Integration site analysis method based on multi-primer design

Abstract

The invention belongs to the technical field of biological information, and discloses an integration site analysis method based on multi-primer design, which comprises the following steps: inserting primers at a plurality of positions of an AAV vector sequence to form a multi-primer vector; integrating the multi-primer vector into a host genome, and capturing a sequence of an integration site through primer amplification; sequencing is conducted on the sequence where the integration site is located, and sequencing data is obtained; and sequencing data redundancy elimination processing: eliminating sequencing result redundancy caused by multi-primer amplification through a multi-primer sequencing data redundancy elimination signal generation algorithm to obtain an accurate integration site detection result. By designing the primers at multiple positions, the problem that the sequence of the integration site cannot be effectively captured under the condition that the AAV vector is integrated into the host genome in an incomplete sequence in the experiment process can be solved.

Description

Technical Field

[0001] The present invention belongs to the field of bioinformatics. Specifically, the present invention belongs to the application direction of second-generation sequencing data analysis in the field of bioinformatics. It discloses an integration site analysis method based on multi-primer design, which aims to accurately detect and analyze integration sites of recombinant adeno-associated virus (rAAV) vectors. Background Art

[0002] Recombinant adeno-associated virus (rAAV) is a commonly used vector for integration analysis. Adeno-associated virus (AAV) is a non-enveloped virus that has been engineered to deliver sequences to target cells. Its simple structure, high safety, and low immunogenicity make rAAV one of the most widely used vectors in gene therapy.

[0003] Integration site analysis (ISA) involves the analysis of the location and functional annotation of integration sites after a vector integrates into the host genome, including preclinical and clinical gene therapy. ISA can predict whether vector integration into the target cell genome will trigger adverse reactions and is key to assessing the biosafety of gene therapy vectors.

[0004] Compared with other types of vectors such as lentiviral vectors, AAV vectors do not insert the entire viral sequence when integrating into the host genome. Instead, only part of the sequence is integrated into the host genome, and the ITRs (Inverse Tandem Repeats) at both ends of the vector are usually lost. In this case, the conventional analysis method based on primer amplification of rAAV ITR sequences will fail to identify the effective primer sequence during sequence capture, resulting in omission of result data.

[0005] Conventional integration site analysis methods, when designing primers (e.g., Chinese patent document CN109554447A), only design a single primer at the end of the sequence for viral vectors, and use the capture of the LTR region as the criterion for capturing the viral sequence. When detecting integration sites in the subsequent bioinformatics analysis step, a single primer sequence is also used as the basis for sequencing result identification and integration site statistics. In addition, when performing primer matching, the problem of a small amount of base loss at the end of the primer during the integration process is addressed by setting an allowed base mismatch. (e.g., Chinese patent document CN116403647A)

[0006] However, if Figure 1As shown, the current conventional experimental method only designs a single primer at the end of the vector sequence. Since the AAV vector sequence is integrated into the host genome in the form of an incomplete sequence, when the integrated sequence does not contain the terminal primer, the integrated sequence cannot be effectively captured, which reduces the sensitivity of the detection. Summary of the Invention

[0007] In response to the above-mentioned problem that a single primer cannot be detected due to the breakage of the AAV vector sequence, the present invention has found through research that, in the experimental design step, by designing primers at multiple positions, it is possible to solve the problem that when the AAV vector is integrated into the host genome with an incomplete sequence during the experiment, the sequence where the integration site is located cannot be effectively captured. Therefore, the first object of the present invention is to provide an integration site analysis method based on multi-primer design. The second object of the present invention is to provide a primer for the above-mentioned analysis method. The third object of the present invention is to provide a computer-readable storage medium. The fourth object of the present invention is to provide a server system for executing the integration site analysis method based on multi-primer design. The fifth object of the present invention is to provide a cloud-based service platform.

[0008] In view of the above problems, the present invention adopts the following technical solutions:

[0009] As a first aspect of the present invention, a method for analyzing integration sites based on multi-primer design comprises the following steps:

[0010] S1, inserting primers at multiple positions of the AAV vector sequence to form a multi-primer vector;

[0011] S12, integrating the multi-primer vector into the host genome, and capturing the sequence of the integration site by primer amplification;

[0012] S3. Sequencing the sequence at the integration site to obtain sequencing data;

[0013] S4. De-redundancy processing of sequencing data: Through the multi-primer sequencing data de-redundancy bioinformatics algorithm, the redundancy of sequencing results caused by multi-primer amplification is eliminated to obtain accurate integration site detection results.

