Application of zedoary turmeric oil in preparation of medicine for treating lung cancer in combination with thermal therapy and radiotherapy
By using zedoary turmeric oil as a radiotherapy sensitizer, combined with thermotherapy and radiotherapy, and regulating TLK2 expression, the unclear role of zedoary turmeric oil in the treatment of lung cancer and the problems of chemotherapy resistance were solved. It significantly improved the sensitivity of lung cancer cells to radiotherapy, inhibited cell proliferation and migration, promoted the apoptosis of lung adenocarcinoma cells, and prolonged the tumor growth inhibition effect.
Patent Information
- Application Number
- CN202511267855.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-05
- Publication Date
- 2025-10-14
AI Technical Summary
In the existing technology, the role and mechanism of zedoary oil in enhancing the sensitivity of lung cancer cells to radiotherapy are still unclear. Chemotherapy drugs have problems of drug resistance and side effects. The existing combined treatment of radiotherapy and heat therapy has limited effect, making it difficult to effectively improve the treatment effect of lung cancer.
Curcuma oil was used as a radiosensitizer, combined with thermotherapy and radiotherapy, to enhance the sensitivity of lung cancer cells to radiotherapy by regulating TLK2 expression, inhibiting cell proliferation and migration, and promoting cell apoptosis.
Curcuma oil combined with hyperthermia significantly increased the sensitivity of lung cancer cells to radiotherapy, inhibited cell proliferation and migration, promoted apoptosis of lung adenocarcinoma cells, and prolonged the inhibitory effect on lung tumor growth in mice.
Smart Images

Figure CN120771252A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of medicine, in particular to the use of zedoary oil in the preparation of a medicament for treating lung cancer in combination with hyperthermia and radiotherapy. BACKGROUND
[0002] Lung cancer is the malignant tumor with the highest incidence and mortality in China. From the perspective of histopathology, lung cancer is mainly divided into non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), among which NSCLC accounts for about 85% of clinical cases, which can be further divided into lung squamous carcinoma, lung adenocarcinoma, lung squamous adenocarcinoma and other subtypes, and the overall cure rate and survival rate are low. The treatment plan of NSCLC mainly depends on the stage of the disease and the health status of the patient. In recent years, great progress has been made in the treatment of lung cancer, and the treatment methods include surgical treatment, chemotherapy, hyperthermia and radiotherapy, etc. Among them, radiotherapy plays an increasingly important role in the treatment of lung cancer, and more than 70% of lung cancer patients apply radiotherapy in the treatment.
[0003] Radiotherapy (RT) or radiotherapy is one of the important treatment methods for NSCLC, and almost throughout the entire process of NSCLC treatment. Radiotherapy can be used as a radical treatment measure for early and part of advanced NSCLC patients who cannot be operated. The main mechanism is that radiotherapy directly or indirectly induces DNA damage through the production of reactive oxygen species, and the types of DNA damage include base mutation, single-strand break (SSB) and double-strand break (DSB). When DNA is damaged, the cell will start the DNA damage response or DNA damage repair system (DDR) pathway, leading to cell cycle arrest for DNA damage repair, so as to maintain the normal progress of the cell cycle; if the damage cannot be repaired, the cell will enter the senescence state; and when the damage is serious, it will directly trigger apoptosis, and the principle of radiotherapy is as shown in Figure 1
[0004] In addition, for patients with advanced NSCLC, radiotherapy can inhibit the growth of metastatic lesions, prolong the survival of patients, or as a palliative treatment to delay the symptoms of patients and improve the quality of life. However, some tumor cells can resist radiation-induced oxidative stress and DNA damage induction through various intracellular pathways, showing radioresistance; other cancer cells can gradually adapt to radiation stress and develop acquired radioresistance. The decrease in radiosensitivity limits the therapeutic effect of radiotherapy, although increasing the radiation dose can lead to the death of tumor cells, but too high a dose will cause damage to adjacent normal tissues and related side effects, and to some extent, reduce the local control rate of tumors, which is an important limiting factor for the selection of radiotherapy dose. Therefore, the development of new and effective radiosensitizers to improve the efficacy of lung cancer radiotherapy and thus improve the prognosis of patients has become an urgent need for current clinical research.
[0005] The clinical treatment model of lung cancer is changing, and more comprehensive factors are included in the decision-making process in addition to age, performance status, and non-small cell histology. Radiotherapy can not only be used as a neoadjuvant therapy to reduce the lesion before surgery to give patients the opportunity to undergo surgery, but also as an adjuvant therapy to reduce the risk of local recurrence of tumors and improve the quality of life of patients. In order to further improve the therapeutic effect, various radiosensitization strategies have been developed and applied in clinical practice.
[0006] Hyperthermia (HT) or thermal therapy is one of the strategies to enhance the radiosensitivity of radiotherapy. As a treatment method with no toxic side effects, no damage to normal tissues, and no impact on the immune function of the body, hyperthermia has become the fifth way of cancer treatment and plays an important role in multidisciplinary treatment. Therapeutic hyperthermia directly kills tumor cells by raising the temperature of the tumor-bearing tissue to 40-43°C, using a heat shock temperature of about 41-42°C. Its biological mechanism mainly involves the destruction of chromosomal proteins bound to DNA in tumor cells, leading to the accumulation of denatured proteins in the nucleus, thereby affecting normal cell function, inhibiting DNA damage repair, sensitizing “S” phase cells, and enhancing the radiosensitivity of hypoxic cells, especially under low pH and nutrient deficiency conditions. The main principle of action of hyperthermia is shown in Figure 2
[0007] Hyperthermia has limited effect on the clearance of local and distant lesions, and the deficiency of anti-tumor immune response is partly due to the lack of "second signal" required for immune cell activation, i.e. the lack of costimulatory signals between antigen-presenting cells (APCs) and T cells. Local high temperature induces tumor cell death and releases a large amount of antigen, which is taken up by APCs and processed into antigen peptide complexes, providing sufficient "first signal" (T cell receptor). However, T cells in the tumor microenvironment often express inhibitory receptors such as PD-1 and CTLA-4, which compete with the costimulatory molecule CD28 for binding to the ligand CD80 / 86 on the surface of APCs, resulting in the lack of "second signal" and inhibiting T cell activation. Therefore, blocking immune checkpoints on the surface of T cells to restore the "second signal" may be a key strategy to enhance the efficacy of hyperthermia. Studies have shown that after 120 h of heat stimulation at 39, 41, and 44°C, radiotherapy combined with hyperthermia can significantly enhance the expression levels of PD-L1, PD-L2, and herpes virus entry mediator (HVEM) in breast cancer cells compared with radiotherapy alone, which indicates that hyperthermia may enhance the sensitivity of tumors to ICI by promoting the expression of PD-L1 on the surface of tumor cells. In a breast cancer mouse model that is not sensitive to immunotherapy, combined 42.5°C hyperthermia can significantly improve the sensitivity of tumors to CTLA-4 monoclonal antibody treatment.
[0008] Another strong basis for the combination of hyperthermia and radiotherapy is that hyperthermia can effectively kill the hypoxic cell population that is resistant to radiation. Tumor blood vessels exhibit abnormalities in their structure and function, and cannot meet the oxygen and nutrient needs of rapid tumor growth, leading to a lack of nutrients, hypoxia, and acidic microenvironment inside the tumor. Cells that survive in these conditions are called hypoxic cells. In vitro studies have shown that long-term or chronic hypoxia can increase the heat sensitivity of cells, making hypoxic cells more sensitive to the lethal effects of high temperature than cells in a high-oxygen environment. In recent years, a large number of in vitro and in vivo experiments and clinical data have shown that hyperthermia combined with radiotherapy has shown good therapeutic effect in head and neck cancer, melanoma, breast cancer, cervical cancer, rectal cancer, and lung cancer, etc. Hyperthermia as an adjuvant to radiotherapy / chemotherapy can improve clinical efficacy and provide new strategies and directions for tumor treatment.
[0009] Chemotherapy has been established as an important treatment for NSCLC in clinical practice. For patients with resectable NSCLC, postoperative adjuvant chemotherapy can reduce the risk of recurrence of NSCLC, and for patients with advanced disease, chemotherapy has been considered as the core of palliative treatment. At present, the clinical chemotherapy drugs for lung adenocarcinoma are very limited, mainly relying on classic drugs such as platinum and antimetabolites. Cisplatin (DDP) as a representative of platinum drugs, by forming abnormal cross-linking of DNA chain to destroy the DNA structure in tumor cells and inhibit the abnormal proliferation of tumor, not only can prolong the survival of patients, but also has the effect of RT sensitization, which is the basis of concurrent chemoradiotherapy. Gemcitabine is an analogue of deoxycytidine (2,2-difluorodeoxycytidine, dFdC), which plays an antitumor effect by interfering with DNA synthesis. The remission rate of gemcitabine alone or combined with cisplatin in the treatment of patients with advanced NSCLC can reach 18-26%. Pemetrexed (PMX) as an antifolate drug, combined with cisplatin chemotherapy has become the standard treatment for NSCLC, and is also the first-line treatment for lung cancer brain metastasis.
[0010] The clinical application of chemotherapy faces two major challenges: first, the original or acquired drug resistance of tumor cells often leads to treatment failure and metastasis. Second, the existing types of chemotherapy drugs are limited, which seriously affects the quality of life of patients. In order to break through these bottlenecks, for patients with stage II-III NSCLC who cannot be operated or technically resected, chemotherapy combined with radiotherapy has been established as the standard treatment. Similar strategies have also shown advantages in the treatment of other solid tumors: carboplatin and paclitaxel chemotherapy combined with radiotherapy can significantly prolong the survival of patients and reduce the recurrence rate, which is a commonly used regimen for the treatment of endometrial cancer. In the treatment of locally advanced pancreatic cancer, gemcitabine and capecitabine chemotherapy combined with stereotactic body radiotherapy (SBRT) has a high clinical remission rate, improves clinical efficacy and survival prognosis, and improves quality of life with tolerable side effects. For patients with unresectable locally advanced lung adenocarcinoma, pemetrexed combined with cisplatin and concurrent radiotherapy can significantly improve the treatment effect, significantly reduce the level of tumor markers to normal, and significantly prolong the progression-free survival rate of patients and improve the quality of life of patients.
