Nucleic acid aptamer aiming at CD147 protein as well as screening method and application of nucleic acid aptamer
By using the engineered living cell-SELEX technology, nucleic acid aptamers that specifically recognize CD147 protein were screened out, solving the problem of insufficient specificity and affinity in recognizing CD147 protein in existing technologies and realizing the application potential in tumor diagnosis and treatment.
Patent Information
- Application Number
- CN202510914136.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-03
- Publication Date
- 2025-10-10
AI Technical Summary
The existing technology lacks highly specific and high-affinity nucleic acid aptamers for recognizing CD147 protein, which limits its application in tumor diagnosis and treatment.
The engineered live cell-SELEX technology was used to screen nucleic acid aptamers that specifically recognize the CD147 protein. An engineered cell line overexpressing the CD147 protein was constructed in CHO-K1 cells using a lentiviral system, and the specificity and affinity of the aptamer were improved through positive and negative screening.
The screened nucleic acid aptamers can efficiently and specifically recognize CD147 protein and have broad application prospects, especially in the field of tumor diagnosis and treatment related to CD147 markers.
Smart Images

Figure CN120758510A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biopharmaceuticals, and in particular relates to a nucleic acid aptamer targeting CD147 protein, a screening method thereof, and an application thereof. Background Art
[0002] Aptamers are DNA or RNA molecules that specifically bind to a target, identified through systematic evolution of ligands by exponential enrichment (SELEX). Due to their exceptional specificity and affinity, they have attracted widespread attention in the field of selective target recognition. Compared to antibodies, aptamers offer advantages such as simplified synthesis, ease of functionalization, low immunogenicity, and low cost, thus holding broad application prospects in areas such as drug delivery, disease diagnosis, and treatment.
[0003] CD147, also known as outer membrane protein matrix metalloproteinase inducer (EMMPRIN) or basal cell surface antigen, is a transmembrane glycoprotein. Studies have shown that it plays an important role in various physiological and pathological processes, including cell signaling, cell adhesion, inflammation, and the occurrence and development of tumors. It is highly expressed in a variety of tumor cells and tissues. CD147 promotes tumor infiltration and metastasis by inducing the secretion of matrix metalloproteinases and is considered a potential target for the diagnosis and treatment of various diseases.
[0004] With the advent of the era of precision medicine, the development of highly specific molecular tools targeting specific biomarkers has become increasingly important. Screening for nucleic acid aptamers targeting the CD147 protein can provide support in areas such as tumor diagnosis and disease treatment related to the CD147 marker. Summary of the Invention
[0005] To address the shortcomings of existing technologies, the present invention aims to provide a nucleic acid aptamer targeting the CD147 protein, as well as a screening method and application thereof. This invention utilizes an engineered live cell-SELEX technique to screen for nucleic acid aptamers that specifically recognize the CD147 protein, demonstrating significant potential for application in the field of ligand recognition targeting CD147.
[0006] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:
[0007] In a first aspect, the present invention provides a nucleic acid aptamer targeting CD147 protein, wherein the nucleotide sequence of the nucleic acid aptamer is shown in any one of SEQ ID NOs: 1-4.
[0008] In the present invention, the nucleic acid aptamers include full-length sequences (DC6 and DC32), and truncated sequences (DC6S2 and DC32S4).
[0009] The nucleotide sequence of the full-length DC6 is shown in SEQ ID NO: 1:
[0010] ATACCAGCTTATTCAATTACTCCAGTGGCATATTATGTAGGCGTAGGGCTATGCGGAAAGATAGTAAGTGCAATCT.
[0011] The nucleotide sequence of the full-length sequence DC32 is shown in SEQ ID NO: 2:
[0012] ATACCAGCTTATTCAATTACTCGAGTGGCATATAATGTAGGCGTAGGGCTAGGCGGAGAGATAGTAAGTGCAATCT.
[0013] The nucleotide sequence of the truncated sequence DC6S2 is shown in SEQ ID NO: 3:
[0014] CAATTACTCCAGTGGCATATTATGTAGGCGTAGGGCTATGCGGAAAGAT AGTAAGTG.
[0015] The nucleotide sequence of the truncated sequence DC32S4 is shown in SEQ ID NO: 4:
[0016] CTCGAGTGGCATATAATGTAGGCGTAGGGCTAGGCGAG.