[0014] According to the present invention, the multi-primer sequencing data redundancy removal and information generation algorithm comprises the following steps:

[0015] Obtain all sequencing sequences supporting the integration site and annotate the primer information contained in each sequence;

[0016] Compare the primer information of different sequences. If the primer information of one sequence is a subset of the primer information of another sequence, retain the sequence corresponding to the subset and filter out the redundant sequences.

[0017] All integration sites were de-redundanted to obtain accurate integration site statistics.

[0018] According to the present invention, the primer design comprises the following steps:

[0019] Multiple primers were designed based on the ITR region of the AAV vector sequence;

[0020] The effectiveness and specificity of the primers were verified experimentally to ensure that the primers could effectively amplify the target sequence.

[0021] Furthermore, the nucleotide sequences of the primers are shown as SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3.

[0022] According to the present invention, the sequencing data de-redundancy processing comprises the following steps:

[0023] S41, enumerate candidate primer subsequences using the k-mer algorithm;

[0024] S42, counting the occurrence frequency of each candidate primer subsequence, and selecting the subsequence with the highest occurrence frequency as the optimal primer;

[0025] S43. Extract the integrated sequence based on the optimal primers to maximize the retention of sequencing results.

[0026] As a second aspect of the present invention, a primer for the above-mentioned analysis method, the nucleotide sequences of the primers are shown as SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3.

[0027] As a third aspect of the present invention, a computer-readable storage medium stores a computer program for executing an integration site analysis method based on multi-primer design, wherein the computer program includes an informatics algorithm for de-redundancy and primer selection, and the computer program can be run on a server or a cloud platform.

[0028] As the fourth aspect of the present invention, a server system for performing an integration site analysis method based on multi-primer design is characterized in that it includes a data receiving module, a data analysis module and a result output module, the data analysis module is configured with an information-based algorithm for de-redundancy and primer selection, and the system can run on a cloud platform.

[0029] As a fifth aspect of the present invention, a cloud-based service platform is provided for performing an integration site analysis method based on multi-primer design. The service platform includes a data upload module, a data analysis module, and a result download module. The data analysis module is configured with an information-based algorithm for de-redundancy and primer selection. The platform supports concurrent access by multiple users.

[0030] As the sixth aspect of the present invention, a device for performing an integration site analysis method based on multi-primer design includes a gene fragmentor, a PCR instrument, a sequencer and a data analysis server, wherein the data analysis server is configured with an information-based algorithm for de-redundancy and primer optimization.

[0031] As the seventh aspect of the present invention, an integration site analysis method based on multi-primer design is used in drug safety assessment, which detects the integration site of the AAV vector in the host genome and evaluates the potential genotoxicity of the drug to the host genome to optimize the safety of the drug.

[0032] As the eighth aspect of the present invention, an integration site analysis method based on multi-primer design is used in the design of gene therapy vectors. By detecting the integration site of the AAV vector in the host genome, the integration efficiency and safety of the gene therapy vector are evaluated to optimize the design of the gene therapy vector.

[0033] Compared with the existing technology, the beneficial effect of the present invention is that it combines specific optimization methods to greatly improve the sensitivity of integration site detection for vectors with random terminal ITR loss. This is specifically reflected in:

[0034] 1. Multi-primer vector experimental plan: The experimental design steps of the present invention, by designing primers at multiple positions, solve the problem of being unable to effectively capture the sequence at the integration site when the AAV vector integrates into the host genome with an incomplete sequence during the experiment.

[0035] Specifically, if Figure 2 As shown in the experimental design, primers are inserted into multiple locations within the AAV vector sequence. Under this premise, when the AAV vector is fragmented into shorter sequences and integrated into the host genome, the remaining primers in the short sequences can be used to detect the integrated sequence. This scheme can effectively avoid the problem of single-primer vector sequences being unable to effectively capture the sequence at the integration site due to primer loss during the experiment, thereby improving the sensitivity of detection.

[0036] 2. Multi-primer de-redundancy solution: To address the problem of redundant sequencing results of multi-primer integrated sequences, the present invention designs a multi-primer sequencing data de-redundancy bioinformatics algorithm to eliminate the redundancy of results caused by multiple primer amplifications on the same integrated sequence and obtain accurate quantitative results.