[0011] The development of chemotherapy combined with radiotherapy technology creates opportunities for major progress in the treatment of NSCLC. In recent years, with the development of chemotherapy resistance, the scarcity of chemotherapy drugs, and side effects, the quality of life of patients has been affected, and the risk of death has increased. Therefore, it is urgent to screen chemotherapy drugs with high efficacy and small side effects. In this context, the characteristics of multi-target and low toxicity of traditional Chinese medicine provide a new direction for the development of new antitumor drugs.
[0012] Zedoary turmeric oil (ZTO) is a volatile oil extracted from Zedoary, containing zedoary ketone, zedoary alcohol, β-elemene, furandiene and other effective components, with antibacterial, anti-inflammatory and anticancer effects. Among them, β-elemene, the main component of Zedoary turmeric oil, can not only directly kill tumors, but also reduce MMP, activate intracellular oxidation-reduction system, promote tumor cell apoptosis and hinder the activation of DNA damage repair mechanism, increasing the sensitivity to radiotherapy. Germacrone is a monocyclic sesquiterpene that is an effective cell cycle arrest and apoptosis inducer in various cancers (breast cancer, ovarian cancer, liver cancer and glioma) by participating in multiple cell signal targets and pathways of tumor proliferation. Notably, not only the monomer components of Zedoary turmeric oil have antitumor activity, but the whole extract can also significantly inhibit the proliferation and migration of lung adenocarcinoma A549 cells and promote cell apoptosis. These characteristics make Zedoary turmeric oil a potential candidate drug for overcoming chemotherapy resistance and improving radiotherapy efficacy, providing a new research direction for optimizing NSCLC treatment strategies.
[0013] To improve the treatment effect of NSCLC, in addition to the conventional treatment regimen, the combination of hyperthermia, chemotherapy and radiotherapy has become one of the promising treatment methods. It has shown effectiveness in improving the survival and quality of life of patients with advanced lung cancer. QuanLi et al. proved in 2020 that mild hyperthermia before radiotherapy can dilate blood vessels, increase blood perfusion and relieve hypoxia, thereby increasing the sensitivity of tumor cells to radiotherapy. Mild hyperthermia after radiotherapy inhibits the repair of DNA damage caused by irradiation. Similar synergistic effects have been verified in other cancer treatments, for example, the combination of pyrotinib and radiotherapy not only prolongs the survival of breast cancer patients with brain metastases, but also reduces toxicity and effectively improves the quality of life of patients. Iason Psilopatis et al. (2023) proposed the use of intraperitoneal hyperthermic chemotherapy in the treatment of uterine cancer. Intraperitoneal hyperthermic chemotherapy is a form of local chemotherapy that uses heating to improve the effectiveness of chemotherapy on peritoneal metastasis and is a promising treatment option. Some clinical studies of NSCLC patients have shown that hyperthermia combined with chemotherapy or radiotherapy is an effective and safe method for controlling malignant tumors. Karasawa et al. proved that radiotherapy combined with hyperthermia can control locally advanced NSCLC, and radiotherapy combined with hyperthermia can induce apoptosis and inhibit the proliferation of human lung adenocarcinoma A549 cells.
[0014] In summary, lung cancer is the highest incidence and mortality of cancer in China and even the world. The treatment of non-small cell lung cancer needs to be decided according to the stage of the disease and the health status of the patient. Radiotherapy as a core treatment method runs through all stages of lung cancer treatment, but high-dose radiotherapy increases the local treatment effect while also inducing serious complications of radiation pneumonia, and even causing death. In order to improve the treatment effect of NSCLC, reduce the pain of patients and prolong the life of patients, combined therapy based on conventional treatment has become an important research direction. Current studies have shown that radiotherapy combined with chemotherapy can induce apoptosis of human lung adenocarcinoma A549 cells and inhibit cell proliferation, and hyperthermia can not only make cancer cells sensitive to subsequent chemotherapy / radiotherapy, but also enhance the cytotoxicity of these interventions. Chemotherapy is one of the important methods for treating tumors at present, but during chemotherapy, patients generally have side effects such as nausea and vomiting, and chemotherapy drugs have limitations. Therefore, it is urgent to screen chemotherapy drugs with high efficacy and small side effects. Traditional Chinese medicine has unique mechanisms such as small side effects and multiple targets, so the research hotspot of anticancer drugs mainly focuses on Chinese herbal medicines. Zedoary oil is a volatile oil extracted from Chinese herbal medicine Zedoary, and zedoary oil can inhibit the proliferation and migration of lung adenocarcinoma cells and induce apoptosis.
[0015] Although the prior art discloses the above, the role and mechanism of zedoary oil combined with hyperthermia in enhancing the radiotherapy sensitivity of lung cancer cells are not clear. SUMMARY
[0016] Based on the problems existing in the prior art, the present application provides the following technical solutions:
[0017] The first aspect of the present application provides the use of zedoary oil in the preparation of a drug for treating lung cancer in combination with hyperthermia and radiotherapy.
[0018] In the present application, "treatment" should be understood in the broadest sense and covers the meaning of "adjuvant therapy", wherein "adjuvant therapy" means for enhancing the effectiveness of anticancer, or preventing or treating conditions related to anticancer.
[0019] In the present application, "treatment" can also include the meaning of "prevention".
[0020] In the present application, the term "prevention" includes reducing the likelihood of the occurrence or aggravation of a disease or condition in a patient.
[0021] In the present application, the term "treatment" and other similar synonyms include the following meanings:
[0022] (i) preventing a disease or condition from occurring in a mammal, in particular, when such mammal is predisposed to the disease or condition but has not yet been diagnosed as having it;
[0023] (ii) inhibiting the disease or condition, i.e., arresting its development;
[0024] (iii) alleviating the disease or condition, i.e., causing the condition to become less severe;
[0025] (iv) relieving the symptoms of the disease or condition.
[0026] Preferably, the lung cancer is non-small cell lung cancer. More preferably, the lung cancer is lung adenocarcinoma.
[0027] Preferably, the drug is a radiotherapy sensitizer, which comprises an effective amount of 180-220 mg / kg of zedoary oil, administered at least once a week.
[0028] More preferably, the radiotherapy sensitizer comprises an effective amount of 180-220 mg / kg of zedoary oil.
[0029] More preferably, the radiotherapy sensitizer is administered at least 3 times a week.
[0030] More preferably, the radiotherapy sensitizer comprises an effective amount of 180-200 mg / kg of zedoary oil, administered at least 3 times a week.
[0031] Preferably, the radiotherapy is at a dose of 2-6 Gy each time, administered at least once a week, for a total of at least 3 times.
[0032] Preferably, the hyperthermia is at a condition of 40-45 °C for 30-60 min.
[0033] Preferably, the radiotherapy is at a dose of 2-6 Gy each time, administered at least once a week, for a total of at least 3 times; and / or the hyperthermia is at a condition of 40-45 °C for 30-60 min.
[0034] More preferably, the hyperthermia is at a condition of 40-43 °C for 30-40 min.
[0035] Further, the drug is prepared from zedoary oil and at least one pharmaceutical carrier and / or at least one pharmaceutical excipient via common pharmaceutical methods.
[0036] Preferably, the pharmaceutical excipient comprises at least one of a co-solvent, a diluent, a binder, a disintegrant, a lubricant, and a flavoring agent.
[0037] More preferably, the co-solvent comprises polysorbate. Most preferably, the co-solvent comprises polysorbate 80.
[0038] Preferably, the dosage form of the drug comprises an injection, a tablet, a capsule, or a granule. More preferably, the dosage form of the drug is an injection.
[0039] More preferably, the drug is prepared from zedoary oil and polysorbate into an injection via common pharmaceutical methods.
[0040] Preferably, the method of drug administration comprises oral or parenteral administration. Among them, the parenteral administration method comprises but is not limited to one or more of the administration routes taking oral or intravenous injection, intravenous infusion, intramuscular injection, subcutaneous injection. More preferably, the method of drug administration is intravenous infusion.
[0041] The second aspect of the present application provides a pharmaceutical composition for treating lung cancer in combination with hyperthermia and radiotherapy, wherein the pharmaceutical composition is a radiotherapy sensitizer, comprising an effective amount of 180-220 mg / kg of zedoary oil, and at least one pharmaceutical carrier and / or at least one pharmaceutical adjuvant, and the pharmaceutical composition is administered at least once a week.
[0042] Preferably, the pharmaceutical composition is administered at least 3 times a week.
[0043] Preferably, the dose of radiotherapy is 2-6 Gy each time, at least once a week, for a total of at least 3 times.
[0044] Preferably, the condition of hyperthermia is 40-45℃, for 30-60 min.
[0045] Preferably, the dose of radiotherapy is 2-6 Gy each time, at least once a week, for a total of at least 3 times; and / or the condition of hyperthermia is 40-45℃, for 30-60 min.
[0046] More preferably, the condition of hyperthermia is 40-43℃, for 30-40 min.
[0047] Further, in the present application, the zedoary oil combined with hyperthermia inhibits cell proliferation, migration, and promotes apoptosis by down-regulating TLK2 to promote the radiotherapy sensitivity of human lung adenocarcinoma cells.
[0048] The endpoints of the ranges and any numerical value disclosed herein are not limited to the precise values stated. These ranges and values should be construed and interpreted as being inclusive of values adjacent to the recited ranges and / or values. For values which are less than one, ranges falling below the lower limit of those endpoints are inclusive of sub-ranges falling to zero, including zero itself. For values which are greater than one, ranges falling above the upper limit of those endpoints are inclusive of sub-ranges falling to infinity, including infinity itself. It is noted that specific values can be varied by ±2% as the numerical protection scope of the present application.
[0049] In the description of the present application, unless otherwise specified, the meaning of "multiple" and the like similar words is two or more. In addition, "comprising", "including", "having", "containing" and the like and any modification thereof used in the present application are open terms, that is, it means to include but not limited to.
[0050] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as those commonly understood by one of ordinary skill in the art to which the application pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, preferred methods and materials are described. All documents mentioned herein are incorporated by reference to disclose and describe in full the methods and / or materials which are described therein. In case of conflict between the present specification and any document incorporated herein by reference, the present specification will control.
[0051] The pharmaceutical compositions described herein are used in the treatment of lung cancer in combination with hyperthermia and radiotherapy. In the present application, the terms "drug" and "pharmaceutical composition" are used interchangeably, and "drug / pharmaceutical composition" refers to a preparation of a compound of the present application with a medium generally accepted in the art for the delivery of a biologically active compound to a mammal (e.g., a human). The purpose of a pharmaceutical composition is to facilitate administration of the biological agent, to aid in absorption of the active ingredient, and to facilitate the biological activity. The term "pharmaceutically acceptable" as used herein means a substance (such as a carrier or a diluent) that does not affect the biological activity or properties of the compounds of the present application, and is relatively nontoxic, i.e., the material is administered to an individual without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.