[0017] In the present invention, the aptamers DC6 and DC32 and their truncated sequences DC6S2 and DC32S4 were experimentally verified to exhibit higher binding capacity than the control group m-Lib in all tested cancer cell lines (MBA-MD-231, HCT8, HCT116, HT29, SKOV-3, and SW480), indicating that these aptamers can specifically recognize and bind to the surface of the CD147 protein. The four candidate aptamer sequences all bound to CD147 cells to varying degrees, but had little binding to CHO-K1 cells, further indicating that the candidate aptamers had a targeting effect on CD147. It can be seen that the aptamers screened in the present invention have high affinity and specificity for CD147 and have broad application prospects in the field of ligand recognition related to the CD147 marker.
[0018] In a second aspect, the present invention provides use of the nucleic acid aptamer against CD147 protein described in the first aspect in the preparation of a drug for treating tumors associated with CD147 expression.
[0019] In a third aspect, the present invention provides use of the nucleic acid aptamer against CD147 protein described in the first aspect in the preparation of a drug targeted delivery vehicle.
[0020] In a fourth aspect, the present invention provides use of the nucleic acid aptamer against CD147 protein described in the first aspect in detecting cells expressing CD147 protein.
[0021] In a fifth aspect, the present invention provides a conjugate of a nucleic acid aptamer, wherein the conjugate comprises the nucleic acid aptamer for CD147 protein described in the first aspect and a conjugate connected to the nucleic acid aptamer.
[0022] Preferably, the conjugate is any one or a combination of at least two of detection, labeling, diagnosis or treatment substances.
[0023] In a specific embodiment of the present invention, the conjugate of the nucleic acid aptamer is a conjugate of a nucleic acid aptamer targeting CD147 protein and biotin.
[0024] In a specific embodiment of the present invention, the conjugate of the nucleic acid aptamer is a conjugate of a nucleic acid aptamer targeting CD147 protein and a fluorescent dye.
[0025] In the present invention, the fluorescent dye-coupled aptamer sequence can be used for specific labeling and imaging of CD147 positive cell surface proteins.
[0026] In a sixth aspect, the present invention provides a kit for detecting CD147 protein, wherein the kit comprises the nucleic acid aptamer for CD147 protein according to the first aspect or the conjugate of the nucleic acid aptamer according to the fifth aspect.
[0027] In a seventh aspect, the present invention provides a method for screening nucleic acid aptamers for CD147 protein according to the first aspect, the method comprising: transferring the human CD147 expression gene into wild-type CHO-K1 cells through a lentiviral system to construct an engineered cell line overexpressing CD147 protein; using untransfected CHO-K1 cells as negative screening cells; using the constructed CD147 engineered cell line as positive screening cells; and using live cell-SELEX technology to screen out CD147-specific nucleic acid aptamers.
[0028] Preferably, the nucleotide sequence of the human CD147 expression gene is shown in SEQ ID NO: 5.
[0029] Preferably, after screening out the CD147-specific nucleic acid aptamers, the method further comprises the steps of predicting the secondary structure of the aptamers using M-fold and optimizing the truncation of the candidate sequences.
[0030] Compared with the prior art, the present invention has the following beneficial effects:
[0031] (1) The present invention provides a nucleic acid aptamer that can specifically bind to the CD147 protein.
[0032] (2) The CD147 nucleic acid aptamer candidate sequence provided by the present invention can specifically recognize tumor cell lines with high expression of CD147.
[0033] (3) The advantages of the screening method based on engineered living cell-SELEX (Cell-SELEX) include: ① Using living cells for screening to improve the ability of aptamers to recognize the natural conformation of the cell membrane; ② Artificially inducing the production of target proteins on the surface of CHO-K1 cell membranes as positive screening cells, and using unmodified CHO-K1 cells as negative screening cells to improve the specificity of aptamers. BRIEF DESCRIPTION OF THE DRAWINGS
[0034] Figure 1 This is the confocal imaging data of the engineered high-expression CD147 cell line in Example 1.
[0035] Figure 2 Schematic diagram of screening CD147 aptamers using the Cell-SELEX method in Example 2.
[0036] Figure 3 This is a flow cytometry result diagram of the enrichment libraries screened in rounds 4, 6, 8, 10, and 12 in Example 3, as well as the interaction between the screening library m-Lib and the engineered cells CD147.
