A molecular marker, an amplification primer pair and application related to chicken carcass traits and meat quality traits

By identifying multiple SNP sites in the PPM1K gene associated with chicken carcass and meat quality traits, molecular markers and primer pairs were developed, solving the problem of insufficient breeding precision in existing technologies, enabling accurate identification of chicken carcass and meat quality traits, and improving breeding results.

CN120758641BActive Publication Date: 2026-05-08SOUTH CHINA AGRICULTURAL UNIVERSITY +2
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTH CHINA AGRICULTURAL UNIVERSITY
Filing Date
2025-07-16
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

There are no reports in the existing technology of the association between the poultry PPM1K gene and chicken carcass traits and meat quality traits, which limits the accuracy of chicken breeding and the selection of target traits.

Method used

Multiple SNP sites on the PPM1K gene were found to be significantly associated with chicken carcass and meat traits. Related molecular markers were developed and primer pairs were designed. Chicken carcass and meat traits were identified by PCR amplification and sequencing.

Benefits of technology

It provides an accurate method for identifying chicken carcass and meat traits using molecular markers, providing a scientific basis for chicken breeding and improving the accuracy of breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120758641B_ABST
    Figure CN120758641B_ABST
Patent Text Reader

Abstract

The application discloses a molecular marker, an amplification primer pair and application related to chicken carcass traits and meat quality traits, and belongs to the technical field of biology. The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 3; a SNP1 of C / T mutation exists at the 112th base of the sequence shown in SEQ ID NO. 3; a SNP2 of C / T mutation exists at the 177th base; a SNP3 of A / C mutation exists at the 194th base; a SNP4 of T / C mutation exists at the 203th base; a SNP5 of A / G mutation exists at the 442th base; and a SNP6 of T / A mutation exists at the 681th base. It is found that a plurality of SNP sites on a PPM1K gene are significantly related to chicken carcass traits and meat quality traits, a new SNP molecular marker is provided for molecular marker assisted selection, and a scientific basis is provided for chicken breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a molecular marker, amplification primer pair, and application related to chicken carcass traits and meat quality traits. Background Technology

[0002] Due to the impact of diseases such as avian influenza, the sale of chilled poultry has become the mainstream in the market. Against this backdrop, the carcass characteristics and meat quality of poultry have become important factors influencing consumer choices. Effectively improving the carcass characteristics and meat quality of poultry will contribute to the further development of the chicken farming industry.

[0003] Single nucleotide polymorphisms (SNPs) are variations in DNA sequences within a genome caused by the insertion, deletion, inversion, and transformation of a single nucleotide. As a common type of heritable variation in animals, SNPs are widely distributed throughout the animal genome, possess stable genetic characteristics, and are easily detected. In animal production, the use of SNPs for molecular marker-assisted selection (MAS) can overcome the limitations of traditional breeding, improving the accuracy of selection and the success rate of breeding target traits.

[0004] Mg 2+ / Mn 2+ Protein phosphatase 1K gene (Mg) 2+ / Mn 2+ Dependent1K (PPM1K) is involved in protein dephosphorylation, and the encoded PPM1K protein plays an important role in regulating mitochondrial function. Mitochondria are crucial for muscle and bone development. However, there are currently no reports on the association between the avian PPM1K gene and chicken carcass traits or meat quality traits. Summary of the Invention

[0005] The purpose of this invention is to provide molecular markers, amplification primer pairs, and applications related to chicken carcass and meat quality traits, thereby addressing the problems existing in the prior art. This invention discovers multiple SNP sites on the PPM1K gene that are significantly associated with chicken carcass and meat quality traits, and develops molecular markers based on these SNP sites. The molecular markers provided by this invention can accurately identify chicken carcass and meat quality traits, thus providing a scientific basis for chicken breeding.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a molecular marker related to chicken carcass traits and meat quality traits, the nucleotide sequence of which is shown in SEQ ID NO.3;

[0008] The sequence shown in SEQ ID NO.3 contains the following SNPs: SNP1 with a C / T mutation at position 112; SNP2 with a C / T mutation at position 177; SNP3 with an A / C mutation at position 194; SNP4 with a T / C mutation at position 203; SNP5 with an A / G mutation at position 442; and SNP6 with a T / A mutation at position 681.