[0037] Specifically, when multiple primers are present in an integration sequence, each primer generates a separate sequence after amplification, resulting in redundant sequencing results. Therefore, it is necessary to filter out redundant results generated by amplifying the same integration sequence. For sequences within the same integration site, the primers included in the sequence are examined. If primers for multiple sequences are mutually included, the sequences corresponding to the included primers are retained. This solution accurately removes redundant items from sequencing results, reducing the bias in integration site statistics caused by redundant amplification with multiple primers.

[0038] 3. Primer subsequence optimization scheme: The primer sequence is one of the key factors for capturing and integrating sequences from sequencing results. Because a small amount of bases may be lost at the end of the primer, when analyzing actual sequencing data, this method selects the optimal primer subsequence to appear in the most sequenced sequences. This ensures the maximum number of valid sequencing results and solves the problem of primers being unable to detect ITR deletions.

[0039] Specifically, to address the problem of reduced sequencing data matching range due to base loss at the end of the primer sequence, the present invention has established a primer sequence optimization process. When analyzing actual sequencing data, it is necessary to screen the optimal primer subsequence from the actual data so that it appears in the most sequencing sequences, ensuring that the effective sequencing results obtained are maximized. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Schematic diagram of the experimental design for a conventional integration site. Conventional integration site experimental methods only design a primer at the end of the vector sequence. When the vector sequence integrates into the host genome as an incomplete sequence, the integration sequence without the primer cannot be detected, resulting in loss of results.

[0041] Figure 2 This is a schematic diagram of the experimental design of the integration site of the present invention. The new experimental method inserts primers at multiple locations in the vector sequence. Even if the vector sequence is not a complete sequence when it is integrated into the host genome, it can still be detected by the primers in this region.

[0042] Figure 3 This is a schematic diagram of the multi-primer vector sequence integration of the present invention. When the AAV vector sequence integrates into the host genome, sequence fragmentation occurs, resulting in an incomplete vector sequence ultimately integrated into the host genome. Because primers exist at multiple locations within the vector sequence, the integrated sequence may also contain multiple primers, each of which will amplify a single resulting sequence.

[0043] Figure 4Schematic diagram of the principle behind redundant sequencing results. Primers are designed at multiple locations within the vector sequence. After the vector sequence integrates into the host genome, the integrated sequence may still contain multiple primers. Each primer triggers amplification, resulting in multiple sequencing results from the same integrated sequence, creating redundant results.

[0044] Figure 5 Flowchart for de-redundancy of multi-primer sequencing data using the bioinformatics algorithm of the present invention.

[0045] Figure 6 This is an example of the association between sequences and primers. Each element Si in the sequence list S is a sequence, and each element Vi in the primer information vector V is the primer number contained in Si. The sequence list S and the primer information vector V have the same length, and Si and Vi correspond one-to-one.

[0046] Figure 7 Schematic diagram of the primer sequence optimization process.

[0047] Figure 8 This is an example of selecting the best primer sequence.

[0048] Figure 9 To verify the effectiveness and specificity of primers by amplifying plasmid standards, the primers from left to right are Marker, ITR1, ITR2, and ITR3.

[0049] Figure 10 The samples were amplified in triplicate using the designed AAV primers to construct a library. Finally, a diffuse library structure was obtained, which was ready for sequencing. DETAILED DESCRIPTION

[0050] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0051] 1. The terms used in this invention have the following meanings:

[0052] AAV: Adeno-Associated Virus;

[0053] Barcode: A short, unique DNA sequence tag used to identify different samples or experimental conditions;

[0054] Primer: A primer is a base sequence used to initiate DNA amplification reaction and is closely linked to the barcode;

[0055] Fastq file: abbreviated as fq, is a file format for storing biological sequences (usually nucleic acid sequences) and their sequencing quality score information;

[0056] k-mer: a subsequence consisting of k consecutive bases in a DNA or RNA sequence;

[0057] Integration site: The integration site refers to the specific location where the vector sequence is inserted into the host genome.

