Nucleic acid rapid detection method of monkey pox virus
Through enzymatic recombinant isothermal amplification technology and specific primer probe combination, the specificity and speed problems of monkeypox virus detection were solved, and rapid and sensitive monkeypox virus detection was achieved, which is suitable for on-site and large-scale sample screening, and improves the efficiency of epidemic control and treatment.
Patent Information
- Application Number
- CN202510842708.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-23
- Publication Date
- 2025-10-10
AI Technical Summary
Existing monkeypox virus detection methods have problems such as low specificity, long detection time, high equipment requirements, and inability to quickly distinguish between different evolutionary branches, which leads to limitations in epidemic control and treatment.
Using enzymatic recombinant isothermal amplification technology, specific primers and probes are designed, which can efficiently amplify monkeypox virus RNA in a short time. The combination of specific primers and probes can also achieve rapid detection and differentiation of monkeypox virus and its different evolutionary branches, making it suitable for rapid on-site detection.
It has achieved rapid, sensitive and specific detection of monkeypox virus, which can be completed within a few minutes. It is suitable for large-scale sample screening, improving the efficiency of epidemic control and treatment, especially enabling rapid response during epidemic outbreaks.
Smart Images

Figure CN120758673A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedical detection technology, and more specifically, to a method for rapid detection of monkeypox virus nucleic acid. Background Art
[0002] Monkeypox is an infectious disease caused by the monkeypox virus, a member of the genus Orthopoxvirus.
[0003] Previous monkeypox virus detection methods mainly include immunological methods, molecular biological methods and pathogenic detection methods; as for serological methods, due to the antigenic cross-talk between monkeypox virus and other poxviruses, the specificity is not strong, resulting in inaccurate detection; pathogenic biological methods involve pathogen isolation technology, the detection cycle is relatively long, and monkeypox virus is classified as a biosafety level I biological factor, which has extremely high requirements for laboratory biosafety. Therefore, both methods have certain limitations in practical applications.
[0004] Currently, the molecular biology techniques used to detect monkeypox virus on the market include PCR and fluorescent quantitative PCR. Although these technologies have high specificity, they have high requirements for instruments and equipment, and cannot perform rapid screening of suspected patients on site, and the detection time often exceeds one hour. Existing constant temperature amplification technologies such as RPA and RAA are mature at the technical level, but the screening of monkeypox virus-specific detection targets is varied, and they cannot truly distinguish between different evolutionary branches of monkeypox (such as strain I and strain II, etc.) quickly and effectively. There are significant differences in the severity of clinical symptoms and treatment effects caused by different monkeypox virus branches, so they also have certain limitations.
[0005] Therefore, the present invention aims to provide a method for rapid detection of monkeypox virus nucleic acid to solve the above problems. Summary of the Invention
[0006] The purpose of the present invention is to provide a method for rapid nucleic acid detection of monkeypox virus. The present invention uses enzymatic recombinant isothermal amplification technology to efficiently and rapidly amplify trace amounts of monkeypox virus RNA specific fragments in a short period of time, thereby achieving rapid detection and differentiation of monkeypox virus and its different evolutionary branches. At the same time, this method has high sensitivity and high specificity, does not require large-scale instruments and equipment, is suitable for rapid on-site detection, and is of great significance for epidemic control and treatment.
[0007] The above technical objectives of the present invention are achieved through the following technical solutions: a specific primer probe set for detecting monkeypox virus, wherein the primer nucleotide sequence for detecting monkeypox virus is:
[0008] Forward primer: ACATGAAATGATCTCTATTGATGATAGTGAC;
[0009] Reverse primer: TTCATAAGAGAACAGTTTGTTGGTACAAAT.
[0010] The nucleotide sequence of the probe for detecting monkeypox virus is:
[0011] TAACTCATTCTATACACGCTTTCCTTGT(FAM-dT)(THF)A(BHQ-1dT)AAAGGATAGTATATA(C3-SPACER).
[0012] The present invention also provides a primer probe set for detecting monkeypox virus strains I and II, respectively. The nucleotide sequence of the primer for detecting monkeypox virus strain I is:
[0013] Forward primer:
[0014] TAACTAATGGAGGTTCGTCAGCGGCCTAG;
[0015] Reverse primer: ACTATGTGATATGATTAAGGGTACTAGCGGT.