[0009] The present invention also provides a primer pair for amplifying the above-mentioned molecular marker, comprising an upstream primer with the sequence shown in SEQ ID NO.1 and a downstream primer with the sequence shown in SEQ ID NO.2.

[0010] The present invention also provides a kit for identifying chicken carcass traits and meat traits, the kit containing the above-mentioned primer pairs.

[0011] The present invention also provides the application of the above primer pair or the above kit in identifying chicken carcass traits and meat quality traits, wherein the chicken carcass traits and meat quality traits include cooking loss rate, wing weight, shank length, dressing percentage, leg muscle weight, leg muscle a value, leg muscle percentage, breast width, leg muscle b value, shank circumference, intermuscular fat width, leg muscle L value, and breast muscle b value.

[0012] The present invention also provides a method for identifying chicken carcass traits and meat quality traits, comprising the following steps:

[0013] Using the chicken genomic DNA to be tested as a template, PCR amplification was performed using the primer pairs or the kit described above to obtain the amplification products; the amplification products were sequenced to detect the genotype of the corresponding SNP sites.

[0014] At the SNP1 locus, the cooking loss rate of individuals with the CT genotype was higher than that of individuals with the TT genotype.

[0015] At the SNP2 locus, the cooking loss rate of individuals with the CT genotype was higher than that of individuals with the TT genotype.

[0016] At the SNP3 locus, individuals with the CC and AC genotypes had lower wing weight and tibia length than individuals with the AA genotype; individuals with the CC and AC genotypes had higher leg muscle a values ​​than individuals with the AA genotype; individuals with the AA genotype had higher dressing percentage and leg muscle weight than individuals with the CC genotype; and individuals with the AA genotype had lower leg muscle percentage than individuals with the CC genotype.

[0017] At the SNP4 locus, individuals with the CC and TC genotypes had a greater chest width than individuals with the TT genotype; individuals with the TT genotype had a higher leg muscle b-value than individuals with the CC genotype.

[0018] At the SNP5 locus, individuals with the GG and AG genotypes had higher chest width and tibial circumference than individuals with the AA genotype.

[0019] At SNP6, individuals with the AA genotype had a greater intramuscular fat width than those with the TT genotype; individuals with the TA genotype had a lesser intramuscular fat width than those with the TT genotype; individuals with the AA and TA genotypes had greater tibial circumference, leg muscle weight, and chest width than those with the TT genotype; individuals with the AA and TA genotypes had lower pectoral muscle b-values ​​than those with the TT genotype; and individuals with the AA genotype had higher leg muscle L-values ​​than those with the TT genotype.

[0020] Optionally, the PCR amplification reaction system is as follows: 2 μL template DNA, 15 μL 2x Rapid Taq Master Mix, 1.2 μL upstream primer, 1.2 μL downstream primer, and 10.6 μL ddH2O.

[0021] Optionally, the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 15 s, 34 cycles; 72℃ final extension for 5 min; storage at 4℃.

[0022] The present invention also provides the application of the above primer pair or the above kit in molecular marker-assisted breeding of chickens.

[0023] The present invention discloses the following technical effects:

[0024] This invention, through analysis of the PPM1K gene, discovered multiple SNP loci significantly associated with chicken carcass and meat quality traits, providing novel SNP molecular markers for marker-assisted selection. Furthermore, experimental verification confirmed the correlation between six SNP loci and chicken carcass and meat quality traits. The molecular markers provided by this invention can accurately identify chicken carcass and meat quality traits, thus providing a scientific basis for chicken breeding. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1This is a diagram showing the pairing positions of PCR primers on the PPM1K gene.