[0058] 2. Experimental process

[0059] (1) The present invention uses a Covaris M220 gene disruptor to shear 1.5 μg of genomic DNA to an average length of 500±50 bp (Tapestation 4150). The fragmented DNA is purified and primer extension is performed using an AAV vector-specific biotin-modified primer. The reaction system is 50 μl, containing 0.01 mM dNTP and 1.25 U Taq enzyme. The cycling program is 95°C pre-denaturation for 2 minutes followed by 1 cycle (95°C for 45 seconds, 58°C annealing for 45 seconds, and 72°C extension for 5 seconds). The extension product is purified by Ampure XP magnetic beads, then captured by Dynabeads M-280 biotin affinity magnetic beads, washed with PBS-BSA solution and LiCl buffer, and a DNA-magnetic bead complex is constructed. Subsequently, a 5′-phosphorylated, 3′-terminally ddC-modified single-stranded linker (10 pmol) was ligated to the unknown end of the target DNA using a ligation system containing 25% PEG8000 and 1 mM hexammine cobalt(III) chloride. The ligation reaction was incubated at room temperature with shaking at 300 rpm overnight (16–24 hours), followed by elution and purification. The ligation product was divided into two equal portions. One aliquot was used for the first nested PCR using a biotinylated target fragment primer and a ligation adapter primer at a primer concentration of 8.35 pmol. The cycling program consisted of 10 cycles of high-temperature denaturation at 95°C followed by 25 cycles of low-temperature denaturation at 90°C, for a total of 35 cycles. The other aliquot was stored as an intermediate product. The biotinylated PCR product was captured using magnetic beads, enriched, and washed. Half of this eluate was used as template for the second exponential PCR, amplified using the inner vector and adapter primers, and ligated with the barcode and sequencing adapters required for sequencing library construction. PCR products were subjected to 2% gel electrophoresis for qualitative control; smeared bands indicated successful amplification. The remaining product was purified and then concentrated using a Qubit 4.0 assay. Samples were pooled at 50 ng / sample and then subjected to next-generation sequencing on a MiSeq sequencer (Illumina). For detailed experimental procedures, see High-resolution insertion-site analysis by linear amplification–mediated PCR (LAM-PCR).

[0060] (2) After the experimental steps use multiple primers to amplify the AAV vector fragment, since the break position of the AAV vector sequence is not fixed, the integration sequence obtained after integration may also contain multiple primers. Each primer will trigger a sequence amplification, which will eventually lead to an integration sequence containing multiple primers to produce multiple result sequences (such as Figure 4As shown in the results sequence via sequencing, multiple sequencing sequences are obtained, resulting in redundancy of the results. In this regard, the present application designs a set of multi-primer sequencing data de-redundancy bioinformatics algorithm, which filters the data according to the primer information of the sequencing data to obtain accurate quantitative results. Figure 5 The flowchart is a schematic diagram, and the specific implementation method of the flowchart is as follows:

[0061] 1) Sequencing obtains double-end Fastq files, uses integrated site detection tools for analysis, obtains integrated site detection results with redundancy, including the specific position of the integrated site on the host genome, sequencing sequences supporting the integrated site, etc. It should be noted that the sequencing sequences supporting the integration event are theoretically composed of two parts, one part is the host genome part, and the other part is the AAV genome end part.

[0062] 2) For any integrated site, obtain all sequencing sequences S supporting the integrated site, for each sequence in S, find the primer sequence contained in the AAV genome end part thereof, and mark the presence of the primer sequence therein, and store the marked information in vector V. The specific method is that if the AAV genome end part contains primer sequence A, 'A' is recorded in vector V; if the AAV genome end part contains primer sequences A, B, and C, 'ABC' is recorded in vector V. After recording is completed, the length of vector V is equal to S, and each sequence in S corresponds to one (such as Figure 4 as shown).

[0063] 3) For any integrated site, obtain all sequencing sequences S supporting the integrated site and the vector V of the primer presence marking. Traverse all sequences, compare the information stored in the vectors V of each two sequences. Assuming that i and k are the i th and k th sequences in sequence S, if the primer information Vi corresponding to one sequence Si is a subsequence of the primer information Vk corresponding to another sequence Sk (such as 'A' is a subsequence of 'ABC'), the contained sequence Si is retained, and the other sequence Sk is discarded; perform the above filtering operation on the sequences corresponding to all integrated sites to obtain the final integrated site statistical result, which no longer contains redundant information, i.e. to obtain accurate quantitative results. The detailed flowchart is shown in Figure 5 .

