Application of F2RL1 gene in sensitizing lung adenocarcinoma immunotherapy
By combining the use of F2RL1 inhibitors and PD-1 inhibitors to target and inhibit the F2RL1 gene, the problem of immunosuppression in immunotherapy of lung adenocarcinoma was solved, the function of CD8+ T cells was significantly enhanced, and the prognosis of patients with lung adenocarcinoma was improved.
Patent Information
- Application Number
- CN202510334011.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-20
- Publication Date
- 2025-10-14
AI Technical Summary
In existing immunotherapy for lung adenocarcinoma, the response rate of immune checkpoint inhibitors is low, there is a lack of effective biomarkers and combination strategies, and tumor-associated fibrosis leads to an immunosuppressive microenvironment, limiting the therapeutic effect.
The combined use of F2RL1 inhibitors and PD-1 inhibitors can inhibit PD-L1 expression in cancer-associated fibroblasts by targeting F2RL1 gene expression or protein activity, promote CD8+ T cell proliferation, and enhance the immunotherapy effect of lung adenocarcinoma.
Significantly inhibit PD-L1 expression, promote CD8+ T cell proliferation, reduce tumor cell growth, enhance the efficacy of anti-PD-1 treatment, and improve the prognosis of patients with lung adenocarcinoma.
Smart Images

Figure CN120771291A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application relates to the field of biological medicine, and particularly relates to application of an F2RL1 gene in sensitizing lung adenocarcinoma immunotherapy. BACKGROUND
[0002] Lung cancer is one of the most common cancers in China. 85% of lung cancer is non-small cell lung cancer (NSCLC), and among them, adenocarcinoma is the most common type. Tumor immunotherapy, including immune checkpoint inhibitors (ICIs), works by activating the human immune system or normalizing the immune system, and is considered the fifth pillar of tumor therapy. It is one of the most promising research directions in the field of lung cancer treatment. However, many biomarkers lack large-scale prospective studies for verification, and the specificity and sensitivity need to be further determined. Therefore, finding new targets, biomarkers and combination strategies for sensitizing immunotherapy is crucial for improving the prognosis of lung adenocarcinoma.
[0003] Epidemiological studies have found that there is a close relationship between pulmonary fibrosis and lung cancer. The fibrotic tumor microenvironment is involved in angiogenesis, extracellular matrix (ECM) remodeling of tumor cells, and immunosuppression. Fibrosis and tumors share common molecular pathways and characteristics, such as activation and proliferation of myofibroblasts and cancer-associated fibroblasts (CAFs), ECM deposition, transforming growth factor beta (TGF-β) upregulation, and hypoxia. Therefore, tumor-associated fibrosis can lead to the formation of an immunosuppressive tumor microenvironment (TME), and targeting tumor-associated fibrosis can improve the immunosuppressive TME, which may be a new strategy for sensitizing tumor immunotherapy. CAFs secrete a series of pro-fibrotic and immunosuppressive cytokines, including vascular endothelial growth factor (VEGF), TGF-β, and interleukin 6 (IL-6), which can lead to tumor cell proliferation, angiogenesis, metastasis, and drug resistance. The large amount of ECM produced by CAFs, including collagen and hyaluronic acid, can increase the rigidity of the microenvironment and interstitial pressure, isolate the tumor nest from the immune system, and thus promote tumor growth and metastasis. Therefore, CAFs promote the formation of an immunosuppressive TME, thereby limiting the efficacy of lung adenocarcinoma immunotherapy; targeting and inhibiting CAFs can sensitize lung adenocarcinoma immunotherapy.
[0004] Coagulation factor II receptor like trypsin receptor 1 (F2RL1) is a member of G protein-coupled receptors, which is expressed on fibroblasts. F2RL1 is overexpressed in lung adenocarcinoma and idiopathic pulmonary fibrosis (IPF). Endogenous agonists such as trypsin and tissue factor can activate F2RL1-mediated Akt, cAMP and calcium ion signal transduction, thereby promoting human lung fibroblast proliferation and extracellular matrix deposition. Therefore, targeting inhibition of F2RL1 can improve the tumor immunosuppressive microenvironment, thereby sensitizing lung adenocarcinoma immunotherapy. SUMMARY
[0005] The present application provides an application of F2RL1 gene in sensitizing lung adenocarcinoma immunotherapy. PD-1 inhibitors have significant anti-tumor effect, but the overall response rate is low. Therefore, research on new targets and combination therapy strategies is a current hotspot. The present application finds that, when F2RL1 inhibitors and PD-1 inhibitors are used in combination for treating lung adenocarcinoma, the expression of PD-L1 in cancer-associated fibroblasts can be significantly inhibited, and / or CD8 + T cell proliferation is promoted, thereby promoting lung adenocarcinoma cell apoptosis. This is achieved by the following technical means.
[0006] The present application provides an application of F2RL1 inhibitor in preparing lung adenocarcinoma immunotherapy drugs, wherein the F2RL1 inhibitor and the PD-1 inhibitor are used in combination; the PD-1 inhibitor is used to block the PD-1 / PD-L1 pathway; and the F2RL1 inhibitor inhibits the expression of F2RL1 gene or the physiological activity of F2RL1 protein, thereby inhibiting the expression of PD-L1 in cancer-associated fibroblasts and / or promoting CD8 + T cell proliferation.
[0007] Further, the PD-1 inhibitor is used to block the PD-1 / PD-L1 pathway.
[0008] Still further, the PD-1 inhibitor is a monoclonal antibody targeting PD-1.
[0009] Further, the F2RL1 inhibitor is an siRNA targeting the expression of F2RL1 gene.
[0010] Still further, the nucleotide sequence of the siRNA of human origin is shown in SEQ ID NO. 21 or SEQ ID NO. 22.
[0011] Still further, the nucleotide sequence of the siRNA of mouse origin is shown in SEQ ID NO. 23 or SEQ ID NO. 24.
[0012] Further, the F2RL1 inhibitor is Leonurine, and the chemical structural formula is:
[0013] .
