the leaves of konjac.

[0137] Example 14 Experiment on the prevention and control of Erwinia carrotus subsp. carrotus infection by QJXW44 bacterial suspension Planting medium: sterile soil: organic soil: vermiculite = 1:2:2. Healthy konjac bulbs of uniform size were planted in sterilized plastic pots with a base diameter of 7.6 cm, a height of 9 cm, and an inner diameter of 10 cm, with one plant per pot. Two groups of 15 pots each were set up, for a total of 30 pots. The CK group received root irrigation with clear water; the soft rot fungus group received root irrigation with a suspension of Erwinia carotovora subsp. carotovora (OD 600 =0.3); the biocontrol liquid group used QJXW44 bacterial suspension (OD 600 =0.3) + Erwinia carotovora subsp. carotovora suspension (OD 600 =0.3) Root irrigation was performed as follows: Before pathogen inoculation, the CK and soft rot bacteria liquid groups were irrigated with clean water, while the biocontrol liquid group was irrigated with a suspension of Bacillus velezensis strain QJXW44. 50 mL was used per pot, once every three days, for a total of three times. Three days after the root irrigation, each konjac corm was pierced with sterilized scissors. The CK group was irrigated with clean water, while the soft rot bacteria liquid and biocontrol liquid groups were irrigated with a suspension of Erwinia carotovora subsp. carotovora (OD = 0.3). 600 =0.3) Root irrigation, normal water and fertilizer management, dig out the bulbs after 30 days and calculate the disease index and prevention effect.

[0138] Grading standard: Grade 0, the konjac corm is normal, with no diseased parts; Grade 1, 0-1 / 10 of the konjac corm turns black and rots; Grade 2, 1 / 10-1 / 5 of the konjac corm turns black and rots; Grade 3, 1 / 5-3 / 10 of the konjac corm turns black and rots; Grade 4, 3 / 10-4 / 10 of the konjac corm turns black and rots; Grade 5, more than 1 / 2 of the konjac corm turns black and rots.

[0139] Experimental results: The biocontrol experiment on konjac bulbs showed that the Velezac Bacillus strain QJXW44 had a good control effect on the soft rot of konjac caused by Erwinia carrot subspecies. Although the wound part of the konjac bulb in the CK group turned black, it did not rot and had no tendency to spread outward; the soft rot fungus liquid group rotted seriously, and the diseased area had a tendency to continue to spread; the overall disease severity in the biocontrol fungus liquid group was not serious, and the disease severity was relatively unobvious. Among them, the disease index of the soft rot fungus liquid group was 71.56%, and the disease index of the biocontrol fungus liquid group was 52.45%, with a relative control efficiency of 26.70%. Figure 28 As shown (A is CK group, B is soft rot fungus liquid group, and C is biocontrol fungus liquid group).

[0140] Example 15 Experimental study on the control of Erwinia carotovora subsp. carotovora infection in konjac plants using QJXW44 bacterial suspension The experiment began after the leaves of the planted konjac were fully expanded. Healthy konjac plants with similar growth conditions were selected, with one plant per pot. Two groups were set up, with 20 pots in each group. The CK group was irrigated with water; the biocontrol liquid group used a suspension of Bacillus Velezii strain QJXW44 (OD 600 =0.3) irrigate the roots with 50 mL per pot, once every 3 days, for a total of 3 times. 3 days after the end of the root irrigation, use sterilized scissors to make wounds on each konjac corm and use a suspension of Erwinia carotovora subsp. carotovora (OD 600 =0.3) Root irrigation, followed by normal water and fertilizer management. After 30 days, dig up the plants and calculate the disease index and control efficacy. Calculations for disease index and control efficacy are the same as above.

[0141] Grading standard: Level 0, the whole plant is normal, with no diseased parts; Level 1, the inoculated part of the bulb turns black, but the diseased part does not expand significantly; Level 2, 0-1 / 3 of the bulb is diseased, but the diseased part does not expand significantly, and there are no obvious symptoms on the stem; Level 3, 1 / 3-1 / 2 of the bulb is diseased, with obvious symptoms at the base of the stem, and some leaves have obvious lesions; Level 4, more than 1 / 2 of the bulb is diseased, the stem has obvious symptoms, and the diseased part spreads upward along the stem, and the leaves turn yellow; Level 5, the plant falls over, and the whole plant turns yellow or dries up.