[0064] (3) For the case that the primer end base loss leads to that only the incomplete primer sequence is contained in the sequencing data, the present application introduces a new bioinformatics algorithm for automatically identifying new primers from actual sequencing data, and screens out the optimal primer sequence through kmer algorithm to realize the maximum reservation of the sequencing results, Figure 7 The flowchart is a schematic diagram, and the specific implementation method of the flowchart is as follows:

[0065] 1) Given a paired-end Fastq file obtained after sequencing, traverse the sequences in the file and extract the fixed-length base sequence in the primer position region to obtain a candidate primer list;

[0066] 2) Use the kmer algorithm to enumerate all subsequences of the candidate primer with a length of at least k. That is, from each candidate primer sequence, take out multiple subsequences of k bases, k+1 bases, k+2 bases, and so on until the full length of the candidate primer sequence, and obtain a list of candidate primer subsequences.

[0067] 3) Count the frequency of each primer subsequence in the candidate primer subsequence list and select the primer subsequence with the highest frequency. If there are multiple primer subsequences with the same frequency, select the primer subsequence with the longest length to obtain the only candidate primer.

[0068] 4) Check whether the frequency of occurrence of the unique candidate primer sequence passes a threshold test. In this method, the threshold for candidate primer sequences is 0.6, meaning that the candidate primer sequence should appear in at least 60% of the Fastq file sequences. If it passes the threshold test, a new primer sequence is obtained; otherwise, a new primer region is selected and steps 1-3 are repeated.

[0069] At this point, a new primer sequence is obtained, and the integration sequence is extracted based on this new primer sequence, which can retain the result data to the greatest extent.

[0070] Example 1

[0071] This example mainly describes the results of designing multiple primers based on the ITR sequence in the AAV vector sequence and constructing a library for sequencing based on the primer sequence.

[0072] In this embodiment, the specific implementation process is as follows:

[0073] 1. AAV vector primer design:

[0074] The ITR sequence is as follows:

[0075] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCG, (SEQ ID No. 1);

[0076] According to conventional primer design principles, the following multi-primer system was finally determined:

[0077] ITR1:GAACCCCTAGTGATGGAGTTGGC, (SEQ ID No. 2);

[0078] ITR2:ATGGAGTTGGCCACTCCCTC,(SEQ ID No.3);

[0079] ITR3:GAGTTGGCCACTCCCTCTCTG,(SEQ ID No.4);

[0080] 2. Perform primer verification based on the above primers and obtain the results Figure 9 After confirming the primers, the sample DNA infected with AAV was targeted amplified and the library was constructed. The following library quality control results were finally obtained. Figure 10 .

[0081] Example 2

[0082] This example describes the use of a bioinformatics algorithm to remove redundancy from multi-primer sequencing data and compares the statistical results before and after redundancy removal for one copy of the data. This aims to demonstrate that the algorithm can effectively remove multiple amplification sequences caused by multiple primers. Figure 5 Schematic diagram of the process of de-redundancy algorithm for multi-primer sequencing data.

[0083] In this embodiment, the input data that needs to be prepared includes:

[0084] (1) Paired-end Fastq files: One human cell sample infected with AAV2 serotype virus was used. The infection conditions were set at an MOI (Multiplicity of Infection) of 10,000 vg / cell, and cells were harvested after 72 hours of culture. After genomic DNA was extracted, PCR amplification was performed using primers specific for the AAV vector sequence, followed by high-throughput sequencing (NGS) to obtain a pair of paired-end Fastq files (150 bp).

[0085] In this embodiment, the specific analysis steps are as follows:

[0086] 1. Integration site detection: For the paired-end Fastq files obtained by sequencing, use integration site detection tools (such as GENIS, INSPIRED, etc.) to perform data analysis to obtain the original integration site detection results. At this time, the original integration site detection results obtained are redundant.

[0087] 2. Association between integration sites and sequencing sequences: The original integration site detection results include information such as the specific location of the integration site on the host genome and the sequencing sequence supporting the integration site. It should be noted that the sequencing sequence supporting the integration event is theoretically composed of two parts, including: (1) one part is the host genome part, and (2) one part is the end part of the AAV genome, and the part of the AAV genome will contain at least one primer sequence. For any integration site, all sequencing sequences supporting the integration site are obtained, and the sequence list is recorded as S. In this embodiment, taking the integration site chr6:100405492 as an example, the sequence list S of the integration site contains a total of 647 sequences.