[0014] The application further provides a lung adenocarcinoma immunotherapy drug, which comprises the F2RL1 inhibitor and the PD-1 inhibitor according to any one of the above.
[0015] The application first discovers that a coagulation factor II receptor-like trypsin receptor 1 (F2RL1) gene is overexpressed in lung adenocarcinoma tissues through bioinformatics means, predicts a poor prognosis of lung adenocarcinoma, and is positively correlated with CD8 + T cell infiltration and negatively correlated with cancer-associated fibroblasts (CAFs) infiltration, and predicts a poor prognosis of lung adenocarcinoma. The lung adenocarcinoma tissue chip research results show that F2RL1 protein is highly expressed in human lung cancer tissues and positively correlated with N staging. The univariate Cox analysis results show that F2RL1 is a risk factor for the prognosis of lung adenocarcinoma. The multivariate Cox analysis results show that F2RL1 is an independent prognostic factor for lung adenocarcinoma patients. The F2RL1 protein expression level is positively correlated with CAFs and CD34 + cell infiltration in human lung adenocarcinoma, negatively correlated with CD8 + T cell infiltration, and unrelated to Tregs cell infiltration. The F2RL1 protein level is positively correlated with PD-L1 + CAFs infiltration.
[0016] The application designs four siRNAs (i.e., si-F2RL1), which are named human si-F2RL1#1 and si-F2RL1#2, and mouse si-F2RL1#1 and si-F2RL1#2, and F2RL1 is knocked down by transfecting si-F2RL1, so that the expression levels of FAP and alpha-SMA in mouse fibroblasts L929 can be inhibited. The L929 cells treated by si-F2RL1, MRC-5 fibroblasts, and CD8 + T cells are co-cultured, so that the proliferation of CD8 + T cells and the levels of GzmB and IFN-γ are significantly increased. The L929 cells and MRC-5 fibroblasts treated by si-F2RL1, and CD8 + T cells, CMT167 cells, and A549 lung cancer cells are co-cultured, so that the apoptosis of CMT167 and A549 lung cancer cells is significantly increased.
[0017] The application also finds that F2RL1 mediates the activation of CAFs in vitro culture and the expression of PD-L1 thereof through Akt signal. Based on the active ingredients of traditional Chinese medicine, the F2RL1 selective inhibitor leucine is screened through virtual screening and biological verification experiments. Leucine inhibits the growth of LLC and CMT167 lung cancer subcutaneous transplanted tumors in mice, induces tumor vascular normalization, reduces α-SMA + vimentin + cell number and interstitial fibrosis and the expression of PD-L1 thereof, increases CD8 + T cell infiltration and effector function, thereby enhancing the efficacy of anti-PD-1 therapy.
[0018] In summary, the application finds that F2RL1 induces immunosuppression of lung adenocarcinoma by promoting the formation of a tumor immune microenvironment, and provides a potential new target, candidate drug and combination therapy for sensitizing lung adenocarcinoma immunotherapy.
[0019] Compared with the prior art, the application has the advantages that:
[0020] 1. The application first finds that F2RL1 is overexpressed in lung adenocarcinoma tissues, which predicts poor prognosis of lung adenocarcinoma patients.
[0021] 2. The application further confirms that siRNA (si-F2RL1) targeting F2RL1 gene is found, which significantly increases the function of CD8 + T cells and lung cancer cell apoptosis; and it is clarified that F2RL1 mediates the activation of CAFs and the expression of PD-L1 thereof through Akt signal, thereby mediating tumor immunosuppression.
[0022] 3. The application also finds that F2RL1 inhibitor leucine targeting F2RL1 gene, through F2RL1 inhibitor leucine, inhibits the growth of mouse lung cancer subcutaneous transplanted tumors, induces tumor vascular normalization, reduces α-SMA + vimentin + cell number and interstitial fibrosis and the expression of PD-L1 thereof, increases CD8 + T cell infiltration and effector function, thereby enhancing the efficacy of anti-PD-1 therapy.
[0023] Therefore, F2RL1 can be used as a potential new target for sensitizing lung adenocarcinoma immunotherapy, which not only can significantly inhibit the growth of lung adenocarcinoma tumor cells, but also can be combined with PD-1 inhibitors. The effect of PD-1 inhibitor on inhibiting PD-L1 expression achieves the purpose of synergistic effect, promotes the combination of the two drugs to sensitize lung adenocarcinoma immunotherapy, and provides a new strategy for lung adenocarcinoma immunotherapy. BRIEF DESCRIPTION OF DRAWINGS
[0024] Figure 1 F2RL1 was highly expressed in lung adenocarcinoma tissues and predicted poor prognosis. Figure 1 In the present disclosure, (A) the differential expression of F2RL1 in lung adenocarcinoma tissues and paracancer tissues; (B) the detection of F2RL1 protein expression by tissue chip; (C) the F2RL1 protein level in lung adenocarcinoma tissues was significantly increased compared with paracancer tissues; (D) Kaplan-Meier curve showed the first progression-free survival rate of lung adenocarcinoma patients in high F2RL1 group and low F2RL1 group.
[0025] Figure 2 Correlation analysis of F2RL1 and immune infiltration in lung adenocarcinoma. Figure 2 In the present disclosure, (A) the correlation of F2RL1 with the level of main immune cell infiltration; (B) the correlation of F2RL1 expression level with fibroblast infiltration level; (C)-(E) the correlation of F2RL1 expression level with fibroblast activation protein (FAP), α-smooth muscle actin (α-SMA) and granzyme B (GZMB) expression level.
[0026] Figure 3 and 4 Correlation of F2RL1 with immunosuppressive microenvironment in human lung adenocarcinoma tissues. Figure 3 In the present disclosure, the correlation analysis of F2RL1 level in lung adenocarcinoma tissues with CD8 + T cell, FOXP3 + cell, α-SMA + cell and CD34 + cell infiltration level. Figure 4 In the present disclosure, the correlation analysis of F2RL1 level with CAFs PD-L1 expression level.