[0142] Experimental results: The root irrigation experiment of konjac plants also showed that the Velezac Bacillus strain QJXW44 has a good control effect on konjac soft rot caused by Erwinia carrot subspecies carrot soft rot. The disease index of the CK group was 52.00%, and the disease index of the biocontrol liquid group was 36.00%, with a relative control efficiency of 30.77%. Figure 29 As shown (A is the CK group, B is the biocontrol liquid group).

[0143] Example 16 Experiment on the prevention and control of soft rot pectinobacterium infection in konjac bulbs by using QJXW44 bacterial suspension Thumb-sized konjac bulbs were planted in sterilized plastic pots, one plant per pot. The experiment began one week after the bulbs were planted, with 15 pots per group. Normal watering and fertilization were maintained during the experiment. After 30 days, the bulbs were dug up and the disease index and control efficacy were calculated. Groups C1, C2, and C3 were established, and the group treatment details are as follows: Group C1: Root irrigation with clean water.

[0144] Group C2: water + soft rot pectinobacterium suspension irrigation (OD 600 =0.3).

[0145] Group C3: QJXW44 bacterial suspension (OD 600 =0.3) + soft rot pectinobacterium suspension (OD 600 =0.3) Root irrigation.

[0146] The specific implementation methods are as follows: Root irrigation was performed every 3 days for a total of 4 times, with 50 mL per pot each time. After the third root irrigation, each konjac corm was pierced with sterile scissors before the fourth root irrigation.

[0147] Table 7 Details of experimental methods for the control effect of QJXW44 bacterial suspension on konjac bulbs in greenhouse

[0148] Grading standard: Grade 0, the konjac corm is normal, with no diseased parts; Grade 1, 0 < the rotten part of the konjac corm ≤ 1 / 10; Grade 2, 1 / 10 < the rotten part of the konjac corm ≤ 1 / 5; Grade 3, 1 / 5 < the rotten part of the konjac corm ≤ 3 / 10; Grade 4, 3 / 10 < the rotten part of the konjac corm ≤ 2 / 5; Grade 5, the rotten part of the konjac corm > 2 / 5.

[0149] Experimental results: The greenhouse control experiment of konjac bulbs showed that the strain QJXW44 had a good control effect on the soft rot caused by soft rot pectin bacteria. In the water control group (C1 group), the wound part of the konjac bulb turned black, but did not rot, and there was no obvious trend of spreading to the surrounding areas; the soft rot fungus liquid group (C2 group) rotted seriously, and the diseased area had a clear trend of spreading to the surrounding areas; the QJXW44 bacterial suspension group (C3 group) had a lighter overall disease severity, and the diseased area spread to the surrounding areas more slowly. Figure 30 As shown (A is group C1, B is group C2, and C is group C3), the relative efficacy of QJXW44 suspension against soft rot of konjac was 46.62%.

[0150] Table 8 Disease index of QJXW44 bacterial suspension in greenhouse control experiment on konjac corms

[0151] Example 17 Experiment on the prevention and control of soft rot pectin bacteria infection in konjac plants using QJXW44 bacterial suspension Thumb-sized konjac bulbs were planted in sterilized plastic pots, one plant per pot. The experiment began after the leaves of the planted konjac fully expanded. Groups D1 and D2 were established, with 20 pots in each group. Normal water and fertilizer management was maintained throughout the experiment. After 30 days, the plants were dug up and the disease index and control efficacy were calculated.

[0152] Set up the groups as follows: Group D1: water + soft rot pectin bacteria suspension (OD 600 =0.3) Root irrigation.

[0153] Group D2: QJXW44 bacterial suspension (OD 600 =0.3)+soft rot pectinobacterium suspension (OD 600 =0.3) Root irrigation.

[0154] Root irrigation was performed every 3 days for a total of 4 times, with 50 mL per pot each time. After the third irrigation, each konjac rhizome was pierced with sterile scissors before the fourth irrigation.