[0052] In some preferred embodiments, the pharmaceutical excipient comprises at least one of a co-solvent, a diluent, a binder, a disintegrant, a lubricant, and a flavoring agent.
[0053] In some more preferred embodiments, the co-solvent comprises a polysorbate. In some most preferred embodiments, the co-solvent comprises polysorbate 80.
[0054] In the present application, the pharmaceutical carrier comprises at least one of dextrose, castor oil, corn oil, germ oil, peanut oil, oleic acid, olive oil, 1,3-butanediol, sesame oil, soybean oil, or a sodium chloride solution, water, or a mixture thereof.
[0055] In the present application, the term "effective amount," or "pharmaceutically effective amount," refers to an amount that is sufficient to effectuate a prophylactic or therapeutic effect on a human and / or other animal, and that is acceptable to the human and / or other animal. The result can be a reduction and / or alleviation of signs, symptoms, or causes of a disease or disorder, or any other desired alteration of a biological system. For example, an "effective amount" for therapeutic uses is the amount of a composition comprising a compound as disclosed herein that is sufficient to result in a significant reduction in clinical symptoms of a disease state. Amounts effective for a particular case will depend on the dosage of the compound, the frequency with which it is given, and the route of administration, among other factors. Techniques for
[0056] In the present application, the terms "administering," "administered," "administration," and the like, refer to the methods by which a compound or composition is delivered to the desired site of biological action.
[0057] In the present application, the radiotherapy or radiation therapy is external irradiation, usually with 5-10 MV X-ray irradiation. Preferably, 6 MV X-ray irradiation is used.
[0058] The pharmaceutical composition of the present application comprising an effective amount of zedoary oil (a radiosensitizer) is administered for treating lung cancer in a mammal (including humans and other animals) in need of combined hyperthermia and radiotherapy, wherein the dose is administered at a pharmaceutically prophylactically or therapeutically effective dose. Of course, the specific dose should also take into account the route of administration, the patient's health status, etc., which are within the skill of a skilled physician. In some preferred embodiments, if it is treatment, the dose of radiotherapy is 2-6 Gy each time, at least once a week, a total of at least 3 times; the dose of the pharmaceutical composition of the present application is at least once a week, and the effective amount of zedoary oil administered each time is 180-220 mg / kg. In some more preferred embodiments, if it is treatment, the dose of radiotherapy is 2 Gy each time, at least once a week, a total of at least 3 times; the dose of the pharmaceutical composition of the present application is at least 3 times a week, and the effective amount of zedoary oil administered each time is 180-200 mg / kg. In some more preferred embodiments, if it is treatment, the dose of radiotherapy is 6 Gy each time, at least once a week, a total of at least 3 times; the dose of the pharmaceutical composition of the present application is at least 3 times a week, and the effective amount of zedoary oil administered each time is 180-200 mg / kg.
[0059] The beneficial effects of the present application at least include:
[0060] 1. The present application first discovers the effect of zedoary oil combined with hyperthermia on the radiosensitivity of lung cancer cells, and the mechanism of zedoary oil combined with hyperthermia in enhancing the radiosensitivity of lung cancer cells.
[0061] 2. Zedoary oil combined with hyperthermia promotes the radiosensitivity of lung adenocarcinoma cells, inhibits cell proliferation and migration, and promotes cell apoptosis.
[0062] 3. Zedoary oil combined with hyperthermia promotes the radiosensitivity of lung tumor in mice, and inhibits the growth of lung tumor.
[0063] 4. Zedoary oil combined with hyperthermia promotes the radiosensitivity of lung cancer (especially lung adenocarcinoma) cells by down-regulating TLK2, inhibits cell proliferation and migration, and promotes cell apoptosis. BRIEF DESCRIPTION OF DRAWINGS
[0064] Figure 1 The principle of radiotherapy is shown.
[0065] Figure 2 The main principle of hyperthermia treatment is shown.
[0066] Figure 3Figure 8 shows the effect of zedoary oil combined with radiotherapy and hyperthermia (the three combined treatments) on the viability of A549, H1299 and MRC-5 cells, wherein ** indicates P<0.01, *** indicates P<0.001 compared with the blank control group, and ## indicates P<0.01, ### indicates P<0.001 compared with the 6 Gy group.
[0067] Figure 4 Figure 9 shows the effect of zedoary oil combined with radiotherapy and hyperthermia (the three combined treatments) on the clonogenicity of A549 and H1299 cells, wherein *** indicates P<0.001 compared with the blank control group, and ### indicates P<0.001 compared with the 6 Gy group.
[0068] Figure 5 Figure 10 shows the effect of zedoary oil combined with radiotherapy and hyperthermia (the three combined treatments) on the proliferation of A549 and H1299 cells as determined by the EdU method, wherein * indicates P<0.05, *** indicates P<0.001 compared with the blank control group, and ### indicates P<0.001 compared with the 6 Gy group.
[0069] Figure 6(A1)-Figure 6(A6) and Figure 6(B1)-Figure 6(B6) Figures 11 and 12 show the effect of zedoary oil combined with radiotherapy and hyperthermia (the three combined treatments) on the cell cycle of A549 and H1299 cells, respectively, wherein * indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001 compared with the blank control group, and ## indicates P<0.01, ### indicates P<0.001, ns indicates no significant difference compared with the 6 Gy group.
[0070] Figure 7 Figure 13 shows the effect of zedoary oil combined with radiotherapy and hyperthermia (the three combined treatments) on the expression of proliferation-related genes in A549 and H1299 cells, wherein * indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001 compared with the blank control group, and # indicates P<0.05, ## indicates P<0.01, ### indicates P<0.001, ns indicates no significant difference compared with the 6 Gy group.
[0071] Figure 8 Figure 14 shows the effect of the three combined treatments on the migration of human lung adenocarcinoma cells as determined by the cell scratch test, wherein ** indicates P<0.01, *** indicates P<0.001 compared with the blank control group, and ## indicates P<0.01, ### indicates P<0.001 compared with the 6 Gy group.
[0072] Figure 9Figure 11(A) and Figure 11(B) show the effect of zedoary oil combined with radiotherapy and hyperthermia (tritherapy) on the mitochondrial membrane potential of A549 and H1299 cells, respectively, wherein *** means P<0.001 compared with the blank control group, and ### means P<0.001 compared with the 6 Gy group.
[0073] Figure 10 Figure 10 shows the morphology of A549 and H1299 cells under laser confocal microscope.
[0074] Figure 11(A) and Figure 11(B) show the effect of zedoary oil combined with radiotherapy and hyperthermia (tritherapy) on the mitochondrial membrane potential of A549 and H1299 cells, respectively, wherein *** means P<0.001 compared with the blank control group, and ### means P<0.001 compared with the 6 Gy group.
[0075] Figure 12(A) and Figure 12(B) show the effect of zedoary oil combined with radiotherapy and hyperthermia (tritherapy) on the apoptosis rate of A549 and H1299 cells, respectively, wherein *** means P<0.001 compared with the blank control group, and # means P<0.05, ### means P<0.001, and ns means no significant difference compared with the 6 Gy group.
[0076] Figure 13 Figure 13(A) and Figure 13(B) show the effect of zedoary oil combined with radiotherapy and hyperthermia (tritherapy) on the DNA fragmentation of A549 and H1299 cells, respectively, wherein *** means P<0.001 compared with the blank control group, and ### means P<0.001 compared with the 6 Gy group.
[0077] Figure 14 Figure 14(A) and Figure 14(B) show the effect of zedoary oil combined with radiotherapy and hyperthermia (tritherapy) on the mRNA and protein expression of apoptosis-related genes in human lung adenocarcinoma A549 and H1299 cells, respectively, wherein * means P<0.05, ** means P<0.01, and *** means P<0.001 compared with the blank control group, and # means P<0.05, ## means P<0.01, and ### means P<0.001 compared with the 6 Gy group, and ns means no significant difference.
[0078] Figure 15 Figure 15 shows the effect of zedoary oil combined with radiotherapy and hyperthermia (tritherapy) on lung adenocarcinoma tumor tissue, wherein ** means P<0.01, and *** means P<0.001 compared with the blank control group, and # means P<0.05, and ### means P<0.001 compared with the 6 Gy group, and ns means no significant difference.
[0079] Figure 16Figure 20 shows the effect of TLK2 combined with radiotherapy and hyperthermia and zedoary oil on the apoptosis rate of A549 and H1299 cells, wherein pLV3 and PCMV are empty vector controls, ** represents P<0.01, *** represents P<0.001 compared with the control group, ### represents P<0.001 compared with the 6Gy group, and ns represents no significant difference.
[0080] Figure 17(A) to Figure 17(D) Figure 20 shows the effect of TLK2 combined with radiotherapy and hyperthermia and zedoary oil on the apoptosis rate of A549 and H1299 cells, wherein pLV3 and PCMV are empty vector controls, ** represents P<0.01, *** represents P<0.001 compared with the control group, ### represents P<0.001 compared with the 6Gy group, and ns represents no significant difference.
[0081] Figure 18 Figure 20 shows the effect of TLK2 combined with radiotherapy and hyperthermia and zedoary oil on the apoptosis rate of A549 and H1299 cells, wherein pLV3 and PCMV are empty vector controls, ** represents P<0.01, *** represents P<0.001 compared with the control group, ### represents P<0.001 compared with the 6Gy group, and ns represents no significant difference.
[0082] Figure 19 Figure 20 shows the effect of TLK2 combined with radiotherapy and hyperthermia and zedoary oil on the apoptosis rate of A549 and H1299 cells, wherein pLV3 and PCMV are empty vector controls, ** represents P<0.01, *** represents P<0.001 compared with the control group, ### represents P<0.001 compared with the 6Gy group, and ns represents no significant difference.
[0083] Figure 20 shows the effect of TLK2 combined with radiotherapy and hyperthermia and zedoary oil on the apoptosis rate of A549 and H1299 cells, wherein pLV3 and PCMV are empty vector controls, ** represents P<0.01, *** represents P<0.001 compared with the control group, ### represents P<0.001 compared with the 6Gy group, and ns represents no significant difference. DETAILED DESCRIPTION
[0084] The present application will be further described in conjunction with specific examples. It should be understood that the following content is only used to explain the present application and cannot be understood as a limitation of the present application. The present application specification and examples are only exemplary. The experimental methods in the following examples are not specified, and are usually carried out according to the conventional conditions or according to the conditions recommended by the manufacturer.