[0027] Figure 5 si-F2RL1 inhibits the activation of fibroblasts to CAFs in vitro. Figure 5 In the present disclosure, (A) Western blot detection of F2RL1 protein expression level. (B) Immunofluorescence staining shows typical figures and quantitative analysis of F2RL1 knockdown (siF2RL1) inhibiting FAP and α-SMA expression in L929 cells. Mean ± SEM, n = 5. Compared with control, *, P < 0.05; **, P < 0.01. Compared with si-Scram group, # , P < 0.05; ## , P < 0.01.
[0028] Figure 6 Knockdown of F2RL1 in CAFs enhances the function of CD8 + T cells co-cultured in vitro. Figure 6 In the present disclosure, (A) CFSE staining and flow cytometry detection of CD8+ T cell proliferation; (B) qPCR detection of CD8 + GzmB and IFN-γ expression levels in T cells; (C) si-F2RL1 treatment of L929 or MRC-5 cells, ELISA detection of GzmB and IFN-γ production; (D) flow cytometry analysis of 7-AAD + proportion of cells. Mean ± SEM, n = 5. Compared with control, *, P < 0.05; **, P < 0.01. Compared with si-Scram group, # , P < 0.05; ##, P < 0.01.
[0029] Figure 7 : F2RL1 protein binding mode with potential inhibitor Leonurine. Figure 6 , the structural diagram of the interaction between Leonurine and F2RL1; in the figure, Leonurine is marked in red, and the residues that produce hydrogen bond interactions with it are marked in blue.
[0030] Figure 8 and Figure 9 : F2RL1 mediates CAF activation and its PD-L1 expression through F2RL1-Akt signaling pathway. Figure 8 , (A) volcano plot of differential expression of F2RL1 gene in high expression group (n = 99) and low expression group (n = 83); (B) KEGG enrichment analysis of differentially expressed F2RL1 related genes, color represents statistical significance, size represents the number of enriched genes; (C) F2RL1, p-Akt and PD-L1 protein levels in Leonurine and si-F2RL1 treated MRC-5 and L929 fibroblasts; (D-E) Effect of si-Akt transfected MRC-5 and L929 fibroblasts on Akt and PD-L1 protein levels. Figure 9 , (F-G) Effect of si-F2RL1 and si-Akt transfected MRC-5 and L929 fibroblasts on IL6, VEGF, TGF-β, α-SMA and FAP gene levels. Mean ± SEM, n = 5. Compared with control, *, P < 0.05; **, P < 0.01. Compared with si-Scram group, # , P < 0.05; ## , P < 0.01.
[0031] Figure 10 : F2RL1 inhibitor Leonurine sensitizes mouse CMT167 lung cancer to anti-PD-1 therapy. Figure 10In the middle, (A) C57BL / 6 mice were injected subcutaneously with CMT167 lung cancer cells to prepare CMT167 lung adenocarcinoma subcutaneous tumor model. The effects of control group, leonurine, anti-PD-1 antibody or the combination of the two on tumor growth curve and tumor weight (n=8); (B) immunohistochemistry (IHC) staining of CD8 + T cells (red) and their IFNγ (green) and GzmB (green) expression (n=6) typical graph and quantitative analysis results; (C) Western blot detection of F2RL1 and PD-L1 expression levels in CMT167 lung cancer tissues (n=5); (D) Hypoxia-inducible factor (HIF)-1α expression level (n=5); (E) Representative immunofluorescence staining of CD34 (green) and α-SMA (red) positive cells in CMT167 tumor tissues and quantitative analysis graph (n=6); (F) Representative immunofluorescence staining of α-SMA (red) and vimentin (green) positive cells in CMT167 tissues and quantitative analysis graph (n=6); (G) Masson staining to detect the typical graph and quantitative analysis of fibrosis area in tumor tissues (n=6). Scale bar, 20 μm. Mean ± SEM. *, P < 0.05; **, P < 0.01; ^, P < 0.05; ^^ compared with α-PD-1, P < 0.01.
[0032] Figure 11 : F2RL1 inhibitor leonurine sensitizes mouse LLC lung cancer anti-PD-1 treatment. Figure 11 In the middle, (A) C57BL / 6 mice were injected subcutaneously with LLC lung cancer cells to prepare LLC lung adenocarcinoma subcutaneous tumor model. The effects of control group, leonurine, anti-PD-1 antibody or the combination of the two on tumor growth curve and tumor weight (n=8); (B) immunohistochemistry (IHC) staining of CD8 +Typical images and quantitative analysis of T cells (red) and their IFNy (green) and GzmB (green) expression (n = 6); (C) Western blot analysis of F2RL1 and PD-L1 expression levels in LLC lung cancer tissues (n = 5); (D) Hypoxia-inducible factor (HIF)-1a expression levels (n = 5); (E) Representative immunofluorescence staining images and quantitative analysis of CD34 (green) and a-SMA (red) positive cells in LLC tumor tissues (n = 6); (F) Representative immunofluorescence staining images and quantitative analysis of a-SMA (red) and vimentin (green) positive cells in LLC tissues (n = 6); (G) Typical images and quantitative analysis of Masson staining for detecting fibrosis area in tumor tissues (n = 6). Scale bar, 20 pm. Mean ± SEM. *, P < 0.05; **, P < 0.01. ^, P < 0.05; ^^, P < 0.01 compared with a-PD-1. DETAILED DESCRIPTION
[0033] The technical solutions of the present application will be described clearly and completely below. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.
[0034] The test methods described in the following examples are conventional techniques in the technical field, or are according to the conditions suggested by the manufacturers, unless otherwise specified; the reagents, materials and instruments used, if not specified by the manufacturers, are conventional products that can be obtained commercially.