[0027] Figure 2 Genotyping diagrams for 7 SNP loci;

[0028] Figure 3 This is a graph showing the results of haplotype analysis. Detailed Implementation

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0031] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0032] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0033] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0034] Example 1

[0035] 1. Materials and Methods

[0036] 1.1 Animal Samples

[0037] A total of 325 small white-feathered broilers, slow-growing yellow-feathered broilers, and fast-growing white-feathered broilers aged 49 days were selected. 2 mL of subcutaneous venous blood was collected from each broiler and stored at -80℃ for DNA extraction. The following traits were recorded for the selected population: breast angle, breast depth, breast width, live weight, shank length, shank circumference, body length, keel length, comb height, carcass weight, subcutaneous fat thickness, intramuscular fat width, semi-eviscerated weight, fully eviscerated weight, abdominal fat weight, wing weight, breast muscle weight, leg muscle weight, foot weight, breast muscle shear force, leg muscle shear force, drip loss rate, cooking loss rate, breast muscle pH, leg muscle pH, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, leg muscle b value, dressing percentage, semi-eviscerated percentage, fully eviscerated percentage, abdominal fat percentage, breast muscle percentage, and leg muscle percentage.

[0038] 1.2 Main Reagents

[0039] Blood DNA Extraction Kit (Brand: OMEGA; Catalog No.: D3392; Guangzhou Feiyang Biotechnology Co., Ltd.), 2x Rapid Taq Master Mix (Dye) (Brand: Novizan; Catalog No.: P222-01; Nanjing Novizan Biotechnology Co., Ltd.), DNA Marker (Brand: TransGen; Catalog No.: BM101-01; Beijing TransGen Biotechnology Co., Ltd.), High Purity Low Electroosmotic Agarose (Brand: Qingke; Catalog No.: TSJ001; Beijing Qingke Biotechnology Co., Ltd.)

[0040] 1.3 Experimental Methods

[0041] 1.3.1 Primer Design

[0042] Based on the sequence of the PPM1K gene in the red junglefowl (Gallus) (NC_052535.1) published by NCBI (National Center for Biotechnology Information Search Database), primers were designed using PrimerPremier 5, with primer synthesis services provided by Guangzhou Qingke Biotechnology Co., Ltd. Primer sequence information is shown in Table 1, and the primer pairing positions on the PPM1K gene are as follows: Figure 1 As shown.

[0043] Table 1. Primer sequences for PCR amplification

[0044]

[0045] 1.3.2 Blood Sample DNA Extraction

[0046] Extract DNA from blood samples according to the instructions of the blood sample DNA extraction kit.

[0047] 1.3.3 PCR amplification of partial PPM1K gene sequence

[0048] Using genomic DNA from the blood samples of the above 325 chickens as templates, the reaction was carried out according to the following system: 2 μL template DNA, 15 μL 2xRapidTaq Master Mix, 1.2 μL upstream primer, 1.2 μL downstream primer, and 10.6 μL ddH2O.

[0049] Reaction procedure: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 15 s, 34 cycles; final extension at 72℃ for 5 min; storage at 4℃. PCR products were sent to Guangzhou Qingke Biotechnology Co., Ltd. for Sanger sequencing.

[0050] 1.3.4 SNP Determination and Genotyping

[0051] The sequence peak diagrams of PCR products obtained through SnapGene software were analyzed to identify potential SNP sites, and the sequencing data of each sample were compared with the sequencing data of each sample using this tool to perform genotyping.

[0052] 1.3.5 Association analysis between genotype and carcass traits

[0053] The phenotypic data of SNP loci and corresponding individuals were analyzed using SPSS 27.0.