[0088] 3. Association between sequences and primers: For each sequence in the sequence list S, search for the primer sequence contained therein at the end of the AAV genome of the sequence, mark the existence of the primer sequence therein, and store the marked information in the vector V. Taking the integration site chr6:100405492 in this embodiment as an example, its sequence list S contains a total of 647 sequences, of which the first sequence S1 contains and only contains primer A (primer A represents the sequence GTACCGTAAAGTTGAGAGTC), and the second sequence S2 contains primer A and primer B (primer B represents the sequence CGTAACAAAGGTCCCGATAG), then V1 = 'A', V2 = 'AB'. Perform the above operation on all sequences in the sequence list S. After the recording is completed, the length of the vector V is equal to S, and it corresponds one-to-one with each sequence in S (such as Figure 6 shown).

[0089] 4. Filtering redundant information: For any integration site, obtain all sequencing sequences S = [S1, S2, S3 ... Sn] that support the integration site, and the vector V = [V1, V2, V3 ... Vn] that records the primer annotation information. The number of elements in both is equal and one-to-one. Traverse all sequences in S and compare the primer annotation information of each two sequences. Taking the integration site chr6:100405492 in this example, the primer information vector V1 corresponding to the first sequence S1 is 'A', and the primer information vector V2 corresponding to the second sequence S2 is 'AB'. Since V1 is truly included in V2, S1 is retained and S2 is filtered.

[0090] 5. Perform the above filtering operation on the sequences corresponding to all integration sites to obtain the final integration site statistics, which no longer contains redundant information, that is, to obtain accurate quantitative results.

[0091] Table 1 is the number of sequences supported by integration sites before and after de-duplication. Three integration sites are extracted for display. After de-duplication, the number of sequences of all sites decreases, proving that the de-duplication algorithm of multi-primer sequencing data realizes data filtering, making the quantitative results more accurate.

[0092] Table 1 is the number of sequences supported by integration sites before and after de-duplication.

[0093]

[0094] Example 3

[0095] In this example, primer selection algorithm is used for 1 data to select new primer, and the number of integration sequences extracted by using complete primer sequence and new primer sequence is compared, so as to prove that the algorithm can maximize the retention of sequencing results. Figure 7 The schematic diagram of primer selection process.

[0096] (1) Paired-end Fastq file 1 pair: 1 case of human cell sample after AAV infection, using AAV2 serotype virus vector for infection. The infection condition is set as MOI (Multiplicity of Infection) = 10,000 vg / cell, and the cells are collected after 72 hours of culture. After extracting genomic DNA, specific primers for AAV vector sequences are used for PCR amplification, followed by high-throughput sequencing (NGS), obtaining 1 pair of paired-end Fastq files (paired-end, 150bp).

[0097] In this example, the specific analysis steps are as follows:

[0098] 1. Extract candidate primer sequences: For the double-end Fastq file obtained after sequencing, traverse the sequencing sequences in it, and extract candidate primer sequences according to the position of primer sequences in the Fastq file. In this example, the length of the candidate primer sequence is 20 bases, and after traversal, all candidate primer sequences are output to the candidate primer list P, a total of 743006 candidate primer sequences are obtained.

[0099] 2. k-mer algorithm extracts candidate primer subsequence: using k-mer algorithm to enumerate all sub-sequences of primer sequences with length no less than k, in this example k = 18, the specific operation method is to take out multiple sub-sequences of 18 bases, 19 bases and 20 bases length from each candidate primer sequence, to get the candidate primer subsequence list Q (as shown in Figure 8 a).

[0100] 3. Selection of candidate primer subsequences: For each candidate primer subsequence in the candidate primer subsequence list Q, count its frequency of occurrence in the primer list P, that is, the percentage of primer sequences in which the subsequence is included, and obtain the candidate primer subsequence with the highest frequency of occurrence. Figure 8 As shown in b, the subprimer sequence ACGCCTGCTTGAAAGTGCC is the longest and appears the most times in primer list P, 572233 times, so it is used as the new primer sequence.

[0101] 4. Check whether the frequency of occurrence of the unique candidate primer sequence passes the 60% threshold test. The inspection found that it appeared in 77.02% of the primer sequences, thus meeting the release criteria.

[0102] At this point, a new primer sequence is obtained. The new primer sequence selected by the primer selection method will be included in the most sequencing sequences. Therefore, using this new primer sequence as the basis for extracting the integrated sequence can achieve the maximum retention of the result data.

[0103] Table 2 shows the statistics of the number of sequences extracted using the original primer sequence and the new primer sequence obtained by selection. It can be seen that the use of the new primer sequence for sequence extraction increased the analyzable data by 20.34%, proving that the algorithm can screen out new primer sequences that are more suitable for actual sequencing data, maximizing the retention of sequencing data.