[0037] Figure 4 It is a flow cytometry result diagram of the enrichment libraries of rounds 4, 6, 8, 10, and 12 screened in Example 3 and the interaction between the screening library m-Lib and the control cell CHO-K1.
[0038] Figure 5 This is the binding of the full-length sequences (DC6 and DC32) and truncated sequences (DC6S2 and DC32S4) in Example 4 to the target cell CD147.
[0039] Figure 6 This is the binding of the full-length sequences (DC6 and DC32) and truncated sequences (DC6S2 and DC32S4) in Example 4 to the control cell CHO-K1.
[0040] Figure 7 Graph showing the flow cytometry results of the interaction between the full-length sequences (DC6 and DC32) and truncated sequences (DC6S2 and DC32S4) and MBA-MD-231 cells in Example 5.
[0041] Figure 8 Graph showing the flow cytometry results of the interaction between the full-length sequences (DC6 and DC32) and truncated sequences (DC6S2 and DC32S4) and HCT8 cells in Example 5.
[0042] Figure 9 Graph showing the flow cytometry results of the interaction between the full-length sequences (DC6 and DC32) and truncated sequences (DC6S2 and DC32S4) in Example 5 and HCT116 cells.
[0043] Figure 10 Graph showing the flow cytometry results of the interaction between the full-length sequences (DC6 and DC32) and truncated sequences (DC6S2 and DC32S4) and HT29 cells in Example 5.
[0044] Figure 11 This is a flow cytometry experiment result showing the interaction between the full-length sequences (DC6 and DC32) and the truncated sequences (DC6S2 and DC32S4) and SKOV-3 cells in Example 5.
[0045] Figure 12 This is a flow cytometry experiment result showing the interaction between the full-length sequences (DC6 and DC32) and the truncated sequences (DC6S2 and DC32S4) and SW480 cells in Example 5.
[0046] Figure 13 This is the confocal imaging data of the binding of the full-length sequences (DC6 and DC32) and truncated sequences (DC6S2 and DC32S4) in Example 6 to CD147 and CHO-K1 cells.
[0047] Figure 14 This is a flow cytometry result of the binding affinity of the candidate sequence DC6 to cells with high CD147 expression in Example 7.
[0048] Figure 15 This is a flow cytometry result of the binding affinity of the candidate sequence DC6S2 to cells that highly express CD147 in Example 7.
[0049] Figure 16 This is a graph showing the results of a flow cytometry experiment on the binding affinity of the candidate sequence DC32 to cells that highly express CD147 in Example 7.
[0050] Figure 17 This is a graph showing the binding affinity flow cytometry results of the candidate sequence DC32S4 in Example 7 with cells that highly express CD147. DETAILED DESCRIPTION
[0051] To address the gaps in the existing technology, the inventors, through research and practice, have developed the technical solution of the present invention. The main achievement of this invention lies in the innovative use of engineered live cell-SELEX (Cell-SELEX) technology to screen nucleic acid aptamers that specifically recognize the CD147 protein, which has great application potential in the field of ligand recognition targeting CD147.
[0052] The relevant technical solutions and implementation processes of the present invention are as follows:
[0053] The present invention provides a nucleic acid aptamer targeting CD147 protein, having the nucleotide sequence shown below, including DC6 and its truncated sequence DC6S2, and DC32 and its truncated sequence DC32S4.
[0054] The nucleotide sequence of SEQ ID NO: 1 is specifically:
[0055] ATACCAGCTTATTCAATTACTCCAGTGGCATATTATGTAGGCGTAGGGCTATGCGGAAAGATAGTAAGTGCAATCT.
[0056] The nucleotide sequence of SEQ ID NO: 2 is specifically:
[0057] ATACCAGCTTATTCAATTACTCGAGTGGCATATAATGTAGGCGTAGGGCTAGGCGGAGAGATAGTAAGTGCAATCT.
[0058] The nucleotide sequence of SEQ ID NO: 3 is specifically:
[0059] CAATTACTCCAGTGGCATATTATGTAGGCGTAGGGCTATGCGGAAAGAT AGTAAGTG.
[0060] The nucleotide sequence of SEQ ID NO: 4 is specifically:
[0061] CTCGAGTGGCATATAATGTAGGCGTAGGGCTAGGCGAG.
[0062] The present invention utilizes a method for screening CD147 nucleic acid aptamers based on engineered cells, comprising:
[0063] (1) Using a lentiviral system, CD147 expression gene was introduced into CHO-K1 cells to obtain a cell line overexpressing CD147, which was used as a target cell for positive screening.