[0016] The nucleotide sequence of the probe for detecting monkeypox virus strain 1 is:
[0017] TAATCGTTGTAACTCACATCATTTATTT
[0018] (FAM-dT)(THF)(BHQ-1dT)CTATATTGTATTCTA(C3-SPACER).
[0019] The nucleotide sequence of the primer for detecting monkeypox virus II strain is:
[0020] Forward primer: CATCCATTGTCGTAGACCAACGAGGAGGAGT;
[0021] Reverse primer: GACACAGAGATGTGTGCGGTTATTAAAAAC.
[0022] The nucleotide sequence of the probe for detecting monkeypox virus II strain is:
[0023] GACCAACGAGGAGGAGTATCGTTGGAGC(FAM-dT)(THF)(BHQ-1dT)AAACCATAGCACTAC(C3-SPACER).
[0024] The present invention also provides a use of a primer probe set for detecting monkeypox virus genus and strain in preparing a kit for detecting monkeypox virus.
[0025] The present invention also provides a method for detecting monkeypox virus, which is characterized by:
[0026] S1. Obtain sequence data of monkeypox virus and other orthopoxvirus genera from NCBI and GISAID official websites;
[0027] S2. Design specific primers and probes to target conserved regions that differ between monkeypoxvirus and other orthopoxviruses.
[0028] S3. Through enzymatic recombination isothermal amplification experiments, specific primer pairs were screened out for the rapid detection of two types of monkeypox virus, genus and strain.
[0029] The present invention is further configured as follows: the specific process of screening candidate primer pairs in step S3 is: designing four forward primers and four reverse primers for the genus and strain of monkeypox virus, a total of 16 combinations of forward and reverse primer pairs, adding amplification template to the first four tubes of the eight-tube strip each time, adding one forward primer and one of the four reverse primers respectively, adding the same primer pair combination and negative control to the last four tubes, and performing comparative analysis based on the test results.
[0030] In summary, the present invention has the following beneficial effects:
[0031] 1. The enzymatic recombinant isothermal amplification technology used in the present invention can complete the detection of monkeypox virus (genus and strain) within a few minutes, which is at least 0.5 hours shorter than the traditional PCR detection method. This significant time advantage enables this method to respond quickly in emergency situations, buying valuable time for epidemic control;
[0032] 2. The specific primers and probes designed in the present invention can anchor sequence regions that are different from those of other poxviruses, enabling specific detection of different strains of monkeypox (Central African strain and West African strain), thereby improving detection accuracy;
[0033] 3. The present invention does not require large-scale instruments and equipment, and can quickly detect and screen suspected patients on site, which is particularly critical for early identification and control of the epidemic. At the same time, the method has good sensitivity and can detect pathogens at concentrations as low as 10 2 It can also be detected at 200 copies / μL, which means that even when the viral load is low, monkeypox virus can be accurately detected;
[0034] 4. The present invention is very suitable for the detection and screening of large-scale samples, and is of great significance for the diagnosis and screening of monkeypox virus infection. Especially in the event of a large-scale outbreak, it can quickly process a large number of samples and quickly identify the virus type, providing key information for epidemic control and treatment, facilitating early identification and rapid response to the epidemic, reducing the impact of the epidemic, and improving overall detection efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figure 1 1 is a flow chart of a method for detecting monkeypox virus according to an embodiment of the present invention;
[0036] Figure 2 is a sequence diagram of a representative strain of monkeypox virus queried in an embodiment of the present invention;
[0037] Figure 3 RT-ERA test data of the monkeypox virus genus and strain in the embodiment of the present invention; DETAILED DESCRIPTION
[0038] The following is combined with Figure 1-3 The present invention is described in further detail.
[0039] Example 1: A method for detecting monkeypox virus
[0040] In this example, the sequences of representative monkeypox virus strains were retrieved by literature review and databases (NCBI, GAISD). Figure 2 As shown, the sequence regions where monkeypox virus strains I and II differ from other orthopoxviruses were anchored, and genus-specific primers and probes were designed, which enabled the rapid identification of monkeypox virus from the orthopoxvirus genus.
[0041] The experimental materials used in this embodiment are as follows: 21.2 μl of water, 20 μl of dissolving solution (DA), 2.1 μl of forward primer, 2.1 μl of reverse primer, 0.8 μl of probe, 2 μl of sample, and 2 μl of activator (MC) are added to each test tube. The primers and probes are first diluted to 100 pmol / μl. When subsequently taken, 5 μl of primers and probes are taken, 45 μl of water are added, and they are diluted to a working solution concentration of 10 pmol / μl. Finally, 2 μl of the sample to be tested (including positive quality control, negative control and other orthopoxvirus quality control products, and the quality control sample needs to extract viral RNA and reverse transcribe) is added.