[0155] Table 9 Details of the experimental method for the prevention effect of QJXW44 bacterial suspension on potted konjac plants

[0156] The grading standard is: 0 level, normal whole plant, no disease site; 1 level, bulb inoculation site blackening, but no obvious external expansion of the disease; 2 level, 0 < bulb disease part ≤ 1 / 3, but no obvious external expansion of the disease, and no obvious symptoms in the stem part; 3 level, 1 / 3 < bulb disease part ≤ 1 / 2, with obvious symptoms at the base of the stem, and some leaf parts have obvious disease spots; 4 level, bulb disease part > 1 / 2, with obvious symptoms in the stem, and the disease spreads upward along the stem, and the leaves are yellow and dry; 5 level, plant collapse, whole plant yellowing or dry.

[0157] The experimental results: the konjac plant control effect experiment also shows that the strain QJXW44 has a good control effect on the soft rot caused by Pectobacterium carotovorum, and the relative soft rot of the konjac plant bulb, stem and leaf of the QJXW44 bacterial suspension root irrigation group (D2 group) is more serious than that of the soft rot bacterial suspension root irrigation group (D1 group), as shown in (left for D1 group, right for D2 group). Figure 31 The disease index of D1 group is (63.61±2.09), and the disease index of D2 group is (32.78±1.74). The relative control effect of QJXW44 bacterial suspension on konjac soft rot is 48.47%.

[0158] In summary, the transcriptome sequencing and enzyme activity determination experiments show that Bacillus velezensis QJXW44 can activate the konjac disease resistance signal pathway, activate the expression of disease resistance related genes, and induce the increase of resistance related enzyme activity, thereby enhancing the disease resistance of konjac bulb and plant.

[0159] Example 18 Detection of konjac rhizosphere soil microbial diversity The experiment was carried out in the greenhouse of Kunming College, and healthy 1-year-old konjac bulbs were used as experimental materials. QJXW44 bacterial suspension (OD 600 =0.3) was used for root irrigation, 50 mL per pot, and root irrigation was only performed once. The konjac rhizosphere soil samples at 0, 2, 4, 6 and 8 weeks were collected using sterile centrifuge tubes and stored in an ultra-low temperature refrigerator, and were sent to Shanghai Meiji Biological Medicine Technology Co., Ltd. for detection. Among them, bacterial primers 338F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') were used, and fungal primers ITS1F (5'-CTTGGTCATTTAGAGGAAGTAA-3') and ITS2R (5'-GCTGCGTTCTTCATCGATGC-3') were used. Data analysis was performed relying on the Meiji biological cloud platform (https: / / cloud.majorbio.com).

[0160] Experimental results: bacterial and fungal community alpha diversity analysis The Chao index is used to estimate the total number of unobserved species in a community. The Chao index can reflect the community richness in a sample. The larger the value, the higher the community richness. Shannon index: An index used to estimate the diversity of microorganisms in a sample. The larger the Shannon value, the higher the community diversity. The lower the Simpson index, the higher the community diversity. Coverage: refers to the coverage rate of each sample library. The higher the value, the higher the probability that the sequence in the sample will be detected, and the lower the probability that it will not be detected. This index reflects whether the sequencing results represent the actual situation of the microorganisms in the sample.

[0161] In bacterial community diversity analysis (Table 8), QJXW44 root irrigation increased bacterial community richness and diversity in the rhizosphere soil. In fungal community diversity analysis (Table 9), although fungal community richness increased, fungal community diversity decreased. Furthermore, the coverage of both bacteria and fungi in the rhizosphere soil of Amorphophallus konjac reached over 99%, indicating that the sample tested was representative, and the sequencing results can be used for subsequent community structure analysis.

[0162] Table 10 Alpha diversity index of soil bacterial community after root irrigation of QJXW44

[0163] Note: The data are the average of three repeated experiments. Data are mean ± standard deviation. Different letters after the data in the same column indicate significant differences (P < 0.05).

[0164] Table 11 Alpha diversity index of soil fungal community after root irrigation of QJXW44

[0165] Note: The data are the average of three repeated experiments. Data are mean ± standard deviation. Different letters after the data in the same column indicate significant differences (P < 0.05).