[0064] The nucleotide sequence of the CD147 expression gene is specifically SEQ ID NO: 5:
[0065]
[0066] (2) Wild-type CHO-K1 cells were used as control cells for negative screening.
[0067] The CD147 nucleic acid aptamer candidate sequence provided by the present invention can specifically recognize tumor cell lines with high expression of CD147.
[0068] In order to more clearly describe the technical solutions and research results of the present invention, the technical solutions of the present invention are further described below by specific embodiments. Scientific researchers can provide content based on the present invention, and other research methods derived without conducting creative research all fall within the scope of protection of the present invention. It should be understood by those skilled in the art that the embodiments are merely to help understand the present invention and should not be regarded as specific limitations of the present invention.
[0069] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.
[0070] Example 1
[0071] In this example, an engineered cell line overexpressing CD147 was constructed, and the specific method is as follows:
[0072] The expression vector pHBLV was digested with EcoR I and BamH I exonucleases and ligated with the target fragment to obtain an expression plasmid containing the target gene. The plasmid was then packaged with the packaging helper plasmids psPAX2 and pMD2G for lentiviral packaging, and the lentiviral supernatant was collected to infect the host cell CHO-K1.
[0073] When CHO-K1 cells reached 50% confluency, the CD147 viral vector and polybrene were added to the culture medium of the CHO-K1 cells. After 24 hours, the culture medium was replaced with complete culture medium and cultured for another 48 hours. Subsequently, selective culture was performed using a culture medium containing 4 μg / mL puromycin to ensure stable expression of the target gene.
[0074] To investigate the expression of CD147 protein on the surface of constructed cells, an Olympus FV500 IX81 laser scanning confocal fluorescence microscope was used for analysis. The specific protocol is as follows:
[0075] CHO-K1 cells and CD147 cells were seeded into 24-well plates and cultured at 37°C and 5% CO2 for 36 hours. After washing with PBS, CD147 antibody containing 3% BSA was added and incubated at 4°C for 30 minutes. After washing with PBS, AlexaFluor 647-labeled secondary antibody was added and incubated in the dark for 30 minutes. At the same time, the cell nuclei were stained with Hoechst 33342 and the cells were washed with PBS for laser confocal imaging analysis ( Figure 1 ), the results showed that compared with CHO-K1 cells, the fluorescence signal of the transfected cells was significantly enhanced, indicating that CHO-K1 cells did not express CD147 protein, while the transfected cells highly expressed CD147 protein, indicating that a CD147 overexpressing cell line was successfully constructed and named CD147 cells.
[0076] Example 2
[0077] In this example, engineered Cell-SELEX technology was used to screen CD147 aptamers, with CD147 cells used as positive screening cells and wild-type CHO-K1 cells used as negative screening cells. The specific screening steps were as follows:
[0078] In the first round of screening, 10 nmol / L of the ssDNA library was incubated with target cells. Unbound DNA sequences were washed away with wash buffer, and the cells were scraped from the culture dish with sterile water. After heating in a hot water bath for 10 minutes, the cells were centrifuged to remove cell debris and recover the bound sequences. In the third round, a negative screening step was introduced. Nonspecific binding sequences were removed by incubating the screening ssDNA library with CHO-K1 cells. The unbound library was then incubated with CD147 cells to obtain the corresponding enriched library. During the screening process, the abundance of the ssDNA library and the number of CD147 cells were gradually reduced, while the number of CHO-K1 cells was increased to improve the affinity and specificity of the selected aptamers. Figure 2 Schematic diagram of the above screening process.
[0079] Example 3
[0080] In this example, flow cytometry was used to examine the enrichment level of the library during the screening process.
[0081] The enriched libraries from rounds 4, 6, 8, 10, and 12 of screening were amplified by PCR using Cy5- and biotin-labeled primers to generate Cy5-labeled single-stranded DNA (Cy5-ssDNA). The binding ability of the enriched libraries from different rounds to CD147 cells was analyzed by flow cytometry. The specific protocol is as follows:
[0082] The enriched libraries of different screening rounds (rounds 4, 6, 8, 10 and 12) labeled with Cy5 fluorescent group were incubated with CD147 cells and CHO-K1 cells at 4°C, washed and analyzed by flow cytometry ( Figure 3 and 4 The results showed that as the number of screening rounds increased, the fluorescence intensity of CD147 cells gradually increased, indicating that the binding force between the enriched library and CD147 cells continued to increase. However, after ten rounds of screening, the fluorescence intensity of CD147 cells did not increase significantly, which also indicated that the library that specifically bound to the CD147 protein had reached saturation ( Figure 3 ); In contrast, the fluorescence intensity of CHO-K1 cells did not show significant changes ( Figure 4 ), which also shows that the library can specifically bind to CD147 protein.