[0054] 2. Results

[0055] 2.1 PPM1K gene sequence PCR amplification and SNP screening

[0056] 325 chicken individuals were selected, and PCR amplification was performed using blood DNA samples from each individual as templates. The PCR products (nucleotide sequences shown in SEQ ID NO.3) were subjected to Sanger sequencing. The peak patterns after sequencing were compared and analyzed, and a total of 7 SNP sites were detected: NC_052535.1:g.46584259C>T; NC_052535.1:g.46584324C>T; NC_052535.1:g.46584341A>C; NC_052535.1:g.46584350T>C; NC_052535.1:g.46584497G>A; NC_052535.1:g.46584589A>G; NC_052535.1:g.46584828T>A; located in SEQ ID NO. The 112th, 177th, 194th, 203rd, 350th, 442nd, and 681st positions of the sequence shown in NO.3; as... Figure 2 As shown.

[0057] SEQ ID NO.3:

[0058] TGCGACTTCATCAACCAGTGCCACGATCCTGCTGAAGCTGCCCACGTTGTTACTGAGCAGGTAATGCTAGGGTTTCTTGAAGCATCAAAATGCCAGATCCTTGCAAGGACA C AGGGCCGTCATTTCAATTAATGTGCTTAGTTCTTGGTCCACAGAACTGCTGAGAATGTCATCAG C GTAGGCAGAAACCATC A GTTTCTCA T TGAAGGTTTTTGACAGTGGTATATCCCATGGAAAGCTCTGAAGCATGCAAGAGCCTGCAGTGTTGGAGCTGGGAGGAAGCAAAGAAGTCTCAGATCATGCTGTCCTATGTGGAGTTAGACAGTTGTTTCCCTTTCTGAGCAGGACC G TGATGCTGACAATTTATTTCTTCCTTCAGGCAATGCAGTACGGCACTGAAGATAATAGCACGGTTGTCATAGTGCCATTTGGAGCATGGGG A AAGTATAAAAATGGTGAGATCAACTTCTCCTTCAGCCGCAGTTTTGCCTCCAGTGGGAGGTGGGCGTGAAGACCTGACACAGCTATCTTTTCCTGCAATAACCTGGATACAACGTGCTATAAGAGAACACAGCCATCTGTTCATAGGTTGACTCAGTGTCTTGTCCATCTCTTCTGTTGCCAGTTATGGAAGATGCAACTGCTCCTGTGGTGCGTAATTGCTGCTTACAGCTGATCGT T TTTTAGTGTTTATTTATTCAGATCAGCACTGGGTTTCCAGTCCCAGCAGCTCCGCACACCATTTCATTTGCACAGACAAGTCTCTGGGCTTGAGCTATGACACATTGGTTTCATCCCAACTCTTGTTACCTAGCACTTAGTTACCTGGCAGCTGTGAAAGTCCGAGA。

[0059] 2.2 Association analysis of PPM1K gene sequence SNP sites with culprit traits

[0060] Association analysis was performed on the above 7 SNP loci with traits (breast angle, breast depth, breast width, live weight, tibia length, tibia circumference, body oblique length, keel length, comb height, carcass weight, subcutaneous fat thickness, intramuscular fat width, semi-eviscerated weight, fully eviscerated weight, abdominal fat weight, wing weight, breast muscle weight, leg muscle weight, chicken foot weight, breast muscle shear force, leg muscle shear force, drip loss rate, cooking loss rate, breast muscle pH value, leg muscle pH value, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, leg muscle b value, dressing percentage, semi-eviscerated percentage, fully eviscerated percentage, abdominal fat percentage, breast muscle percentage, and leg muscle percentage).

[0061] As shown in Table 2, the results showed that the molecular marker NC_052535.1:g.46584259C>T site was significantly correlated with the cooking loss rate (p<0.05). Among them, the cooking loss rate of individuals with the CT heterozygous genotype was significantly higher than that of individuals with the TT mutant homozygous genotype (p<0.05).

[0062] As shown in Table 3, the results showed that the molecular marker NC_052535.1:g.46584324C>T site was significantly correlated with the cooking loss rate (p<0.05). Among them, the cooking loss rate of individuals with the CT heterozygous genotype was significantly higher than that of individuals with the TT mutation homozygous genotype (p<0.05).