[0104] Table 2 Statistics of the number of sequences extracted using primer sequences

[0105]

[0106] In summary, the present invention solves the problem that the sequence where the integration site is located cannot be effectively captured when the AAV vector is integrated into the host genome with an incomplete sequence during the experiment by designing primers at multiple positions in the experimental design step. At the same time, during the sequencing process, if the rAAV break position happens to be on the primer sequence, there will be a small amount of loss of the terminal base of the primer sequence. If the reference primer sequence is directly used for sequence matching, the matching result data will be lost. Even if a small amount of primer sequence base mismatch is allowed during matching, its matching logic is not completely consistent with the logic of primer terminal base loss. Therefore, the present invention designs a bioinformatics algorithm to screen out the optimal primer sequence through subsequence according to the actual sequencing data to maximize the detection results.

[0107] Furthermore, based on the experimental design of inserting multiple primers into the AAV vector sequence, after the AAV vector sequence is integrated into the host genome, when an integrated sequence contains multiple primers, each primer will trigger a sequence amplification. Ultimately, an integrated sequence containing multiple primers will amplify multiple different result sequences, that is, the original result sequence has data redundancy. Therefore, the present invention designs an informatics algorithm to eliminate the result redundancy caused by multiple primers amplifying the same integrated sequence, thereby obtaining accurate quantitative results.

[0108] The above are only a few preferred embodiments of the present invention, and their description is relatively specific and detailed, but it should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art may make various modifications and improvements without departing from the scope of the present invention, and such modifications and improvements are within the scope of protection of the present invention.

Claims

1. A method for analyzing integration sites based on multi-primer design, characterized in that: The following steps are involved: S1, inserting primers at multiple positions of the AAV vector sequence to form a multi-primer vector; S12, integrating the multi-primer vector into the host genome, and capturing the sequence of the integration site by primer amplification; S3. Sequencing the sequence at the integration site to obtain sequencing data; S4. De-redundancy processing of sequencing data: Through the multi-primer sequencing data de-redundancy bioinformatics algorithm, the redundancy of sequencing results caused by multi-primer amplification is eliminated to obtain accurate integration site detection results.

2. The integration site analysis method based on multi-primer design according to claim 1, wherein: The multi-primer sequencing data redundancy removal algorithm comprises the following steps: Obtain all sequencing sequences supporting the integration site and annotate the primer information contained in each sequence; Compare the primer information of different sequences. If the primer information of one sequence is a subset of the primer information of another sequence, retain the sequence corresponding to the subset and filter out the redundant sequences. All integration sites were de-redundanted to obtain accurate integration site statistics.

3. The integration site analysis method according to claim 1, wherein Described primer design comprises the following steps: Multiple primers were designed based on the ITR region of the AAV vector sequence; The effectiveness and specificity of the primers were verified experimentally to ensure that the primers could effectively amplify the target sequence.

4. The integration site analysis method according to claim 3, wherein The nucleotide sequences of the primers are shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No.

3.

5. The integration site analysis method according to any one of claims 1 to 3, characterized in that: The sequencing data de-redundancy processing comprises the following steps: S41, enumerate candidate primer subsequences using the k-mer algorithm; S42, counting the occurrence frequency of each candidate primer subsequence, and selecting the subsequence with the highest occurrence frequency as the optimal primer; S43. Extract the integrated sequence based on the optimal primers to maximize the retention of sequencing results.

6. A primer for use in the analysis method according to any one of claims 1 to 5, characterized in that: The nucleotide sequences are shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No.

3.

7. A computer-readable storage medium, characterized in that A computer program for executing the integration site analysis method based on multi-primer design according to any one of claims 1 to 5 is stored, wherein the computer program includes an information-based algorithm for de-redundancy and primer optimization.

8. A server system for executing the integration site analysis method based on multi-primer design according to any one of claims 1 to 5, characterized in that: It includes a data receiving module, a data analysis module and a result output module. The data analysis module is configured with a bioinformatics algorithm for redundancy removal and primer optimization.

9. A device for performing the integration site analysis method based on multi-primer design according to any one of claims 1 to 5, characterized in that: The system includes a gene crusher, a PCR instrument, a sequencer and a data analysis server, wherein the data analysis server is equipped with an information-based algorithm for redundancy removal and primer optimization.

10. Use of an integration site analysis method based on the multi-primer design according to any one of claims 1 to 5 in drug safety assessment or gene therapy vector design.

Images