[0083] Example 4
[0084] According to the flow cytometry results, the enriched library of the tenth round was selected for sequencing. Based on the sequencing results and the M-fold simulated nucleic acid secondary structure, two sequences (named DC6 and DC32) were selected for truncation optimization and affinity analysis.
[0085] The binding affinity of aptamer sequences (DC6 and DC32 and the corresponding optimized sequences DC6S2 and DC32S4) to CD147 was analyzed by flow cytometry. The specific experimental scheme was as follows: Cy5 fluorescent group-labeled aptamer sequences (0.5 μM) were incubated with CHO-K1 cells and CD147 cells (2×10 5 ) were incubated on ice for 50 minutes. After washing with wash buffer, the fluorescence intensity of the cells was analyzed by flow cytometry. The initial screening library m-Lib was used as a negative control.
[0086] Figure 5 The images show the binding of full-length sequences (DC6 and DC32) and truncated sequences (DC6S2 and DC32S4) to CD147. As can be seen from the images, all candidate aptamers increased the fluorescence intensity of CD147 cells compared to m-Lib. Figure 6 The binding ability of the full-length sequences (DC6 and DC32) and truncated sequences (DC6S2 and DC32S4) to CHO-K1 cells was demonstrated. It was observed that after the interaction of all nucleic acid aptamers with CHO-K1 cells, there was no significant change in fluorescence intensity, indicating that the selected nucleic acid aptamer sequences have the ability to target the CD147 protein.
[0087] Example 5
[0088] The affinity of the candidate aptamer sequences for different cancer cell lines, including colorectal cancer cell line (SW480), ovarian cancer cell line (SKOV-3), colorectal cancer cell line (HCT116, HT29, HCT8), and breast cancer cell line (MBA-MD-231), was analyzed by flow cytometry. The specific experimental steps are shown in Example 4.
[0089] Figure 7 Flow cytometry results showing the interaction of full-length sequences (DC6 and DC32) and truncated sequences (DC6S2 and DC32S4) with MBA-MD-231 cells are shown.
[0090] Figure 8 Flow cytometry results showing the interaction of full-length sequences (DC6 and DC32) and truncated sequences (DC6S2 and DC32S4) with HCT8 cells are shown.
[0091] Figure 9 Flow cytometry results showing the interaction of full-length sequences (DC6 and DC32) and truncated sequences (DC6S2 and DC32S4) with HCT116 cells are shown.
[0092] Figure 10 Flow cytometry results showing the interaction of full-length sequences (DC6 and DC32) and truncated sequences (DC6S2 and DC32S4) with HT29 cells are shown.
[0093] Figure 11 Flow cytometry results showing the interaction of full-length sequences (DC6 and DC32) and truncated sequences (DC6S2 and DC32S4) with SKOV-3 cells are shown.
[0094] Figure 12 Flow cytometry results showing the interaction of full-length sequences (DC6 and DC32) and truncated sequences (DC6S2 and DC32S4) with SW480 cells are shown.
[0095] The above results showed that the aptamers DC6 and DC32 and their truncated sequences DC6S2 and DC32S4 showed higher binding ability than the control group m-Lib in all tested cancer cell lines (MBA-MD-231, HCT8, HCT116, HT29, SKOV-3 and SW480), indicating that these aptamers can specifically recognize and bind to the surface of CD147 protein.
[0096] Example 6
[0097] The binding ability of all candidate aptamer sequences to CD147 cells and CHO-K1 cells, including full-length sequences (DC6 and DC32) and truncated sequences (DC6S2 and DC32S4), was analyzed using laser scanning confocal microscopy.
[0098] Cells were seeded in 24-well plates, washed with PBS, and then Cy5-labeled aptamers were added. The cells were incubated on ice in the dark for 50 minutes. Unbound sequences were removed by washing three times with PBS. Hoechst 33342 was added to stain the cell nuclei. After incubation for 15 minutes, the cells were washed with PBS and imaged using a laser scanning confocal fluorescence microscope.