[0063] Further analysis revealed that the NC_052535.1:g.46584259C>T site and the NC_052535.1:g.46584259C>T site were completely linked. Figure 3 The two loci have the same genotype in every individual in the population.

[0064] As shown in Table 4, the results indicated that the molecular marker NC_052535.1:g.46584341A>C was significantly correlated with wing weight, tibia length, dressing percentage, leg muscle weight, leg muscle a value, and leg muscle percentage (p<0.05). Specifically, individuals with the CC mutant homozygous genotype and AC heterozygous genotype had significantly lower wing weight and tibia length than those with the AA wild-type homozygous genotype (p<0.05), but there was no significant difference between CC and AC (p>0.05). Individuals with the CC mutant homozygous genotype and AC heterozygous genotype had significantly higher leg muscle a values ​​than those with the AA wild-type homozygous genotype (p<0.05), but there was no significant difference between CC and AC (p>0.05). Individuals with the AA wild-type homozygous genotype had significantly higher dressing percentage and leg muscle weight than those with the CC mutant homozygous genotype (p<0.05). Individuals with the AA wild-type homozygous genotype had significantly lower leg muscle percentage than those with the CC mutant homozygous genotype (p<0.05).

[0065] As shown in Table 5, the results indicated that the molecular marker NC_052535.1:g.46584350T>C site was significantly correlated with chest width and leg muscle b-value (p<0.05). Individuals with the CC mutant homozygous genotype and the TC heterozygous genotype had significantly higher chest width than those with the TT wild-type homozygous genotype, while there was no significant difference between TC and CC (p>0.05). Individuals with the TT wild-type homozygous genotype had significantly higher leg muscle b-value than those with the CC mutant homozygous genotype (p<0.05).

[0066] As shown in Table 6, the results indicated that the molecular marker NC_052535.1:g.46584589A>G was significantly correlated with chest width and tibia circumference (p<0.05). Individuals with the GG mutant homozygous genotype and the AG heterozygous genotype had significantly higher chest width and tibia circumference than those with the AA wild-type homozygous genotype, while there was no significant difference between AG and GG (p>0.05).

[0067] As shown in Table 7, the results indicated that the molecular marker NC_052535.1:g.46584828T>A was significantly correlated with chest width, tibia circumference, intramuscular fat width, leg muscle L-value, leg muscle weight, and pectoral muscle b-value (p<0.05). Individuals with the AA mutant homozygous genotype had significantly higher intramuscular fat width than those with the TT wild-type homozygous genotype (p<0.05), while individuals with the TA heterozygous genotype had significantly lower intramuscular fat width than those with the TT wild-type homozygous genotype (p<0.05). Tibia circumference, leg muscle weight, and chest width were significantly higher in individuals with the AA mutant homozygous genotype and those with the TA heterozygous genotype than in those with the TT wild-type homozygous genotype (p<0.05), while there was no significant difference between AA and TA (p>0.05). The pectoral muscle b-value was significantly lower in individuals with the AA mutant homozygous genotype and those with the TA heterozygous genotype than in those with the TT wild-type homozygous genotype (p<0.05). The leg muscle L value of individuals with the AA mutant homozygous genotype was significantly higher than that of individuals with the TT wild-type homozygous genotype (p<0.05).

[0068] Apart from the six SNP sites mentioned above, the association between the NC_052535.1:g.46584497G>A site and the carcass traits was not significant (p>0.05).

[0069] Table 2. Association between NC_052535.1:g.46584259C>T site and meat quality traits.

[0070]

[0071] Table 3. Association between NC_052535.1:g.46584324C>T site and meat quality traits.

[0072]

[0073] Table 4. Associations between the NC_052535.1:g.46584341A>C locus and carcass and meat quality traits.

[0074]

[0075] Table 5. Associations between the NC_052535.1:g.46584350T>C site and carcass and meat quality traits.