[0085] Example 1
[0086] 2.2 Experimental materials
[0087] 2.2.1 Experimental animals, cell lines
[0088] Human non-small cell lung adenocarcinoma cell lines A549 and H1299 and human embryonic lung cells MRC-5 were purchased from Wuhan Pons Life Science Co., Ltd.; Balb / c nude mice were purchased from Sanyei (Suzhou) Biotechnology Co., Ltd.
[0089] 2.3 Experimental process
[0090] 2.3.1 MTT method for determining human lung adenocarcinoma cell viability
[0091] After A549 and H1299 cells were inoculated into 96-well plates and treated according to Table 2.1, 10 μL of 5 mg / mL MTT was added to each well, and incubated at 37°C in the dark for 4 h. The culture medium was discarded, and 100 μL of DMSO solution was added. The OD value was measured at 490 nm. 490 nm The absorbance value was measured, and the inhibition rate was calculated by repeating the test three times. The inhibition rate = [(control group-experimental group) / (control group-blank group)]*100%.
[0092] Table 2.1 Cell treatment grouping table
[0093] Group Treatment method Control group No treatment Radiotherapy group 6 Gy treatment for 24 h Radiotherapy combined with hyperthermia group Hyperthermia 43℃ for 30 min, then 6 Gy treatment for 24 h Radiotherapy combined with ZTO group ZTO treatment for 24 h, then 6 Gy treatment for 24 h Radiotherapy combined with hyperthermia and ZTO group ZTO treatment for 24 h, then hyperthermia 43℃ for 30 min, and then 6 Gy treatment for 24 h
[0094] 2.3.2 EdU method for detecting human lung adenocarcinoma cell proliferation
[0095] After A549 and H1299 cells were inoculated into 6-well plates and cultured for 12 h, the cells were treated according to Table 2.1 and cultured at 37°C in a 5% CO2 incubator for 48 h. The EdU method was used to detect lung adenocarcinoma cell proliferation. The specific steps are described in the kit instructions (BeyoClick™ EdU-488 cell proliferation detection kit).
[0096] 2.3.3 Determination of cell colony formation ability
[0097] After the cells were treated according to Table 2.1, A549 and H1299 cells were digested, 1 mL of cells with a concentration of 100 cells / mL were inoculated in a 12-well plate, and cultured at 37°C in a 5% CO2 incubator for 7-10 d. After about 50 cell colonies were formed in the culture dish, the culture was stopped, washed twice with PBS, then fixed with methanol at room temperature for 0.5 h, added with 0.1% crystal violet and incubated at room temperature for 1 h, washed with running water, dried and photographed, and the number of colonies was counted by ImageJ software.
[0098] 2.3.4 Cell scratch, Tanswell detection of human lung adenocarcinoma cell migration ability
[0099] Cell scratch: A549, H1299 cells were seeded into 6-well plates for 12 h, then the cells were treated according to Table 2.1, and then 200 μL of the gun head was used to scratch the cells. The cells were gently washed with PBS and then replaced with complete medium. The cells were photographed at 0 h, 6 h, and 24 h, and the scratch area was calculated using ImageJ.
[0100] Transwell: A549, H1299 cells were seeded into 60 mm dishes for 12 h, then the cells were treated according to Table 2.1, and then the cells were resuspended with serum-free medium after trypsin digestion was stopped. The concentration was adjusted to 1×10 5 6 / mL, and 300 μL of the cell suspension was added to the upper chamber of the Transwell. At the same time, 500 μL of medium containing 20% fetal bovine serum was added to the lower chamber of the Transwell. After incubation at 37°C, 5% CO2 for 24 h, the cells were fixed with 4% paraformaldehyde for 0.5 h and then stained with 0.1% crystal violet for 1 h. Finally, the cells were washed with distilled water, air-dried, and then the upper chamber was removed and placed on a glass slide coated with neutral gum. The cells were observed, photographed, and counted under a microscope.
[0101] 2.3.5 Flow cytometry detection of cell cycle of human lung adenocarcinoma cells
[0102] The cells were seeded into 60 mm dishes 12 h before treatment, and then the cell cycle was detected after the cells were treated according to Table 2.1. The cells were trypsinized (without EDTA), transferred to a centrifuge tube, and centrifuged at 1000 g for 5 min. The cells were resuspended with pre-cooled PBS solution, centrifuged at 1000 g for 5 min, and the supernatant was discarded. 70% ethanol solution was added to the cell pellet, and the cells were resuspended and fixed at 4°C for 18 h or more. The cells were centrifuged at 1000 g for 5 min, and the supernatant was discarded. The cells were resuspended with PBS solution, centrifuged at 1000 g for 5 min, and the supernatant was discarded. 500 μL of cell cycle staining solution was added, and the cells were incubated at 37°C for 0.5 h. The cells were filtered with a 400-mesh filter, and then the cell cycle was detected.
[0103] 2.3.6 Laser confocal microscope detection of cell morphology
[0104] A549, H1299 cells were seeded into 6-well plates containing cell slides, cultured for 12 h, and then the cells were treated according to Table 2.1. The medium was discarded, the cells were washed twice with PBS, methanol was added for fixation for 30 min, and then the cells were washed twice with PBS. Acridine orange was added to the slides, and the cells were stained for 5 min. The slides were washed three times with PBS, removed, and inverted onto a glass slide coated with an anti-fluorescence quencher. The cell morphology was observed and photographed using a laser confocal microscope.
[0105] 2.3.7 Annexin V-FITC detection of apoptosis rate of human lung adenocarcinoma cells
[0106] After the cells were inoculated in 60 mm culture dishes, they were treated according to Table 2.1, and then trypsin (without EDTA) was used to digest the cells and transfer them to centrifuge tubes, 1000 g, 5 min, and the supernatant was discarded. The cells were resuspended in PBS, centrifuged at 1000 g for 5 min, the supernatant was discarded, and 5 μL Annexin V-FITC and 10 μL propidium iodide staining solution were added. Incubate in a 37°C incubator for 0.5 h in the dark, and mix well. Filter through a 400 mesh screen and detect on the machine.
[0107] 2.3.8 JC-1 detection of mitochondrial membrane potential changes of human lung adenocarcinoma cells
[0108] After the cells were inoculated in 60 mm culture dishes, they were treated according to Table 2.1, and then trypsin (without EDTA) was used to digest the cells and transfer them to centrifuge tubes, 1000 g, 5 min, and the supernatant was discarded. The cells were resuspended in PBS, centrifuged at 1000 g for 5 min, the supernatant was discarded, and 5 μL Annexin V-FITC and 10 μL propidium iodide staining solution were added. Incubate in a 37°C incubator for 0.5 h in the dark, and mix well. Filter through a 400 mesh screen and detect on the machine.
[0109] 2.3.9 One-step TUNEL detection of DNA fragmentation in human lung adenocarcinoma cells
[0110] Inoculate cells in 6-well plates containing cell slides, incubate for 12 h, then treat according to Table 2.1, discard the culture medium, rinse twice with PBS, incubate with 0.3% Triton X-100 in PBS at room temperature for 5 min, add TUNEL detection solution to cover the slide, incubate in a wet box at 4°C overnight, the next day rinse three times with PBS, add DAPI and incubate at room temperature for 5 min, rinse with PBS, then cut out the slide and mount it on a glass slide with anti-fluorescence quencher, and take pictures using a laser confocal microscope.
[0111] 2.3.10 qRT-PCR detection of mRNA expression of proliferation and apoptosis-related genes in human lung adenocarcinoma cells
[0112] 2.3.10.1 RNA extraction and reverse transcription
[0113] (1) Extraction of total RNA from A549 cells, H1299 cells and tumor tissues
[0114] Take out the tissue sample or collect blank group and experimental group A549 and H1299 cells in pre-cooled 1.5 mL EP tube, add 1 mL Trizol, add magnetic beads, homogenizer to break the tissue or cells, lysis on ice for 15 min; 12000 r / m centrifugation at 4℃ for 15 min; The upper liquid is moved to a new tube, add 250 μL chloroform solution, mix well and stand on ice for 15 min; 12000 r / m centrifugation at 4℃ for 15 min; The uppermost liquid is moved to a new tube, add 600 μL pre-cooled isopropanol, stand on ice for 15 min; 12000 r / m centrifugation for 15 min, discard the supernatant; Add 1 mL 75 % ethanol solution (DEPC water preparation), 12000 r / m centrifugation for 5 min, discard the supernatant, repeat the operation; Dry the centrifuge tube, add 10 μL pre-cooled DEPC water, measure the RNA concentration with NanoDrop 2000, and store at -80℃.
[0115] (2) Reverse transcription
[0116] Take 1 ng RNA to 0.2 mL EP tube, dH2O to 12 μL, 65℃ for 5 min, RNA denaturation; Add 4 μL 4×Mix, 37℃ for 5 min, stand in ice for 2 min; Add 2 μL 5×RT Master Mix II, 37℃ for 15 min; 98℃, 5 min. -20℃ for standby.
[0117] 2.3.10.2 qRT-PCR detection of gene expression
[0118] Dilute the reverse transcription product according to the ratio of 1:2, and prepare the qRT-PCR reaction system according to Table 2.2. The reaction conditions are 95℃ for 30 s; 95℃ for 5 s; 60℃ for 10 s, for a total of 35 cycles.
[0119] Table 2.2 qRT-PCR reaction system
[0120] Ingredient Volume TB Green Premix Ex Taq II (2×) 5 μL qRT-PCR upstream primer (10 μM) 0.5 μL qRT-PCR downstream primer (10 μM) 0.5 μL cDNA < 100 ng ddH2O Supplemented to 10 μL
[0121] The qRT-PCR primers of proliferation-related genes CCND1, PCNA, Ki67 and apoptosis-related genes Caspase3, Caspase8, Caspase9, FAS, Bcl-2 and Bax are shown in Table 2.3.