[0035] Example 1: F2RL1 is highly expressed in lung adenocarcinoma and predicts poor prognosis
[0036] 1. Test methods
[0037] (1) Gene expression profile interactive analysis (GEPIA) database analysis of the difference in F2RL1 gene expression level between human lung adenocarcinoma tissues and para-cancer tissues
[0038] Gene expression profile interactive analysis (GEPIA) database (http: / / gepia.cancer-pku.cn / ) was used to analyze the difference in F2RL1 gene expression level between human lung adenocarcinoma tissues and para-cancer tissues. Boxplot visualizes the expression difference of gene F2RL1 in 483 lung adenocarcinoma tissues and 347 normal tissues, and P < 0.05 is statistically significant.
[0039] (2) F2RL1 tissue chip immunohistochemical staining
[0040] ①Dewaxing: Put the paraffin sections into an oven at 75℃ for 1-2 h. Put the sections into xylene I, II, III for 10 min, respectively. Put the sections into anhydrous ethanol for 10 min, 95% ethanol for 10 min, 75% ethanol for 5 min, and distilled water for 5 min for hydration to avoid the structure damage caused by the sudden contact with water.
[0041] ②Microwave antigen retrieval: Soak the sections in citrate buffer at pH=6.0 or Tris-EDTA buffer at pH=9.0, and microwave for 3 min at high power and 12 min at low power. Cool to room temperature naturally. Wash with PBS for 3 times, 5 min each time.
[0042] ③Block endogenous peroxidase: Surround the tissue with a circle of 0.3 mm or more from the tissue using a histological pen. Add 100 μl of 3% H2O2, and incubate at 37℃ for 25 min in the dark. Wash with PBS for 3 times, 5 min each time.
[0043] ④Blocking: Add 1 drop of antigen blocking solution, and incubate at 37℃ for 30 min in a wet box.
[0044] ⑤Primary antibody incubation: Remove the blocking solution, add the primary antibody F2RL1 (1:100) or PD-L1 (1:300) or CD8 (1:2), and incubate at 4℃ overnight. Wash with PBS for 3 times, 5 min each time.
[0045] ⑥Secondary antibody incubation: Add the secondary antibody of the same species as the primary antibody, which is labeled with horseradish peroxidase, and incubate at 37℃ for 50 min. Wash with PBS for 3 times, 5 min each time.
[0046] ⑦DAB color development: After slightly shaking the sections, add the freshly prepared DAB color development solution, observe and control the color development time, and then wash away the DAB with water to stop the color development after the yellow-brown positive signal appears.
[0047] ⑧Nuclei counterstaining: Hematoxylin counterstaining for 3 min, and then wash with water. Place the sections in warm water or dilute ammonia water for 10 min or so for counterstaining.
[0048] ⑨Dehydration and mounting: Put the sections into 75%, 95%, and 100% ethanol for 5 min each, xylene I for 5 min, and then slightly dry, and then use neutral gum for mounting.
[0049] (3) Kaplan-Meier Plotter for survival curve
[0050] We used the Kaplan-Meier Plotter database (https: / / kmplot.com / analysis / index.php?p=background) to investigate the effect of F2RL1 expression on first progression survival in lung adenocarcinoma.
[0051] (4) Kaplan-Meier survival analysis
[0052] The compiled tissue microarray clinical prognostic data files were screened to retain only survival status and survival time, with death represented by "1" and survival represented by "0." Survival time was converted to months. The compiled scoring files were merged with the corresponding survival time and survival status for each sample. The "survival" R package was used to analyze survival differences between high and low F2RL1 expression groups in tissue microarray lung adenocarcinoma patients.
[0053] (5) Chi-square test analysis of the relationship between F2RL1 expression level in lung adenocarcinoma tissue microarray and clinical pathological characteristics
[0054] The chi-square test in existing statistical analysis software was used to analyze the correlation between different clinicopathological characteristics such as TNM (tumor-node-metastasis) stage and age and the FR2L1 high expression group and low expression group.
[0055] (6) Univariate and multivariate Cox regression analysis
[0056] Univariate Cox regression analysis was performed on the data to explore the impact of each variable on overall survival. Hazard ratios (HRs) and 95% confidence intervals (95% CIs) were used to present the data. An HR of 1 indicates no effect, an HR of <1 indicates a protective factor, and an HR of >1 indicates a risk factor. Multivariate Cox regression analysis was then performed to identify variables that impacted overall survival in the multivariate regression model.
[0057] 2. Test results
[0058] The gene expression profile interactive analysis (GEPIA) database was used to analyze the expression of F2RL1 gene in human lung adenocarcinoma patients. Compared with adjacent adjacent tissues, the gene level of F2RL1 in lung adenocarcinoma tissues was significantly increased. Figure 1 As shown in A. This suggests that the expression of F2RL1 may reflect the prognosis of patients with lung adenocarcinoma. The results of human lung adenocarcinoma tissue chip analysis showed that F2RL1 protein was significantly increased in lung adenocarcinoma tissue, as shown in Figure 1 As shown in B. Quantitative analysis using immunohistochemistry in this paper showed that the expression level of F2RL1 protein in lung adenocarcinoma tissue chips was significantly increased compared with that in adjacent tissues. Figure 1C. The Kaplan-Meier survival curve shows that the progression-free survival rate of the high F2RL1 group is lower than that of the low F2RL1 group, as shown in FIG. 2B. Figure 1 D. The Kaplan-Meier survival curve shows that the progression-free survival rate of the high F2RL1 group is lower than that of the low F2RL1 group, as shown in FIG. 2B.
[0059] The relationship between F2RL1 expression level and clinical pathological characteristics was studied using lung adenocarcinoma tissue chip, and F2RL1 expression level was positively correlated with N stage, which predicted poor prognosis of lung adenocarcinoma, as shown in Table 1 below.