[0076]

[0077]

[0078] Table 6. Association between NC_052535.1:g.46584589A>G site and carnivorous traits.

[0079]

[0080] Table 7. Association between the NC_052535.1:g.46584828T>A site and carcass and meat quality traits.

[0081]

[0082] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of molecular markers as targets in identifying carcass traits and meat quality traits in chickens, characterized in that, The carcass and meat characteristics of the chicken include cooking loss rate, wing weight, shank length, dressing percentage, leg muscle weight, leg muscle a value, leg muscle percentage, breast width, leg muscle b value, shank circumference, intramuscular fat width, leg muscle L value, and breast muscle b value. The molecular markers are combinations of SNP1, SNP2, SNP3, SNP4, SNP5 and SNP6; SNP1 is a C / T single nucleotide polymorphism at position 112 of the sequence shown in SEQ ID NO.3; SNP2 is a C / T single nucleotide polymorphism at position 177 of the sequence shown in SEQ ID NO.3; SNP3 is an A / C single nucleotide polymorphism at position 194 of the sequence shown in SEQ ID NO.3; SNP4 is a T / C single nucleotide polymorphism at position 203 of the sequence shown in SEQ ID NO.3; SNP5 is an A / G single nucleotide polymorphism at position 442 of the sequence shown in SEQ ID NO.3; and SNP6 is a T / A single nucleotide polymorphism at position 681 of the sequence shown in SEQ ID NO.

3. At the SNP1 locus, the cooking loss rate of individuals with the CT genotype was higher than that of individuals with the TT genotype. At the SNP2 locus, the cooking loss rate of individuals with the CT genotype was higher than that of individuals with the TT genotype. At the SNP3 locus, individuals with the CC and AC genotypes had lower wing weight and tibia length than individuals with the AA genotype; individuals with the CC and AC genotypes had higher leg muscle a values ​​than individuals with the AA genotype; individuals with the AA genotype had higher dressing percentage and leg muscle weight than individuals with the CC genotype; and individuals with the AA genotype had lower leg muscle percentage than individuals with the CC genotype. At the SNP4 locus, individuals with the CC and TC genotypes had a greater chest width than individuals with the TT genotype; individuals with the TT genotype had a higher leg muscle b-value than individuals with the CC genotype. At the SNP5 locus, individuals with the GG and AG genotypes had higher chest width and tibial circumference than individuals with the AA genotype. At SNP6, individuals with the AA genotype had a greater intramuscular fat width than those with the TT genotype; individuals with the TA genotype had a lesser intramuscular fat width than those with the TT genotype; individuals with the AA and TA genotypes had greater tibial circumference, leg muscle weight, and chest width than those with the TT genotype; individuals with the AA and TA genotypes had lower pectoral muscle b-values ​​than those with the TT genotype; and individuals with the AA genotype had higher leg muscle L-values ​​than those with the TT genotype.