[0122] Table 2.3 qRT-PCR reaction primers
[0123] Gene Upstream primer (5'-3') Downstream primer (5'-3') CCND1 TCTACACCGACAACTCCATCCG (SEQ ID NO: 1) TCTGGCATTTTGGAGAGGAAGTG (SEQ ID NO: 2) PCNA CAAGTAATGTCGATAAAGAGGAGG (SEQ ID NO: 3) GTGTCACCGTTGAAGAGAGTGG (SEQ ID NO: 4) β-actin CTTCGCGGGCGACGAT (SEQ ID NO: 5) CCACATAGGAATCCTTCTGACC (SEQ ID NO: 6) Ki67 GAAAGAGTGGCAACCTGCCTTC (SEQ ID NO: 7) GCACCAAGTTTTACTACATCTGCC (SEQ ID NO: 8)
[0124] Continue table:
[0125] Gene Upstream primer (5'-3') Downstream primer (5'-3') Caspase3 GGAAGCGAATCAATGGACTCTGG (SEQ ID NO: 9) GCATCGACATCTGTACCAGACC (SEQ ID NO: 10) Caspase8 CACCTTGTGTCTGAGCTGGT (SEQ ID NO: 11) TGAGGGAGGCCAGATCTTCA (SEQ ID NO: 12) Caspase9 GACACCAGCATACAGAGTGACC (SEQ ID NO: 13) GTGCCATGACTGTCACACTTGC (SEQ ID NO: 14) Fas GGACCCAGAATACCAAGTGCAG (SEQ ID NO: 15) GTTGCTGGTGAGTGTGCATTCC (SEQ ID NO: 16) Bcl-2 ATCGCCCTGTGGATGACTGAGT (SEQ ID NO: 17) GCCAGGAGAAATCAAACAGAGGC (SEQ ID NO: 18) Bax ATCGCCCTGTGGATGACTGAGT (SEQ ID NO: 19) GCCAGGAGAAATCAAACAGAGGC (SEQ ID NO: 20)
[0126] 2.3.11 Western blot detection of proliferation and apoptosis-related protein expression in human lung adenocarcinoma cells
[0127] 2.3.11.1 Extraction of total protein from A549 and H1299 cells and determination of total protein concentration by BCA method
[0128] 5 x 10 4 -10 5 A549 and H1299 cells were evenly plated in 6-well plates, treated according to Table 2.1, and then 100 μL of RIPA lysis buffer containing proteasome inhibitors was added. The cells were collected into 1.5 mL centrifuge tubes, and after 0.5 h of shaking at 4°C, they were centrifuged at 13000 r / m for 15 min at 4°C, and the supernatant was retained.
[0129] Protein standard curve preparation: The standard required for the standard curve was prepared according to Table 2.4. The sample to be tested was diluted 1:5 with ddH2O, and the mixture was placed in a 0.2 mL EP tube. 25 μL of the sample to be tested was diluted and mixed with 200 μL of sample detection solution (A solution: B solution = 50:1) and transferred to a 96-well plate. After incubation at 37°C for 0.5 h in the dark, the OD562nm was measured on a microplate reader, and the standard curve was constructed. The remaining sample was added with 6x Buffer according to the standard curve, and the difference between the samples was calculated using 1x Buffer. The sample was stored at -20°C after being incubated at 98°C for 10 min.
[0130] Table 2.4 Determination of total protein concentration in A549 and H1299 cells
[0131] Standard concentration 2 mg / mL BSA Buffer ddH2O 0 0 μL 10 μL 40 μL 0.2 5 μL 10 μL 35 μL 0.4 10 μL 10 μL 20 μL 0.8 20 μL 10 μL 10 μL 1.0 25 μL 10 μL 5 μL
[0132] 2.3.11.2 SDS-PAGE electrophoresis for detection of protein expression
[0133] The polyacrylamide gel was prepared according to Table 2.5. After aligning the glass plates and clamping them, it was observed whether they were clamped properly. First, 6 mL of separation gel was added using a pipette, and methanol was used to press the separation gel flat. After the gel was solidified, the methanol was poured out, the concentrated gel was injected, and the comb was inserted. After the gel was solidified, the electrophoresis device was assembled, and an appropriate amount of protein sample was added to each well for electrophoresis under the following conditions: 90 V for 1.5 h.
[0134] Table 2.5 Polyacrylamide gel formulation
[0135] 3% separating gel formula 10% concentrated gel formula
[0136] Continuation table:
[0137] Composition Volume Composition Volume Double distilled water 5.12 mL Double distilled water 4.5 mL 30% acrylamide 6 mL 30% acrylamide 1 mL Tris-HCl (pH 8.8) 6.5 mL Tris-HCl (pH 6.8) 850 μL 10% SDS 180 μL 10% SDS 65 μL 10% APS (ammonium persulfate) 180 μL 10% APS (ammonium persulfate) 65 μL TEMED 18 μL TEMED 6.5 μL
[0138] (1) Transfer
[0139] Take out the concentrated gel, cut off the bromophenol blue and excess part, and put the separated gel into pre-cooled 1x transfer buffer. From top to bottom in order: white side of clamp, sponge, filter paper, PVDF membrane, separated gel, filter paper, sponge, black side of clamp, avoid air bubbles. Connect the power supply, 200 mA, 1 h. Put the wet transfer system in ice to reduce the temperature;
[0140] (2) Blocking
[0141] Use 1x TBST to configure 10% skim milk, take out the PVDF membrane from the wet transfer system, add an appropriate amount of skim milk, and block at room temperature for 1 h. Collect the blocking solution and rinse with 1x TBST, 15 min each time, repeat 3 times;
[0142] (3) Antigen-antibody immune reaction
[0143] Pour the diluted primary antibody into the incubation box containing the PVDF membrane, and incubate at 4°C overnight. The next day, recover the primary antibody, rinse with 1x TBST at room temperature for 15 min each time, and repeat 3 times. Add secondary antibody of the same species and incubate at room temperature in the dark for 1 h. Rinse with 1x TBST 3 times for 15 min each time. Use the Odyssey dual infrared laser imaging system to analyze and store the data, and use ImageJ to quantify the protein expression level.
[0144] 2.3.12 Establishment of mouse A549 cell subcutaneous tumor model
[0145] 6-week-old Balb / c nude mice were purchased from Sanyuan (Suzhou) Biotechnology Co., Ltd. The use and feeding of animals strictly followed the relevant regulations of the national experimental animal welfare ethics and the regulations of Qiqihar University for the management and use of experimental animals. A549 cells (5x10 6 were injected subcutaneously into the axillary fossa of nude mice. When the tumor volume was about 100 mm 3 When the tumor volume was about 100 mm 2a / b / 2, where a and b are the shorter and longer diameters of the tumor, respectively. Two weeks after treatment, the mice were sacrificed by cervical dislocation and the tumor xenografts were dissected and weighed. A portion was fixed in formalin, dehydrated, paraffin-embedded and sectioned, followed by immunohistochemical staining; another portion was extracted for RNA for gene expression detection. During the experiment, no mice showed signs of severe weight loss (>15%), infection or wounds.
[0146] 2.3.13 Immunohistochemical staining
[0147] After deparaffination and rehydration of the sections, endogenous peroxidase blocking was performed in the dark after tissue antigen retrieval; circles were drawn and 10% horse serum was added for blocking at 37°C. The primary antibody was added, and the samples were incubated overnight at 4°C. The next day, the samples were returned to room temperature, and the secondary antibody was added. After incubation at 37°C for 1 h, color development was performed using DAB, and the color development was observed under a microscope. After color development, hematoxylin staining and differentiation were performed, and the sections were dehydrated and transparentized before mounting. The sections were observed under a microscope.
[0148] 2.3.14 Construction of TLK2 interference and overexpression plasmids
[0149] TLK2 interference plasmid pLV3-U6-TLK2(human)-shRNA-Puro (abbreviated as sh-TLK2) and TLK2 overexpression plasmid pCMV-TLK2(human)-3xHA-Neo (abbreviated as oe-TLK2) were constructed by Constructed by Wuhan Moli Biosciences Co., Ltd.
[0150] 2.3.15 TLK2 interference plasmid and overexpression plasmid transfection into human lung adenocarcinoma cells
[0151] 5 x 10 4 -10 5 A549 and H1299 cells were plated in 6-well plates at a density of 70-80% confluency. pLV3-U6-TLK2 (human)-shRNA-Puro and pCMV-TLK2 (human)-3xHA-Neo were transfected into A549 and H1299 cells, including the following steps: first, prepare No. 1 and No. 2 1.5 mL EP tubes, add 125 μL opti medium into No. 1 and No. 2 1.5 mL EP tubes, respectively, add 7 μL Lipofectamine™ 3000 reagent into No. 1 1.5 mL EP tube; then, take 20 μL pLV3-U6-TLK2 (human)-shRNA-Puro and pCMV-TLK2 (human)-3xHA-Neo (concentration of 0.2 μmol / L) into No. 2 1.5 mL EP tube, finally add 10 μL P3000™ reagent and mix gently, incubate at room temperature for 5 min; finally, mix the solution in No. 2 1.5 mL EP tube and add it into No. 1 1.5 mL EP tube, mix gently, incubate at room temperature for 15 min; aspirate the medium in the six-well plate, wash the cells with 1xPBS buffer twice, aspirate the PBS buffer, add 18 mL serum-free medium, and then add it into each well of the six-well plate after the transfection reagent incubation is completed, label the transfection material in each well, and change the complete medium after 4 h. Figure 3 Figure 4 Figure 5 Figure 6 (A1)-Figure 6 (A6) Figure 6 (B1)-Figure 6 (B6) Figure 7 Figure 8 Figure 9
[0152] 2.3.16 Cell colony formation experiment to detect the effect of TLK2 combined with hyperthermia, radiotherapy and zedoary oil on the proliferation of human lung adenocarcinoma cells
[0153] According to the steps of 2.3.15, TLK2 interference plasmid, overexpression plasmid were transfected into human lung adenocarcinoma cells, respectively, and after 24 h, 48 h, radiotherapy was performed, respectively, and after 48 h of combined treatment of the three, A549, H1299 cells were digested, 1 mL of cells with a concentration of 100 / mL were inoculated in a 12-well plate, and cultured in a 37°C, 5% CO2 incubator for 7-10 d. After about 50 cell colonies were formed in the culture dish, the culture was stopped, washed twice with PBS, and then fixed with methanol at room temperature for 0.5 h. 0.1% crystal violet was added and incubated at room temperature for 1 h. Washed with running water, dried and photographed, and the number of colonies was counted by ImageJ software.