[0042] Mix the above reagents evenly and add them to the isothermal amplification instrument, observe the changes in fluorescence value, and copy the data to the computer for analysis after the test.
[0043] In this embodiment, four forward primers (F1, F2, F3, F4) and four reverse primers (R1, R2, R3, R4) for the monkeypox virus genus are designed, so there are a total of 4×4=16 combinations of forward and reverse primer pairs, as shown in Table 1:
[0044] Table 1 Primer probe list for monkeypox virus
[0045]
[0046]
[0047] In this example, amplification template (positive plasmid) was added to the first four tubes of the eight-tube strip, along with one forward primer and one of the four reverse primers. The same primer pair combination and a negative control were added to the last four tubes, and the test results were compared and analyzed.
[0048] in conclusion:
[0049] The results were sorted and summarized, and two candidate primer pairs were finally obtained, namely F4R1 and F3R2, among which:
[0050] The specific sequence of F4 is:
[0051] ACATGAAATGATCTCTATTGATGATAGTGAC;
[0052] The specific sequence of R1 is:
[0053] TTCATAAGAGAACAGTTTTGTTGGTACAAAT;
[0054] The specific sequence of F3 is:
[0055] GACCTGATGTTCATATATTGGTTCATACATG;
[0056] The specific sequence of R2 is:
[0057] TGATATACGATTCATAAGAGAACAGTTTGTTGGT;
[0058] The sequence of the probe is:
[0059] TAACTCATTCTATACACGCTTTCCTTGT / i6FAMdT / / idSp / A / iBH Q1dT / AAAGGATAGTATATA / C3-Spacer / .
[0060] Example 2: A method for detecting monkeypox virus strain I
[0061] Based on Case 1, this example further identifies the sequence regions where monkeypox virus strains I and II differ, designs primers and probes specific for monkeypox virus strain I, and uses the same detection method as in Example 1 to enable rapid identification of monkeypox virus strain I from the genus Monkeypox virus.
[0062] In this embodiment, three forward primers (F1, F2, F3) and three reverse primers (R1, R2, R3) for monkeypox virus strain I are designed, so there are a total of 3×3=9 combinations of forward and reverse primer pairs, as shown in Table 1:
[0063] Table 1 Primer probe list for monkeypox virus strain 1
[0064]
[0065] In this example, amplification template (positive plasmid) was added to the first four tubes of the eight-tube strip, along with one forward primer and one of the four reverse primers. The same primer pair combination and a negative control were added to the last four tubes, and the test results were compared and analyzed.
[0066] in conclusion:
[0067] The results were sorted and summarized, and two candidate primer pairs were finally obtained, namely F1R3 and F1R1, among which:
[0068] The specific sequence of F1 is:
[0069] TAACTAATGGAGGTTCGTCAGCGGCCTAG;
[0070] The specific sequence of R3 is:
[0071] ACTATGTGATATGATTAAGGGTACTAGCGGT;
[0072] The specific sequence of R1 is:
[0073] TCGCTATCTCTTGTTCGGTATAAAATGCATT;
[0074] The sequence of the probe is:
[0075] TAATCGTTGTAACTCACATCATTTATTT / i6FAMdT / / idSp / / iBHQ 1dT / CTATATTGTATTCTA / C3-Spacer / .
[0076] Example 3: A method for detecting monkeypox virus II strain
[0077] Based on Case 1, this example further anchors the sequence regions where monkeypox virus strains I and II differ, designs primers and probes specific for monkeypox virus strain II, and uses the same detection method as Examples 1 and 2 to enable rapid identification of monkeypox virus strain II from the genus Monkeypox virus.
[0078] In this embodiment, four forward primers (F1, F2, F3, F4) and four reverse primers (R1, R2, R3, R4) for monkeypox virus strain II are designed, so there are a total of 4×4=16 combinations of forward and reverse primer pairs, as shown in Table 1:
[0079] Table 1 Primer probe list for monkeypox virus II strain
[0080]
[0081] In this example, amplification template (positive plasmid) was added to the first four tubes of the eight-tube strip, along with one forward primer and one of the four reverse primers. The same primer pair combination and a negative control were added to the last four tubes, and the test results were compared and analyzed.