2. A method for identifying the carcass characteristics and meat quality characteristics of chickens, characterized in that, Includes the following steps: Using the chicken genomic DNA to be tested as a template, PCR amplification was performed using primer pairs or kits containing the primer pairs to detect molecular markers associated with chicken carcass traits and meat quality traits, and amplification products were obtained; the amplification products were sequenced to detect the genotype of the corresponding SNP sites on the molecular markers; The primer pair includes an upstream primer with the sequence shown in SEQ ID NO.1 and a downstream primer with the sequence shown in SEQ ID NO.2; The nucleotide sequence of the molecular marker is shown in SEQ ID NO.3; SNP1 has a C / T mutation at base 112; SNP2 has a C / T mutation at base 177; SNP3 has an A / C mutation at base 194; SNP4 has a T / C mutation at base 203; SNP5 has an A / G mutation at base 442; and SNP6 has a T / A mutation at base 681. At the SNP1 locus, the cooking loss rate of individuals with the CT genotype was higher than that of individuals with the TT genotype. At the SNP2 locus, the cooking loss rate of individuals with the CT genotype was higher than that of individuals with the TT genotype. At the SNP3 locus, individuals with the CC and AC genotypes had lower wing weight and tibia length than individuals with the AA genotype; individuals with the CC and AC genotypes had higher leg muscle a values ​​than individuals with the AA genotype; individuals with the AA genotype had higher dressing percentage and leg muscle weight than individuals with the CC genotype; and individuals with the AA genotype had lower leg muscle percentage than individuals with the CC genotype. At the SNP4 locus, individuals with the CC and TC genotypes had a greater chest width than individuals with the TT genotype; individuals with the TT genotype had a higher leg muscle b-value than individuals with the CC genotype. At the SNP5 locus, individuals with the GG and AG genotypes had higher chest width and tibial circumference than individuals with the AA genotype. At SNP6, individuals with the AA genotype had a greater intramuscular fat width than those with the TT genotype; individuals with the TA genotype had a lesser intramuscular fat width than those with the TT genotype; individuals with the AA and TA genotypes had greater tibial circumference, leg muscle weight, and chest width than those with the TT genotype; individuals with the AA and TA genotypes had lower pectoral muscle b-values ​​than those with the TT genotype; and individuals with the AA genotype had higher leg muscle L-values ​​than those with the TT genotype.

3. The method according to claim 2, characterized in that, The PCR amplification reaction system consisted of: 2 μL template DNA, 15 μL 2x RapidTaq Master Mix, 1.2 μL upstream primer, 1.2 μL downstream primer, and 10.6 μL ddH2O.

4. The method according to claim 2, characterized in that, The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 15 s, 34 cycles; 72℃ final extension for 5 min; storage at 4℃.

5. The application of molecular markers as targets in marker-assisted breeding of chickens, characterized in that, The molecular markers are one or more of SNP1, SNP2, SNP3, SNP4, SNP5, and SNP6; SNP1 is a C / T single nucleotide polymorphism at position 112 of the sequence shown in SEQ ID NO.3; SNP2 is a C / T single nucleotide polymorphism at position 177 of the sequence shown in SEQ ID NO.3; SNP3 is an A / C single nucleotide polymorphism at position 194 of the sequence shown in SEQ ID NO.3; SNP4 is a T / C single nucleotide polymorphism at position 203 of the sequence shown in SEQ ID NO.3; SNP5 is an A / G single nucleotide polymorphism at position 442 of the sequence shown in SEQ ID NO.3; and SNP6 is a T / A single nucleotide polymorphism at position 681 of the sequence shown in SEQ ID NO.

3. At the SNP1 locus, the cooking loss rate of individuals with the CT genotype was higher than that of individuals with the TT genotype. At the SNP2 locus, the cooking loss rate of individuals with the CT genotype was higher than that of individuals with the TT genotype. At the SNP3 locus, individuals with the CC and AC genotypes had lower wing weight and tibia length than individuals with the AA genotype; individuals with the CC and AC genotypes had higher leg muscle a values ​​than individuals with the AA genotype; individuals with the AA genotype had higher dressing percentage and leg muscle weight than individuals with the CC genotype; and individuals with the AA genotype had lower leg muscle percentage than individuals with the CC genotype. At the SNP4 locus, individuals with the CC and TC genotypes had a greater chest width than individuals with the TT genotype; individuals with the TT genotype had a higher leg muscle b-value than individuals with the CC genotype. At the SNP5 locus, individuals with the GG and AG genotypes had higher chest width and tibial circumference than individuals with the AA genotype. At SNP6, individuals with the AA genotype had a greater intramuscular fat width than those with the TT genotype; individuals with the TA genotype had a lesser intramuscular fat width than those with the TT genotype; individuals with the AA and TA genotypes had greater tibial circumference, leg muscle weight, and chest width than those with the TT genotype; individuals with the AA and TA genotypes had lower pectoral muscle b-values ​​than those with the TT genotype; and individuals with the AA genotype had higher leg muscle L-values ​​than those with the TT genotype.