[0154] 2.3.17 Cell scratch, Transwell detection of TLK2 combined with radiotherapy and zedoary oil on the migration of human lung adenocarcinoma cells
[0155] Cell scratch: according to the steps of 2.3.15, TLK2 interference plasmid, overexpression plasmid were transfected into human lung adenocarcinoma cells, respectively, and after 24 h, 48 h, radiotherapy was performed, respectively, and after 48 h of combined treatment of the three, using a 200 μL gun head to make a scratch, PBS was gently washed to replace the complete culture medium, and photographs were taken at 0 h, 6 h, and 24 h. Image J was used to calculate the scratch area.
[0156] Transwell: according to the steps of 2.3.15, TLK2 interference plasmid, overexpression plasmid were transfected into human lung adenocarcinoma cells, respectively, and after 24 h, 48 h, radiotherapy was performed, respectively, and after 48 h of combined treatment of the three, after trypsin digestion, the cells were resuspended with serum-free medium, the concentration was adjusted to 1×10 5 6 / mL, 300 μL of cell suspension was added to the upper chamber of Transwell, and 500 μL of medium containing 20% fetal bovine serum was added to the lower chamber of Transwell. After incubation at 37°C, 5% CO2 for 24 h, 4% paraformaldehyde was used for fixation for 0.5 h, and then 0.1% crystal violet was used for staining for 1 h. Finally, distilled water was used for washing, dried, and the upper chamber was taken out and placed on a glass slide coated with neutral gum, observed, photographed and counted under a microscope.
[0157] 2.3.18 Annexin V-FITC detection of TLK2 combined with radiotherapy and zedoary oil on the apoptosis rate of human lung adenocarcinoma cells
[0158] According to the steps of 2.3.15, TLK2 interference, overexpression plasmid was transfected into human lung adenocarcinoma cells, respectively, and after 24 h, 48 h, radiotherapy, combination therapy of the three were carried out, respectively, 48 h later, the cells were digested with trypsin (without EDTA) and transferred to centrifuge tubes, 1000 g, 5 min, the supernatant was discarded; the cells were resuspended with PBS, centrifuged at 1000 g for 5 min, the supernatant was discarded, and 5 μL Annexin V-FITC and 10 μL propidium iodide staining solution were added. Incubate in a 37°C incubator for 0.5 h in the dark, mix well; filter through a 400 mesh screen, and detect on the machine.
[0159] Results
[0160] 2.4.1 Effect of Zedoary Oil Combined with Hyperthermia and Radiotherapy on Proliferation of A549 and H1299 Cells
[0161] In order to explore the effect of zedoary oil combined with hyperthermia on the radiosensitivity of human lung adenocarcinoma cells, A549 and H1299 cells were treated with radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, and the three combined treatment for 48 h, respectively. Cell viability was detected by MTT method, cell clone formation rate was detected by crystal violet staining, cell proliferation was evaluated by EdU method, cell cycle changes were analyzed by flow cytometry, and PCNA and CCND1 gene expression changes were detected by qRT-PCR and Western Blot.
[0162] The results of cell viability changes are shown in Figure 10 Compared with the control group (Ctrl), the cell inhibition rates of A549 cells after radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, and the three combined treatment for 48 h were increased by 28.4%, 46.3%, 49.2%, and 61.7%, respectively; the cell inhibition rates of H1299 cells were increased by 25.3%, 59.6%, 54.4%, and 79.1%, respectively; the cell inhibition rates of MRC-5 cells were increased by 16.5%, 8.08%, 19.7%, and 30.3%, respectively. In A549 and H1299 cells, compared with the radiotherapy group, the cell viability of radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, and the three combined treatment decreased, and the three combined treatment was the most significant.
[0163] The changes of cell clone formation rate are shown in Figure 13As shown, in A549 cells, compared with the control group (Ctrl), the cell clone formation rates of radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, and the combination of the three decreased by 10%, 22.7%, 49%, and 78.2%, respectively. In H1299 cells, compared with the control group (Ctrl), the cell clone formation rates of radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, and the combination of the three decreased by 20.6%, 59.8%, 74.8%, and 94.4%, respectively. The effect of the combination of the three was more significant in A549 and H1299 cells. In A549 and H1299 cells, compared with the radiotherapy group, the cell clone formation rates of radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, and the combination of the three decreased, with the combination of the three being the most significant.
[0164] Changes in cell proliferation such as Figure 14 As shown. In A549 cells, compared with the control group (Ctrl), the proportion of EdU-positive cells decreased by 10.9%, 24.5%, 49.5%, and 79.6% after radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, and the combination of the three. In H1299 cells, the proportion of EdU-positive cells decreased by 20%, 59.9%, 73.8%, and 93.5%, respectively. The difference after the combination of the three treatments was more significant in A549 and H1299 cells. In A549 and H1299 cells, the proportion of EdU-positive cells decreased after radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, and the combination of the three treatments compared with the radiotherapy group, with the combination of the three treatments showing the most significant reduction.
[0165] Changes in the cell cycle such as Figure 14 and As shown, compared with the control group (Ctrl), in A549 and H1299 cells, the percentages of G1 phase cells increased by 1.08-fold and 1.09-fold after radiotherapy, respectively, and the percentages of S phase cells decreased by 4.23% and 3.6%, respectively; after radiotherapy combined with hyperthermia treatment, the percentages of G1 phase cells increased by 1.05-fold and 1.13-fold, respectively, the percentage of S phase cells in A549 cells increased by 1.05-fold, and the percentage of S phase cells in H1299 cells decreased by 8.6%; after radiotherapy combined with zedoary oil treatment, the percentages of G1 phase cells increased by 1.12-fold and 1.3-fold, respectively, and the percentages of S phase cells decreased by 5.95% and 17.4%, respectively; after the combined treatment of the three, the percentages of G1 phase cells increased by 1.12-fold and 1.28-fold, respectively, and the percentages of S phase cells decreased by 0.4% and 16%, respectively. In A549 and H1299 cells, compared with the radiotherapy group, the percentage of cells in the G1 phase of the cell cycle increased and the percentage of cells in the S phase decreased in radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, and the combination of the three.
[0166] qRT-PCR and Western Blot were used to detect the mRNA and protein expression of PCNA and CCND1. The results are shown in As shown in Fig. 6, compared with the control group (Ctrl), the mRNA of PCNA in A549 cells was reduced by 41.7%, 50%, 53.7%, and 63.7% after radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with Zedoary oil, and radiotherapy combined with hyperthermia and Zedoary oil, respectively. The protein expression was reduced by 7%, 16.6%, 14.9%, and 49.2%, respectively. In H1299 cells, the mRNA of PCNA was reduced by 49.5%, 72.2%, 71.7%, and 80.8%, respectively. The protein expression was reduced by 3%, 26.8%, 33.8%, and 52.7%, respectively. In A549 cells, compared with the control group (Ctrl), the mRNA of CCND1 was reduced by 52.8%, 68.5%, 67.1%, and 73.7% after radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with Zedoary oil, and radiotherapy combined with hyperthermia and Zedoary oil, respectively. The protein expression was reduced by 17.6%, 19.7%, 34.1%, and 66.7%, respectively. In H1299 cells, the mRNA of CCND1 was reduced by 39.2%, 53.2%, 69.4%, and 80.9%, respectively. The protein expression was reduced by 3%, 15.2%, 20.4%, and 30.1%, respectively. In A549 and H1299 cells, the combination of the three treatments showed more significant differences. In A549 and H1299 cells, compared with the radiotherapy group, the mRNA and protein expression of PCNA and CCND1 were reduced after radiotherapy combined with hyperthermia, radiotherapy combined with Zedoary oil, and radiotherapy combined with hyperthermia and Zedoary oil. The combination of the three treatments was the most obvious.
[0167] In summary, Zedoary oil combined with hyperthermia and radiotherapy reduced the viability of human lung adenocarcinoma A549 and H1299 cells, inhibited the clonogenicity and proliferation rate of A549 and H1299 cells, hindered the orderly progression of the cell cycle, and inhibited the proliferation of human lung adenocarcinoma A549 and H1299 cells.
[0168] 2.4.2 Effect of Zedoary oil combined with hyperthermia and radiotherapy on the migration of human lung adenocarcinoma A549 and H1299 cells
[0169] The effect of Zedoary oil combined with hyperthermia and radiotherapy on the migration ability of human lung adenocarcinoma A549 and H1299 cells was studied by cell scratch test and Transwell experiment. The results of cell scratch test are shown in As shown in Fig. 6, compared with the control group (Ctrl), the mRNA of PCNA in A549 cells was reduced by 41.7%, 50%, 53.7%, and 63.7% after radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with Zedoary oil, and radiotherapy combined with hyperthermia and Zedoary oil, respectively. The protein expression was reduced by 7%, 16.6%, 14.9%, and 49.2%, respectively. In H1299 cells, the mRNA of PCNA was reduced by 49.5%, 72.2%, 71.7%, and 80.8%, respectively. The protein expression was reduced by 3%, 26.8%, 33.8%, and 52.7%, respectively. In A549 cells, compared with the control group (Ctrl), the mRNA of CCND1 was reduced by 52.8%, 68.5%, 67.1%, and 73.7% after radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with Zedoary oil, and radiotherapy combined with hyperthermia and Zedoary oil, respectively. The protein expression was reduced by 17.6%, 19.7%, 34.1%, and 66.7%, respectively. In H1299 cells, the mRNA of CCND1 was reduced by 39.2%, 53.2%, 69.4%, and 80.9%, respectively. The protein expression was reduced by 3%, 15.2%, 20.4%, and 30.1%, respectively. In A549 and H1299 cells, the combination of the three treatments showed more significant differences. In A549 and H1299 cells, compared with the radiotherapy group, the mRNA and protein expression of PCNA and CCND1 were reduced after radiotherapy combined with hyperthermia, radiotherapy combined with Zedoary oil, and radiotherapy combined with hyperthermia and Zedoary oil. The combination of the three treatments was the most obvious.
[0170] Transwell experiment results are as follows As shown, compared with the control group (Ctrl), the migration of cells to the lower chamber was reduced after radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, and the combination of the three, and the combination of the three was more obvious; compared with the radiotherapy group, the migration of cells to the lower chamber was reduced after radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, and the combination of the three.
[0171] In conclusion, zedoary oil combined with thermotherapy and radiotherapy inhibited the migration of human lung adenocarcinoma A549 and H1299 cells.