[0082] in conclusion:
[0083] The results were sorted and summarized, and two candidate primer pairs were finally obtained, namely F4R4 and F4R3, among which:
[0084] The specific sequence of F4 is:
[0085] CATCCATTGTCGTAGACCAACGAGGAGGAGT;
[0086] The specific sequence of R4 is:
[0087] GACACAGAGATTGTGTGCGGTTATTAAAAAC;
[0088] The specific sequence of R3 is:
[0089] GCGGTTATTAAAAACATTGGACTAAGGAGC;
[0090] The sequence of the probe is:
[0091] GACCAACGAGGAGGAGTATCGTTGGAGC / i6FAMdT / / idSp / / iBHQ1dT / AAACCATAGCACTAC / C3-Spacer / .
[0092] This specific embodiment is merely an explanation of the present invention and is not intended to limit the present invention. After reading this specification, those skilled in the art may make non-creative modifications to this embodiment as needed. However, as long as such modifications are within the scope of the claims of the present invention, they are protected by patent law.
Claims
1. A specific primer probe set for detecting monkeypox virus, characterized by: The nucleotide sequence of the primer for detecting monkeypox virus is: Forward primer: ACATGAAATGATCTCTATTGATGATAGTGAC; Reverse primer: TTCATAAGAGAACAGTTTGTTGGTACAAAT; The nucleotide sequence of the probe for detecting monkeypox virus is: TAACTCATTCTATACACGCTTTCCTTGT(FAM-dT)(THF)A(BH Q-1dT)AAAGGATAGTATATA(C3-SPACER).
2. A primer probe set for detecting monkeypox virus strain I, characterized by: The nucleotide sequence of the primer for detecting monkeypox virus strain 1 is: Forward primer: TAACTAATGGAGGTTCGTCAGCGGCTCTAG; Reverse primer: ACTATGTGATATGATTAAGGGTACTAGCGGT. The nucleotide sequence of the probe for detecting monkeypox virus strain 1 is: TAATCGTTGTAACTCACATCATTTATTT(FAM-dT) (THF)(BHQ-1dT)CTATATTGTATTCTA(C3-SPACER).
3. A primer probe set for detecting monkeypox virus strain II, characterized by: The nucleotide sequence of the primer for detecting monkeypox virus II strain is: Forward primer: CATCCATTGTCGTAGACCAACGAGGAGGAGT; Reverse primer: GACACAGAGATGTGTGCGGTTATTAAAAAC. The nucleotide sequence of the probe for detecting monkeypox virus II strain is: GACCAACGAGGAGGAGTATCGTTGGAGC(FAM-dT)(THF)(BHQ-1dT)AAACCATAGCACTAC(C3-SPACER).
4. Use of a primer probe set for detecting the genus and strain of Monkeypox virus according to claim 1 or 2 in the preparation of a kit for detecting Monkeypox virus.
5. A kit for detecting monkeypox virus, characterized in that: The kit comprises a primer probe set for detecting monkeypox virus genus and strain according to claim 1 or 2.
6. A method for detecting monkeypox virus, characterized by: The following steps are involved: S1. Obtain sequence data of monkeypox virus and other poxvirus genera from NCBI and GISAID official websites; S2. Design specific primers and probes to target conserved regions that differ between monkeypoxvirus and other poxvirus genera. S3. Through enzymatic recombination isothermal amplification experiments, specific primer pairs were screened out for the rapid detection of two types of monkeypox virus, genus and strain.
7. The method for detecting monkeypox virus according to claim 5, wherein: The specific process for screening candidate primer pairs in step S3 is as follows: four forward primers and four reverse primers for the genus and strain of monkeypox virus are designed, for a total of 16 combinations of forward and reverse primer pairs. Each time, the amplification template is added to the first four tubes of the eight-tube strip, and one forward primer and one of the four reverse primers are added respectively. The same primer pair combination and a negative control are added to the last four tubes, and the test results are compared and analyzed.
Citation Information
Patent Citations
Composition and kit for western and middle non-branch two-channel typing detection of monkey pox virus and application of composition and kit for western and middle non-branch two-channel typing detection of monkey pox virus
CN115772584A
Double-gene loop-mediated isothermal amplification detection reagent, kit and detection method for monkey pox virus
CN116144839A