[0166] Analysis of bacterial community composition at the phylum and genus levels The results of bacterial phylum level analysis showed that the relative abundance of 10 phyla exceeded 1%, including Proteobacteria, Chloroflexi, Actinobacteriota, Acidobacteriota, Bacteroidota, Myxococcota, Firmicutes, Patescibacteria, Gemmatimonadota and Cyanobacteria. Among them, Proteobacteria accounted for 32.45%-38.96% of the bacterial community, such as Figure 32 There are 32 bacterial groups with a relative abundance of more than 1% at the genus level, with norank_f_A4b accounting for the highest proportion and showing an increasing trend, as shown in Figure 2. Figure 33 As shown in the figure, it indicates that the root irrigation of strain QJXW44 changed the population abundance of bacteria in the rhizosphere soil of konjac at the phylum and genus levels.

[0167] Analysis of fungal community composition at the phylum and genus levels In terms of fungal community grouping, the relative abundance of seven fungal phyla, including Ascomycota, unclassified_k_Fungi, Basidiomycota, Fungi_phy_Incertae_sedis, Chytridiomycota, Rozellomycota, and Mortierellomycota, was greater than 1%, and Ascomycota was the main fungal phylum in the rhizosphere soil of Amorphophallus konjac, accounting for 58%-72% of the fungal community. Figure 34 At the genus level, there are 28 fungal groups with a relative abundance of more than 1%, such as Figure 35 As shown in the figure, unclassified_c__Sordariomycetes accounted for the highest proportion and showed an increasing trend. This indicates that root irrigation with strain QJXW44 altered the abundance of fungi in the rhizosphere soil of Amorphophallus at the phylum and genus levels.

Claims

1. A strain of Bacillus velez QJXW44, characterized in that: The Bacillus velez ( Bacillus velezensis ) QJXW44 was deposited in the General Microbiology Center of China Culture Collection Administration on May 10, 2024, with the deposit number CGMCC No. 30596.

2. A bacterial agent, characterized in that: The active ingredient contains at least one of the bacterial suspension or sterile fermentation liquid of the Bacillus velezensis QJXW44 according to claim 1.

3. The method for preparing the primary extract of the fermentation broth of Bacillus Velez QJXW44 according to claim 2, characterized in that: The QJXW44 bacterial suspension is prepared by culturing Bacillus velezensis QJXW44 on LB solid medium overnight, transferring the culture to sterile LB liquid medium, culturing at 28°C and 120 rpm for 24 hours, centrifuging the fermentation broth at 5000 rpm for 5 minutes, removing the supernatant, and resuspending the cells in sterile water to prepare a bacterial suspension. The method for preparing the sterile fermentation broth of QJXW44 is as follows: after culturing Bacillus velezensis QJXW44 on LB solid culture medium overnight, transferring it to sterile LB liquid culture medium, culturing it at 28°C and 120 r / min for 24 hours, centrifuging the fermentation broth at 5000 r / min for 5 minutes, retaining the supernatant, and filtering the supernatant through a sterile filter membrane to obtain a sterile fermentation broth.

4. The Velez subsp. carotovora ... E.carotovorasubsp.carotovora, Ecc.), Botrytis cinerea ( Botryosphaeriadothidea ), Fusarium oxysporum ( Fusariumoxysporum ), Fusarium solani ( Fusariumsolani ) products.

5. The Velez subsp. QJXW44 according to claim 1 is used in the preparation of a method for inhibiting soft rot pectin bacteria ( Pectobacterium aroidearum )、Panax notoginseng Fusarium solani( Panax notoginseng Fusarium solani )、Clodia spp.( Neofusicoccum parvum graminearum ( Fusarium graminearum ), Alternaria alternata ( Alternaria alternata ) and Fusarium equisetum ( Fusarium equiseti ) products.

6. Use of the Bacillus velezensis QJXW44 according to claim 1 in preparing products for preventing and treating konjac soft rot caused by infection with Erwinia carrot subspecies.

7. Use of the Bacillus velezensis QJXW44 according to claim 1 in preparing products for preventing and treating konjac soft rot caused by infection with Erwinia carrots.

8. Use of the described Bacillus Velez subtilis QJXW44 of claim 1 in preparing a konjac growth promoter product.

9. Use of the Bacillus Velez subtilis QJXW44 according to claim 1 in preparing a konjac resistance inducer product.

10. Use of the Bacillus Velez QJXW44 according to claim 1 in preparing a product for regulating the microbial community structure in the rhizosphere soil of konjac.

Images