[0060] Table 1. Relationship between F2RL1 level and clinical pathological characteristics in lung adenocarcinoma tissue chip
[0061] The F2RL1 level in lung adenocarcinoma and clinical characteristics were analyzed by single factor and multiple factor Cox regression analysis, and the results showed that the HR of F2RL1 was 3.086, the 95% confidence interval was 1.543-6.174 (P < 0.001), and F2RL1 was a risk factor for lung adenocarcinoma prognosis. The HR and 95% confidence interval of F2RL1 were 3.076 and 1.283-7.375 (P < 0.012), respectively, indicating that F2RL1 and T stage were independent prognostic factors for lung adenocarcinoma patients, as shown in Table 2 below.
[0062] Table 2
[0063] The above results show that F2RL1 protein is overexpressed in lung adenocarcinoma tissues and predicts poor prognosis of lung adenocarcinoma patients.
[0064] Example 2: Correlation of F2RL1 with immunosuppressive microenvironment of lung adenocarcinoma
[0065] 1. Test method
[0066] (1) Bioinformatics analysis of the correlation between F2RL1 and lung adenocarcinoma immune cell and stromal cell infiltration
[0067] The mRNA expression data and clinical information of lung adenocarcinoma patients were downloaded from TCGA database. Based on the gene expression data of lung adenocarcinoma tissues in TCGA data set, the xCell algorithm in the R package of "immune deconv" was used to calculate the infiltration level of immune cells and stromal cells in each tumor tissue, and the difference in cell infiltration level between high / low group patients was compared.
[0068] (2) Bioinformatics analysis of the correlation between F2RL1 expression level and fibroblast infiltration level and fibroblast activation protein and alpha-smooth muscle actin expression level
[0069] Expression data and clinical information of lung adenocarcinoma patients were downloaded from TCGA database. The correlation between F2RL1 gene expression level and fibroblast infiltration level and fibroblast activation protein and alpha-smooth muscle actin expression level was analyzed by bioinformatics.
[0070] (3) Multicolor immunofluorescence of human lung adenocarcinoma tissue
[0071] Quantitative multicolor immunofluorescence analysis was performed using Opal Polaris 7-color kit to characterize the immune landscape in human lung adenocarcinoma tissue. The main steps are as follows:
[0072] ① De-waxing: Place the paraffin section in a 65 ℃ oven for 1 h; de-wax with xylene I, II, III for 3 times, 10 min each time; anhydrous ethanol for 10 min, 95% ethanol for 10 min, 80% ethanol for 5 min, 70% ethanol for 5 min, distilled water for 5 min. Soak in 10% buffered formaldehyde for 20 min, rinse with running water, and rinse with citrate buffer.
[0073] ② Microwave repair: Soak the section in citrate buffer at pH 6 or Tris-EDTA buffer at pH 9, high fire for 3 min, low fire for 12 min, cool at room temperature for 1 h after repair is completed, and rinse with TBST.
[0074] ③ Blocking: Surround the tissue with a group of histological pens, add antibody blocking solution, and incubate at 37℃ in a humidified box for 10 min.
[0075] ④ Primary antibody incubation: Remove the blocking solution, add primary antibody (CD8, 1:2; F2RL1, 1:200; CD34, 1:300; Foxp3, 1:800; alpha-SMA, 1:500; CK, 1:3), incubate at 37℃ for 1 h (or overnight at 4℃), and rinse with TBST for 3 times, 2 min each time.
[0076] ⑤ Secondary antibody incubation: Add Polymer HRP Ms+Rb, incubate at 37℃ in a humidified box for 10 min, rinse with TBST for 3 times, 2 min each time.
[0077] ⑥ OPAL fluorescence incubation: Add corresponding wavelength fluorescent dye (1:100 dilution), place in a humidified box at 37℃ for 10 min, rinse with TBST for 3 times, 2 min each time.
[0078] ⑦ Repeat steps ②-⑥ until all primary antibodies are sequentially incubated.
[0079] 8. Add DAPI (1:100), incubate at 37°C for 10 min, rinse with TBST for 3 times, 2 min each time, and rinse with distilled water for 2 min. Add anti-fluorescence quenching agent for sealing. Use multispectral microscope (Akoya Bioscience) to scan the section.
[0080] For each section, capture the fluorescence spectrum from 420 nm to 720 nm at the same exposure time with an interval of 20 nm using Vectra, and then combine the captured images to create a single stacked image, retaining the spectral features of all labeled particles. Analyze the data using the software.
[0081] (4) Double immunofluorescence of human lung adenocarcinoma tissue
[0082] ① De-waxing: Place the paraffin section in a 65°C oven for 1 h; de-wax with xylene I, II, and III for 3 times, 10 min each time; rinse with anhydrous ethanol for 10 min, 95% ethanol for 10 min, 80% ethanol for 5 min, 70% ethanol for 5 min, and distilled water for 5 min. Soak in 10% buffered formaldehyde for 20 min, rinse with running water, and rinse with citrate buffer.
[0083] ② Microwave repair: Soak the section in citrate buffer at pH=6 or Tris-EDTA buffer at pH=9, high fire for 3 min and low fire for 12 min. After the repair is completed, cool at room temperature for 1 h, and rinse with PBS.
[0084] ③ Blocking: Surround the tissue with a histological pen, and then add the antibody blocking solution dropwise. Incubate at 37°C for 10 min in a humidified box.
[0085] ④ Primary antibody incubation: Remove the blocking solution, add the primary antibody (a-SMA, 1:500; PD-L1, 1:200), and incubate at 37°C for 1 h (or overnight at 4°C). Rinse with PBS for 3 times, 5 min each time.
[0086] ⑤ Secondary antibody incubation: Add the HRP-labeled secondary antibody of the same species as the primary antibody dropwise, and incubate at 37°C for 50 min in a humidified box. Rinse with PBS for 3 times, 5 min each time. ⑥ Add DAPI (1:100), incubate at 37°C for 10 min, rinse with PBS for 3 times, 5 min each time, and rinse with distilled water for 2 min. Add anti-fluorescence quenching agent for sealing.