[0172] 2.4.3 Effects of Zedoaria oil combined with hyperthermia and radiotherapy on apoptosis in human lung adenocarcinoma A549 and H1299 cells
[0173] A549 and H1299 cells were treated with radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, or a combination of the three. After 48 hours of culture, acridine orange staining was used to detect apoptotic bodies, the JC-1 assay was used to measure mitochondrial membrane potential (MMP), the AV / PI assay was used to determine apoptosis rates, and the TUNEL assay was used to detect DNA fragmentation during apoptosis. qRT-PCR and Western blot were used to examine changes in the expression of apoptosis-related genes.
[0174] Laser confocal microscopy shows changes in nuclear morphology. As shown, in untreated A549 and H1299 cells, the nuclei were larger, clear in structure, nearly round, and had uniform green fluorescence; after radiotherapy, it was obvious that the nuclei were marginalized and the cell volume was reduced; radiotherapy combined with hyperthermia and radiotherapy combined with zedoary oil had similar results, with cell shrinkage, nuclear chromatin condensation, and plasma membrane blebbing observed in H1299 cells; after the combined treatment of the three, the number of cells was significantly reduced, the cell sizes were different, the plasma membrane blebbled to form apoptotic bodies in H1299 cells, and cell fragmentation was observed in A549 cells.
[0175] The changes in mitochondrial membrane potential are shown in Figure 11(A) and Figure 11(B). Compared with the control group (Ctrl), the permeability of the mitochondrial membrane in A549 and H1299 cells was enhanced and MMP was decreased after radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, and the combination of the three. Compared with the radiotherapy group, the changes in mitochondrial membrane potential were reduced after radiotherapy combined with hyperthermia and radiotherapy combined with zedoary oil, and the combination of the three significantly decreased the mitochondrial membrane potential.
[0176] The AV / PI results are shown in Figures 12(A) and 12(B). Compared with the control group (Ctrl), the early apoptosis rate, late apoptosis rate, and dead cell ratio of A549 and H1299 cells were significantly increased after radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, and the combination of the three. The early apoptosis rate and dead cell ratio increased more significantly after the combination of the three. Compared with the radiotherapy group, the early apoptosis rate, late apoptosis, and dead cell ratio of A549 and H1299 cells were significantly increased after radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, and the combination of the three.
[0177] TUNEL immunofluorescence results The results showed that in A549 cells, compared with the control group (Ctrl), the proportion of DNA breaks (green) in cells treated with radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, and the combination of the three increased by 7.13%, 45.52%, 49.24%, and 80.67%, respectively. Compared with the radiotherapy group, the proportion of DNA breaks in cells treated with radiotherapy combined with hyperthermia and radiotherapy combined with zedoary oil increased, and the increase in the proportion of DNA breaks was more significant after the combination of the three. In H1299 cells, compared with the control group, the proportion of DNA breaks (green) in cells treated with radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil, and the combination of the three increased by 14.3%, 20.51%, 79.45%, and 86.12%, respectively. Compared with the radiotherapy group, the proportion of DNA breaks in cells treated with radiotherapy combined with hyperthermia and radiotherapy combined with zedoary oil increased, and the increase in the proportion of DNA breaks was more significant after the combination of the three.
[0178] qRT-PCR and Western Blot were used to detect the effects of zedoary oil combined with thermotherapy and radiotherapy on the expression of apoptosis-related genes (Bax, Bcl-2, Caspase3, FAS, Caspase9, Caspase8) mRNA and protein in human lung adenocarcinoma A549 and H1299 cells. As shown in the figure, in A549 and H1299 cells, compared with the control group (Ctrl), the mRNA expression of pro-apoptosis related genes (Bax, Caspase3, FAS, Caspase9, Caspase8) increased after radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with turmeric oil, and the combination of the three was reduced, while the mRNA expression of anti-apoptosis gene (Bcl-2) decreased; compared with the radiotherapy group, the mRNA expression of pro-apoptosis related genes increased significantly after radiotherapy combined with hyperthermia, radiotherapy combined with turmeric oil, and the combination of the three, while the mRNA expression of anti-apoptosis genes decreased significantly. The mRNA expression of apoptosis related genes increased most significantly after the combination of the three. Western Blot results are shown in the figure. As shown in Fig. 6, compared with the control group (Ctrl), the protein expression of pro-apoptotic related genes increased and the protein expression of anti-apoptotic genes decreased after radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with Zedoary oil and the combination of the three treatments in A549 and H1299 cells; compared with the radiotherapy group, the protein expression of pro-apoptotic related genes significantly increased and the protein expression of anti-apoptotic genes significantly decreased after radiotherapy combined with hyperthermia, radiotherapy combined with Zedoary oil and the combination of the three treatments, and the change of pro-apoptotic related genes protein expression was the most obvious after the combination of the three treatments, which was consistent with the results of fluorescence quantification.
[0179] In summary, Zedoary oil combined with hyperthermia and radiotherapy induced the formation of apoptotic bodies, reduced mitochondrial membrane potential, increased the apoptosis rate and the proportion of DNA breakage cells, increased the expression of pro-apoptotic related genes and decreased the expression of anti-apoptotic genes in human lung adenocarcinoma A549 and H1299 cells, indicating that Zedoary oil combined with hyperthermia and radiotherapy promoted the apoptosis of human lung adenocarcinoma A549 and H1299 cells.
[0180] 2.4.4 In vivo detection of the effect of Zedoary oil combined with hyperthermia and radiotherapy on lung adenocarcinoma tumor tissue
[0181] To detect the effect of Zedoary oil combined with hyperthermia on the radiotherapy sensitivity of lung adenocarcinoma subcutaneous tumor, a tumor-bearing nude mouse model was constructed with A549 cells, and the growth of tumor tissue was detected after radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with Zedoary oil and the combination of the three treatments. The results are shown in Fig. 8. Figure 15 As shown in Fig. 8, compared with the control group (Ctrl), radiotherapy inhibited the growth of lung adenocarcinoma ectopic tumor, but they partially recovered tumor growth after radiotherapy, leading to radioresistance (D) in the figure. Figure 15 Radiotherapy combined with hyperthermia and radiotherapy combined with Zedoary oil significantly inhibited the growth of lung adenocarcinoma ectopic tumor, reduced tumor weight and tumor volume, and the combination of the three treatments inhibited the growth of lung adenocarcinoma ectopic tumor more obviously, indicating that Zedoary oil combined with hyperthermia sensitized A549 tumor to radiotherapy.
[0182] Subsequently, immunohistochemical analysis of the proportion of Ki-67 (cell proliferation marker) positive cells in tumor tissue was performed, and the results showed that the proportion of Ki-67 positive cells decreased by 12.726% after radiotherapy, and the proportion of Ki-67 positive cells in tumor tissue decreased by 16.147%, 17.616% and 18.453% after radiotherapy combined with hyperthermia, radiotherapy combined with Zedoary oil and the combination of the three treatments, respectively, and the effect was the most obvious after the combination of the three treatments.
[0183] In addition, the expression changes of proliferation and apoptosis related genes in tumor tissue were detected, and the results are shown in Fig. 9. Figure 16As shown, compared with the control group (Ctrl), the mRNA expression of proliferation-related genes CCND1, PCNA and Ki67 decreased, the mRNA expression of pro-apoptotic genes (Bax, Caspase3, FAS, Caspase9 and Caspase8) increased, and the mRNA expression of anti-apoptotic gene (Bcl-2) decreased after radiotherapy. Compared with the radiotherapy group, the mRNA expression of proliferation and apoptosis-related genes changed consistently after radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil and the combination of the three, and the combination of the three was the most obvious. Therefore, it is further indicated that zedoary oil combined with hyperthermia increases the sensitivity of lung adenocarcinoma ectopic tumor in mice to radiotherapy.
[0184] 2.4.5 Effect of TLK2 combined with radiotherapy, hyperthermia and zedoary oil on the proliferation of human lung adenocarcinoma cells
[0185] In order to study the effect of TLK2 on the proliferation of human lung adenocarcinoma A549 and H1299 cells, TLK2 interference and overexpression plasmids were transfected into lung adenocarcinoma cells for 24 h and 48 h, respectively, and then radiotherapy, the combination of the three was performed for 48 h. The cell clone formation rate was detected by crystal violet staining.
[0186] The results of the change of cell clone formation rate are shown in Figures 17(A) to 17(D) TLK2 interference plasmid was transfected into lung adenocarcinoma cells for 24 h, and then radiotherapy and the combination of the three were performed for 48 h. In A549 cells, compared with the control group (Ctrl), the clone formation rate of human lung adenocarcinoma cells decreased by 12.0% after interfering with TLK2 gene, which was similar to the effect of radiotherapy. Compared with the radiotherapy group, the clone formation rate of human lung adenocarcinoma cells decreased by 18.8% after radiotherapy combined with TLK2 gene interference. Compared with the combination of the three, the clone formation rate of human lung adenocarcinoma cells decreased by 9.2% after the combination of the three combined with TLK2 gene interference. In H1299 cells, compared with the control group (Ctrl), the clone formation rate of human lung adenocarcinoma cells decreased by 63.0% after interfering with TLK2 gene. Compared with the radiotherapy group, the clone formation rate of human lung adenocarcinoma cells decreased by 8.6% after radiotherapy combined with TLK2 gene interference. Compared with the combination of the three, the clone formation rate of human lung adenocarcinoma cells decreased by 9.9% after the combination of the three combined with TLK2 gene interference. Subsequently, we transfected TLK2 gene overexpression vector into lung adenocarcinoma cells for 48 h, and then performed radiotherapy and the combination of the three for 48 h. It was found that the results were opposite to those of TLK2 gene interference. The clone formation rate of human lung adenocarcinoma cells increased after overexpression of TLK2 gene.
[0187] 2.4.6 Effect of TLK2 combined with radiotherapy, hyperthermia and zedoary oil on the migration of human lung adenocarcinoma cells
[0188] The effects of TLK2 on the migration of lung adenocarcinoma cells were detected by cell scratch test and Transwell experiment, and the results of the cell scratch test are shown in Figure 18 Fig. 2(a), Fig. 2(b), Fig. 2(c) and Fig. 2(d) of Fig. 2. Lung adenocarcinoma cells were transfected with TLK2 interference plasmid for 24 hours, and then radiotherapy, three combined treatment were performed for 48 hours. After resuspending the cells, crystal violet staining was performed after culturing in the Transwell chamber for 24 hours. Compared with the control group (Ctrl), the number of lung adenocarcinoma cells moving to the lower chamber was reduced after interfering with the TLK2 gene; compared with the radiotherapy group, the number of lung adenocarcinoma cells moving was significantly reduced after interfering with the TLK2 gene and then radiotherapy; compared with the three combined treatment group, the difference in the number of lung adenocarcinoma cells moving was most significant after interfering with the TLK2 gene and then three combined treatment. The results of overexpressing the TLK2 gene were opposite.