[0099] The results are as follows Figure 13 As shown in the figure, compared with the control group, all four candidate aptamer sequences bound to CD147 cells to varying degrees, but had little binding to CHO-K1 cells, further demonstrating that the candidate aptamers have a targeting effect on CD147.
[0100] Example 7
[0101] The binding affinity of DC6, DC32, DC6S2, and DC32S4 to cells expressing high levels of CD147 was tested using flow cytometry. Target cells were incubated with different concentrations (0nM, 5nM, 10nM, 25nM, 50nM, 100nM, 200nM, 300nM, 400nM, and 500nM) of Cy5 fluorescently labeled DC6, DC32, DC6S2, and DC32S4, and the fluorescence intensity was measured by flow cytometry. The equilibrium dissociation constant (K d ) by the formula F / F0=Bmax×X / (K d +X), where F represents the fluorescence intensity of cells bound to Cy5-labeled aptamers, F0 represents the fluorescence intensity of cells treated with Cy5-labeled m-Lib, and X is the concentration of the aptamer.
[0102] Figure 14 A flow cytometry experiment shows the binding affinity of the candidate sequence DC6 to cells with high CD147 expression.
[0103] Figure 15 A flow cytometry experiment shows the binding affinity of the candidate sequence DC6S2 to cells that highly express CD147.
[0104] Figure 16 A flow cytometry experiment shows the binding affinity of the candidate sequence DC32 to cells that highly express CD147.
[0105] Figure 17 A flow cytometry experiment shows the binding affinity of the candidate sequence DC32S4 to cells with high CD147 expression.
[0106] The results showed that the K of DC6 d The value was 81.32±4.46nM, and the K d The value was 44.08±12.56nM, and the K d The value was 45.68±13.87nM, and the K d The value was 34.86±5.92 nM, indicating that the screened candidate aptamer sequences had a high binding affinity to CD147.
[0107] In summary, the present invention provides a nucleic acid aptamer that can specifically bind to the CD147 protein and has high affinity and targeting to the CD147 protein. The screened nucleic acid aptamer can provide assistance in the fields of tumor diagnosis and disease treatment related to the CD147 marker.
[0108] The applicant declares that the above is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the scope of protection and disclosure of the present invention.
Claims
1. A nucleic acid aptamer for CD147 protein, characterized in that: The nucleotide sequence of the nucleic acid aptamer is shown in any one of SEQ ID NOs: 1-4.
2. Use of the nucleic acid aptamer against CD147 protein according to claim 1 in the preparation of a drug for treating tumors related to CD147 expression.
3. Use of the nucleic acid aptamer for CD147 protein according to claim 1 in the preparation of a drug targeted delivery vehicle.
4. Use of the nucleic acid aptamer against CD147 protein according to claim 1 in detecting cells expressing CD147 protein.
5. A nucleic acid aptamer conjugate, characterized in that: The conjugate contains the nucleic acid aptamer targeting CD147 protein according to claim 1 and a conjugate connected to the nucleic acid aptamer.
6. The nucleic acid aptamer conjugate according to claim 5, characterized in that The conjugate is any one or a combination of at least two of detection, labeling, diagnosis or treatment substances.
7. A kit for detecting CD147 protein, characterized in that: The kit comprises the nucleic acid aptamer against CD147 protein according to claim 1, or the nucleic acid aptamer conjugate according to claim 5 or 6.
8. The method for screening nucleic acid aptamers against CD147 protein according to claim 1, characterized in that: The method includes: transferring the human CD147 expression gene into wild-type CHO-K1 cells through a lentiviral system to construct an engineered cell line that overexpresses the CD147 protein; using untransfected CHO-K1 cells as negative screening cells; using the constructed CD147 engineered cell line as positive screening cells; and using the live cell-SELEX technology to screen out CD147-specific nucleic acid aptamers.
9. The method for screening nucleic acid aptamers for CD147 protein according to claim 8, characterized in that: The nucleotide sequence of the human CD147 expression gene is shown in SEQ ID NO:
5.
10. The method for screening nucleic acid aptamers against CD147 protein according to claim 8 or 9, characterized in that: After the CD147-specific nucleic acid aptamer is screened, the method further includes the steps of using M-fold to predict the secondary structure of the aptamer and optimizing the truncation of the candidate sequence.