[0087] 2. Test results
[0088] The test results show that F2RL1 is positively correlated with B cells, memory B cells, pre-B cells, CD8 + T cells, memory effector CD8 + T cells, and naive CD8 +T cells and Th1 cells, as shown in Figure 2 F2RL1 expression level was positively correlated with fibroblast infiltration level, as shown in Figure 2 B. F2RL1 expression level was positively correlated with expression levels of fibroblast activation protein (FAP) and α-smooth muscle actin (α-SMA), but negatively correlated with CD8 + T cell function index granzyme B (GZMB) expression level, as shown in Figure 2 C-2E. The above results show that F2RL1 is a potential marker for predicting the immune microenvironment of lung adenocarcinoma.
[0089] The present application uses multicolor immunofluorescence staining to detect the infiltration levels of immune cells and stromal cells in human lung adenocarcinoma tissues. F2RL1 has obvious colocalization with α-SMA + (CAFs marker), indicating that F2RL1 is expressed in CAFs. The test results found that, compared with the F2RL1 high expression group, the F2RL1 low expression group had more CD8 + T cell infiltration in human lung adenocarcinoma tissues, while the proportion of α-SMA + cells (CAFs) and CD34 + cells (endothelial cells) was less, and FOXP3 + cells (Tregs) had no significant difference, as shown in Figure 3 F2RL1 high expression group, the PD-L1 + CAFs infiltration level was significantly increased, as shown in Figure 4 These results show that F2RL1 is related to CAFs, endothelial cells and CD8 + T cells, but not Tregs cells, in the immune microenvironment of lung adenocarcinoma.
[0090] Example 3: Knocking down F2RL1 in CAFs inhibits the activation of fibroblasts to CAFs in vitro and enhances the function of CD8 + T cells in vitro co-culture
[0091] 1. Test method
[0092] (1) Transfect L929 cells with si-F2RL1
[0093] Design si-F2RL1, named murine si-F2RL1#1 and murine si-F2RL1#2 respectively; and negative control si-scram.
[0094] The nucleotide sequence (sense strand) of murine si-F2RL1#1 is gggacgcaacaacaguaaagg, as shown in SEQ ID NO. 23.
[0095] The nucleotide sequence (sense strand) of the murine si-F2RL1#2 is gcuugaugaugaugaugauga, as shown in SEQ ID NO. 24.
[0096] L929 cells were grown in DMEM medium containing 10% fetal bovine serum in a 37°C incubator with 5% CO2 and 95% air. Cell morphology was assessed periodically. L929 cells were seeded in 12-well plates 24 h before transfection, with 1.5 mL complete medium without penicillin / streptomycin per well. When the cell confluency reached about 60%, si-RNA targeting F2RL1 (murine si-F2RL1#2) and negative control (si-scram) were used to stably transfect the cells using LipofectaMine 2000 for 6 h, and then the medium was replaced and the cells were cultured for 48 h before harvesting for subsequent experiments.
[0097] (2) Induced activation of CAFs
[0098] ① Preparation of lung cancer cell conditioned medium
[0099] First, lung cancer cell conditioned medium was prepared. The 3rd-5th passage of mouse lung cancer cells CMT167 was cultured to 70% confluence, and then serum-free medium was added to continue culturing for 24 h. The culture supernatant was collected, centrifuged at 1000 rpm for 5 min, and filtered using a 0.22 μM bacterial filter to obtain the lung cancer cell conditioned medium.
[0100] ② Experiment of activating fibroblasts into CAFs
[0101] The lung cancer cell conditioned medium prepared above was mixed with DMEM medium at a ratio of 1:1. Then, si-F2RL1-treated L929 fibroblasts were cultured for 48 h, and the cells were collected for examination.
[0102] ③ Immunofluorescence of L929 cells
[0103] Fibroblast activation protein (FAP) and a-SMA were detected by immunofluorescence. The specific detection method and steps are as follows: the cell-climbed glass slide in the culture plate was washed with PBS for 3 times, 3 min each time; the glass slide was fixed with 4% paraformaldehyde for 15 min, and then washed with PBS for 3 times, 3 min each time; 0.5% Triton X-100 (prepared with PBS) was used for room temperature penetration for 20 min; the glass slide was washed with PBS for 3 times, 3 min each time, and then the PBS was absorbed with absorbent paper; normal goat serum was added on the glass slide, and the glass slide was sealed at room temperature for 30 min; the sealing liquid was removed, and the primary antibody FAP (1:100) or a-SMA (1:300) was added, and the glass slide was incubated at 4°C overnight. The glass slide was washed with PBS for 3 times, 5 min each time; the secondary antibody with fluorescence labeling (488 nm / 594 nm) corresponding to the species of the primary antibody was added, and the glass slide was incubated at 37°C in the dark for 60 min; the glass slide was washed with PBS for 3 times, 5 min each time; the liquid on the glass slide was absorbed with absorbent paper, and the glass slide was sealed with anti-fluorescence quenching sealing agent containing DAPI, and then the glass slide was observed under a fluorescence microscope to collect images. The average fluorescence intensity of immunofluorescence was analyzed by using software.
[0104] (4) Transfection of si-F2RL1 into MRC-5 cells
[0105] The si-F2RL1 was designed, and was named as human si-F2RL1#1 and human si-F2RL1#2, respectively; and a negative control si-scram was designed.
[0106] The nucleotide (sense strand) sequence of human si-F2RL1#1 is ggauguggaaccuguuuaaug, as shown in SEQ ID NO. 21.
[0107] The nucleotide (sense strand) sequence of human si-F2RL1#2 is gaaucagguuuccaaucaaca, as shown in SEQ ID NO. 22.
[0108] The MRC-5 cells were grown in DMEM medium containing 10% fetal bovine serum in a 37°C incubator with 5% CO2 and 95% air. The cell morphology was evaluated regularly. 24 h before transfection, the MRC-5 cells were inoculated in a 12-well plate, and 1.5 mL of complete culture medium without penicillin / streptomycin was added to each well. When the cell confluence reached about 60%, the si-RNA targeting F2RL1 (human si-F2RL1-AS1#1) and the negative control (si-scram) were transfected, and the cells were stably transfected with LipofectaMine 2000 for 6 h. Then, the culture medium was replaced, and the cells were cultured for 48 h. Then, the cells were collected for subsequent experiments.