[0189] The results of the Transwell experiment are shown in Figure 19 Fig. 2(a), Fig. 2(b), Fig. 2(c) and Fig. 2(d) of Fig. 2. Lung adenocarcinoma cells were transfected with TLK2 interference plasmid for 24 hours, and then radiotherapy, three combined treatment were performed for 48 hours. After resuspending the cells, crystal violet staining was performed after culturing in the Transwell chamber for 24 hours. Compared with the control group (Ctrl), the number of lung adenocarcinoma cells moving to the lower chamber was reduced after interfering with the TLK2 gene; compared with the radiotherapy group, the number of lung adenocarcinoma cells moving was significantly reduced after interfering with the TLK2 gene and then radiotherapy; compared with the three combined treatment group, the difference in the number of lung adenocarcinoma cells moving was most significant after interfering with the TLK2 gene and then three combined treatment. The results of overexpressing the TLK2 gene were opposite.
[0190] 2.4.7 The effect of TLK2 combined with radiotherapy, hyperthermia and zedoary oil on the apoptosis of human lung adenocarcinoma cells
[0191] The AV / PI results are shown in Fig. 20(a), Fig. 20(b), Fig. 20(c) and Fig. 20(d) of Fig. 20. After transfecting human lung adenocarcinoma cells with TLK2 interference plasmid for 24 hours, radiotherapy, three combined treatment were performed for 48 hours. After collecting the cells, flow cytometry was used to detect the changes of cell apoptosis. B1 region: dead cells; B2 region: late apoptotic cells; B3 region: living cells; B4 region: early apoptotic cells. Compared with the control group (Ctrl), the early apoptosis rate, late apoptosis rate and death cell ratio of lung adenocarcinoma cells increased after interfering with the TLK2 gene; compared with the radiotherapy group, the early apoptosis rate of lung adenocarcinoma cells increased after interfering with the TLK2 gene and then radiotherapy; compared with the three combined treatment group, the early apoptosis rate, late apoptosis rate and death cell ratio of lung adenocarcinoma cells increased after interfering with the TLK2 gene and then three combined treatment. The effect of overexpressing the TLK2 gene was opposite to that of interfering with the TLK2 gene.
[0192] Summary:
[0193] 1. The present application first found that zedoary oil combined with hyperthermia has the effect of radiotherapy sensitivity on lung cancer cells:
[0194] (1) In the related experiment of the influence of zedoary oil combined with hyperthermia and radiotherapy on the proliferation of A549 and H1299, it was found that after radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil and the three combined treatment, the cell viability, the number of EdU positive cells and the cell cloning formation rate were reduced, and the three combined treatment was more obvious; flow cytometry showed that the proportion of G1 phase cells increased significantly and the proportion of S phase cells decreased significantly, and the cells were blocked in G1 phase, thereby inhibiting cell proliferation.
[0195] (2) In the related experiment of the influence of zedoary oil combined with hyperthermia and radiotherapy on the migration of A549 and H1299, it was found that the cell scratch recovery width decreased and the number of Tanswell cell migration decreased, and the three combined treatment was the most obvious, thereby inhibiting cell migration.
[0196] (3) In the related experiment of the influence of zedoary oil combined with hyperthermia and radiotherapy on the apoptosis of A549 and H1299, it was found that:
[0197] Laser confocal microscope observation showed that the cell morphology presented different degrees of change, especially the nucleus of the cells treated with the three combined treatment showed apoptosis; the mitochondrial membrane potential decreased, the early apoptosis rate of the cells and the number of TUNEL positive cells increased; qRT-PCR and Western Blot methods were used to detect the expression changes of proliferation and apoptosis related genes, and the expression of proliferation related genes (CCND1, PCNA) decreased, the expression of pro-apoptotic genes (Bax, Caspase3, Fas, Caspase9, Caspase8) increased, and the expression of anti-apoptotic genes (Bcl-2) decreased, thereby promoting cell apoptosis.
[0198] (4) In the related experiment of the influence of zedoary oil combined with hyperthermia and radiotherapy on the growth of A549 tumor, it was found that:
[0199] After radiotherapy, radiotherapy combined with hyperthermia, radiotherapy combined with zedoary oil and the three combined treatment, the tumor volume became smaller, the tumor weight decreased, the expression of Ki67 decreased, and the three combined treatment was the most obvious. After radiotherapy, the expression of proliferation related genes (CCND1, PCNA) decreased, the expression of pro-apoptotic genes (Bax, Caspase3, Fas, Caspase9, Caspase8) increased, and the expression of anti-apoptotic genes (Bcl-2) decreased, and the three combined treatment decreased the most obviously. In summary, zedoary oil combined with hyperthermia can significantly enhance the sensitivity of A549 cells and tumor to radiotherapy, inhibit the growth and proliferation of tumor, and promote the apoptosis of tumor cells.
[0200] 2、The present application first found the mechanism of zedoary oil combined with hyperthermia to enhance the radiotherapy sensitivity of lung cancer cells:
[0201] (1) Transcriptional sequencing screening gene
[0202] Transcriptome sequencing was performed on A549 cells treated with radiotherapy and the combination of the three, to screen for differentially expressed genes and analyze differentially involved signaling pathways. Tousled-like kinase 2 (TLK2) was significantly changed among the differentially expressed genes. To verify whether TLK2 affects the sensitivity of radiotherapy, TLK2 interference and overexpression vectors were constructed.
[0203] (2) Effect of TLK2 combined with radiotherapy on the proliferation of A549 and H1299 cells
[0204] TLK2 interference and overexpression vectors were transfected into A549 and H1299 cells, and the viability of A549 and H1299 cells was detected. After interfering with TLK2, the cell viability decreased, and after overexpressing TLK2, the cell viability increased. Subsequently, it was found through EdU and cell colony formation experiments that the number of EdU positive cells decreased after interfering with TLK2, and the cell colony formation rate decreased, and TLK2 combined with radiotherapy significantly reduced, especially in the case of the combination of the three. The cell cycle results showed that after interfering with TLK2, the proportion of G1 phase cells increased, and the proportion of S phase cells decreased, which blocked the cell cycle at the G1 phase, arrested mitosis, inhibited cell proliferation, and induced apoptosis. However, overexpression of TLK2 had the opposite effect, which could resist the effect of radiotherapy.
[0205] (3) Effect of Morinda officinalis oil combined with hyperthermia and radiotherapy on the migration of A549 and H1299 cells
[0206] Cell scratch test and Transwell experiment were used to explore the role of TLK2 in the migration of lung adenocarcinoma cells. Interfering with TLK2 significantly inhibited the migration ability of A549 and H1299 cells, especially in the case of combined radiotherapy and the combination of the three, the inhibitory effect was more obvious. On the contrary, overexpression of TLK2 enhanced the migration ability of cells.
[0207] (4) Effect of Morinda officinalis oil combined with hyperthermia and radiotherapy on the apoptosis of A549 and H1299 cells
[0208] The results of laser confocal microscope observation showed that after interfering TLK2, the morphology of lung adenocarcinoma cells changed significantly, including cell shrinkage, nuclear chromatin pyknosis, plasma membrane blebbing and other phenomena, which were consistent with the typical characteristics of apoptosis. Especially in the case of combined radiotherapy and the three combinations, the characteristics of apoptosis were more obvious; after interfering TLK2, the mitochondrial membrane potential decreased, the early apoptosis rate and the number of TUNEL positive cells increased significantly, which was more significant after TLK2 combined with radiotherapy and after the three combinations, and overexpression of TLK2 had the opposite effect; in addition, the results of qRT-PCR and Western Blot showed that interfering TLK2 significantly up-regulated the expression of pro-apoptotic genes (such as Bax, Caspase3, FAS, Caspase9, Caspase8), while down-regulated the expression of anti-apoptotic gene Bcl-2, especially in the case of combined radiotherapy and the three combinations, the gene expression was more obvious, in summary, it was confirmed that TLK2 promoted the sensitivity of A549 and H1299 cells to radiotherapy, inhibited cell proliferation and migration, and promoted cell apoptosis.
[0209] Finally, it should be pointed out that the above examples are only used to illustrate the technical solutions of the present application and do not constitute a limitation on the present application. Within the technical concept of the present application, various simple modifications can be made to the technical solutions of the present application, including the combination of various technical features in any other suitable manner. These simple modifications and combinations should be considered as disclosed by the present application and fall within the protection scope of the present application.
Claims
1. Use of zedoary turmeric oil in the preparation of a medicine for treating lung cancer in combined hyperthermia and radiotherapy.
2. The use according to claim 1, characterized in that The lung cancer is non-small cell lung cancer.
3. The use according to claim 2, characterized in that The lung cancer is lung adenocarcinoma.
4. The use according to any one of claims 1 to 3, characterized in that The drug is a radiosensitizer, which contains an effective amount of 180-220 mg / kg of zedoary turmeric oil and is administered at least once a week.
5. The use according to claim 4, characterized in that The radiosensitizer comprises an effective amount of 180-200 mg / kg of zedoary turmeric oil, and is administered at least 3 times a week.
6. The use according to claim 4, characterized in that The radiation therapy dose is 2-6 Gy per time, administered at least once a week, for a total of at least 3 times; and / or The heat treatment condition is 40-45° C., and the treatment lasts 30-60 minutes.
7. The use according to claim 6, characterized in that The pharmaceutical excipients include at least one of a solubilizer, a diluent, a binder, a disintegrant, a lubricant and a flavoring agent.
8. The use according to claim 6, characterized in that The dosage forms of the drug include injection, tablet, capsule or granule.
9. A pharmaceutical composition for treating lung cancer in combination with hyperthermia and radiotherapy, characterized in that: The pharmaceutical composition is a radiosensitizer, comprising an effective amount of 180-220 mg / kg of zedoary turmeric oil, and at least one pharmaceutical carrier and / or at least one pharmaceutical excipient, and the pharmaceutical composition is administered at least once a week.
10. The pharmaceutical composition according to claim 9, characterized in that The pharmaceutical composition is a radiosensitizer, comprising an effective amount of 180-200 mg / kg of zedoary turmeric oil, and at least one pharmaceutical carrier and / or at least one pharmaceutical excipient. The pharmaceutical composition is administered at least three times a week.