[0109] (5) Co-culture experiment
[0110] Isolation of human PBMCs
[0111] All volunteers were healthy males who signed a written informed consent. The methods and procedures were as follows:
[0112] Sample preparation: Ficoll-Paque PREMIUM 1.077 g / ml density gradient centrifugation was used to separate peripheral blood mononuclear cells from healthy donors. This study has been approved by the Ethics Committee of Wuhan University Medical Department. After red blood cells were lysed with lysing solution, CD8 + T cell isolation kit Dynabeads™ FlowComp™ Human CD8 kit was used to purify CD8 + T cells from peripheral blood mononuclear cells. PBMCs were resuspended in PBS. The cell density was adjusted to 1 x 10 7 cells / mL.
[0113] Magnetic bead incubation: magnetic beads were added at a ratio of 10 μL magnetic beads per 1 x 10 7 cells. After gentle mixing, incubate at room temperature for 20 min, and mix every 5 min during the incubation.
[0114] Magnetic bead capture: place the tubes in a magnetic stand for 2 min, and discard the supernatant of unbound cells. Keep the tubes in the magnetic stand, and add 5 mL buffer to wash the magnetic bead-cell complex, and repeat the washing for 2 times.
[0115] Magnetic bead release: add FlowComp™ release buffer. Incubate at room temperature for 15 min, and mix gently during the incubation to separate the magnetic beads from the cells.
[0116] Remove magnetic beads: place the tubes back in the magnetic stand for 1 min, and transfer the cell suspension without magnetic beads to a new tube. Centrifuge (300 x g, 5 min) to collect the cells, and resuspend with medium for standby.
[0117] Flow cytometry was used to detect the purity of the enriched CD8 + T cells, which was 95%. The enriched CD8 + T cells were inoculated in a 24-well plate, and cultured in RPMI 1640 medium with fetal bovine serum at a constant temperature of 37°C and in a culture box containing 5% CO2. The CD8 + T cells were stimulated with anti-CD3 / CD28 (1 mg / ml) for 24 h.
[0118] Isolation and extraction of mouse spleen cells
[0119] Experimental animal handling and sample preparation: C57BL / 6 mice were sacrificed by cervical dislocation and immediately immersed in 75% ethanol solution for surface disinfection for 3 min. Under aseptic conditions, the spleen tissue was quickly removed and transferred to pre-cooled RPMI-1640 medium (containing 1% double antibody) for rinsing twice. The sample was placed in a sterile culture dish, and the tissue was mechanically disaggregated using a sterile syringe piston, filtered through a 200-mesh screen to obtain a single-cell suspension. The resulting cell suspension was centrifuged at 1500 rpm for 5 min at 4°C, and the supernatant was discarded. Red blood cell lysis solution was added and allowed to stand for 3 min. After terminating the lysis reaction, repeat the centrifugation step at 1500 rpm for 5 min at 4°C, and discard the supernatant. This operation is repeated until the red blood cells are completely lysed, and finally the cells are resuspended with complete medium (RPMI-1640 + 10% FBS), and the cell viability is evaluated by trypan blue staining method > 95%.
[0120] Purification of CD8 from lymphocyte suspension using Dynabeads FlowComp Mouse CD8 kit + T cells. Vortex the bead tube to resuspend, take the beads to a new tube, add an equal volume of separation buffer and mix well, let stand in the magnetic stand for 1 min, discard the supernatant and remove the tube, resuspend the beads with an equal volume of separation buffer as the initial beads, and wash the beads. Take 500 μL (5 x 10 7 ) cell suspension, add 25 μL FlowComp™ mouse CD8 antibody and mix well, incubate at 2-8°C for 10 min. Add 2 mL separation buffer, centrifuge at 350 x g for 8 min, discard the supernatant, and resuspend in 1 mL separation buffer. Add 75 μL of washed FlowComp™ magnetic beads, mix well (e.g. vortex for 2-3 seconds). Incubate at 2-8°C for 15 min, add 1 mL separation buffer, blow and suck 2-3 times (or vortex for 2-3 seconds), and let stand in the magnetic stand for 2 min to keep the magnetic attraction state. Carefully discard the supernatant containing CD8 negative cells. Repeat the washing of the beads bound to CD8 + cells. Resuspend the bead-bound cells with 1 mL release buffer, incubate at room temperature for 10 min, release the cells by blowing and sucking 10 times, and let stand in the magnetic stand for 2 min. Transfer the supernatant containing free CD8 + cells to a new tube. Flow cytometry showed that the purity of the enriched CD8 + T cells was 93%. The enriched CD8 + T cells were inoculated in a 24-well plate, cultured in RPMI1640 medium with fetal bovine serum at a constant temperature of 37°C and in a culture box containing 5% CO2. The CD8 + T cells were stimulated with anti-CD3 / CD28 (1 mg / ml) for 24 h.
[0121] ③Transwell co-culture
[0122] Human CD8 + T cells and human fibroblast MRC-5, mouse CD8 + T cells and mouse fibroblast L929, all at 5:1 ratio, and A549 or CMT167 cells were added in the lower chamber. Normal fibroblast group, CAF group, si-Scram group, and si-F2RL1 group were set up.
[0123] 4 mL DMEM (containing 10% FBS) was added, and the co-culture system was maintained for 48 h. Then the chamber was removed, and flow cytometry analysis was performed to evaluate tumor cell death.
[0124] (6) Gene expression analysis
[0125] ① Trizol method for extracting total RNA: collect cells, use Trizol lysis buffer to lyse cells (1 mL at room temperature for 5 min), add chloroform (0.2 mL, room temperature for 3 min), centrifuge at 12000 rpm for 15 min; take the upper colorless liquid (about 0.2 mL) and add isopropanol 0.5 mL, stand on ice for 10 min; centrifuge at 12000 rpm for 10 min to keep the precipitate, add anhydrous ethanol (1 mL, wash, centrifuge at 12000 rpm for 10 min; repeat twice to keep the precipitate; place at room temperature for 5-10 min, add DEPC water to dissolve the RNA precipitate, and store at -80°C refrigerator for standby.
[0126] ② According to the instructions of the reverse transcription kit (Novozyme, China), the synthesis of first-strand cDNA was carried out. Take 2 μg RNA template, add RNAase-free ddH2O, Oligo (dT) 23VN and mix evenly, then heat at 65°C for 5 min, and pre-cool on ice to denature the RNA template, then add gDNA wiper Mix to remove genomic DNA, finally add 10×RTMix and HiScript II Enzyme Mix to synthesize first-strand cDNA.
[0127] ③ Real-time quantitative PCR: add primers and SYBR Green PCR premix to mix, with a final volume of 25 μL. Use CFX96 fluorescent quantitative PCR instrument (Bio-Rad) for real-time quantitative PCR to detect the Ct value of each group of target genes. Use 2 -ΔΔCt method for relative quantification of mRNA, with GAPDH as the internal reference gene. The primer sequences are as follows: Table 3.
[0128] Table 3 Primers for qPCR reaction
[0129]
[0130] (7) GzmB and IFN-γ production assay
[0131] GzmB and IFN-γ production in the supernatant was detected by ELISA. The specific detection method and steps are as follows:
[0132] ① Collect cell culture fluid, centrifuge at 2000 rpm for 5 min to take the supernatant; dilute the standard according to the concentration ratio of 1 / 2, 1 / 4, 1 / 8, 1 / 16, 1 / 32, and set up blank background control.
[0133] ② Add the cell culture supernatant to be tested and different concentrations of standard to the pre-coated detection wells at 100 μL / well, seal the plate with film, and incubate at room temperature for 2 h.
[0134] ③ Wash the plate 5 times, and the last time is placed on the water-absorbing paper to pat dry; add biotinylated antibody 100 μL / well, seal the plate with film, and incubate at room temperature for 1 h.
[0135] ④ Wash the plate 5 times, and the last time is placed on the water-absorbing paper to pat dry; add horseradish peroxidase-labeled Streptavidin 100 μL / well, seal the plate with film, and incubate at room temperature for 20 min.
[0136] ⑤ Wash the plate 5 times, and the last time is placed on the water-absorbing paper to pat dry; add color developing agent TMB solution 100 μL / well, seal the plate with film, and incubate at room temperature for 15 min.
[0137] ⑥ Add 50 μL / well of stop solution, mix well, and immediately detect the absorbance value at 450 nm. Draw the standard curve with the standard A450 value after removing the background as the ordinate and the standard concentration as the abscissa. Calculate the corresponding concentration of each sample by the absorbance value of the sample and the standard curve.
[0138] 2. Test results
[0139] The results of Western blotting in this paper showed that si-F2RL1 (murine si-F2RL1#1 and si-F2RL1#2) transfected L929 cells could significantly reduce the expression of F2RL1 protein in L929 cells, as shown in Figure A. High expression of FAP and α-SMA is a characteristic of CAF activation. Therefore, this paper used immunofluorescence staining to detect FAP and α-SMA in mouse fibroblasts L929. As a result, F2RL1 knockdown significantly inhibited the expression levels of FAP and α-SMA in mouse fibroblasts L929, as shown in Figure B. Figure 5 Figure 5 As shown in B. These data suggest that the tumor fibrosis-related gene F2RL1 plays an important role in the activation of lung adenocarcinoma CAFs.
[0140] Co-culture of si-F2RL1-treated L929 and MRC-5 fibroblasts can significantly promote CD8 + T cell proliferation and expression of GzmB and IFN-γ, as shown in Figure 6 A-6C. Co-culture of si-F2RL1-transfected L929 cells or MRC-5 cells with human CD8 + T cells or mouse CD8 + T cells, and co-culture with lung adenocarcinoma cells CMT167 or A549, the results showed that F2RL1 siRNA can significantly increase the percentage of 7-AAD + CMT167 and A549 cells, as shown in Figure 6 D.
[0141] Example 4: Virtual screening results show that leonurine is a potential inhibitor of F2RL1
[0142] 1. Test method
[0143] (1) Virtual screening
[0144] First, the known F2RL1 structure (PDB id: 5NDD) was obtained from the Protein Data Bank, and the chemical structures of 36043 natural small molecule compounds were obtained from the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP). The docking of F2RL1 protein structure and natural small molecule compounds was performed using software.
[0145] 2. Test results
[0146] The top 10 available candidate drugs ZINC ID, structure, Total score, Crash score and Polar score. The scoring function value of Total-Score represents the affinity of small molecule ligands extracted from macromolecular proteins to receptors, the higher the value, the higher the affinity; Crash represents the inappropriateness between the ligands extracted from macromolecular proteins and the receptors, the closer to zero, the better. Polar is the polar function score, the larger the value, the better when the binding site is on the surface of the molecule; when inside the molecule, the smaller the value, the better. Among them, Leonurine (ZINC14444766) has a commercial reagent and is relatively easy to obtain, with a Crash score ranking second and a Polar score ranking fourth, and a total affinity score greater than 7, showing good binding capacity, as shown in Table 4.
[0147] Table 3 Virtual screening of F2RL1 small molecule inhibitors and compounds with top ten scores
[0148]
[0149] Leonurine forms hydrogen bond interactions with F2RL1 at GLU145, LYS213, LYS1147 and TYR1139 (position number of amino acid residues), so it is selected as a candidate drug for further research. The binding mode of F2RL1 protein and Leonurine is shown in Figure 7 .
[0150] Example 5: F2RL1 inhibitor Leonurine activates CAFs in vitro culture through Akt signal and sensitizes CMT167 and LLC mice to PD-1 treatment
[0151] 1. Test method
[0152] (1) KEGG analysis
[0153] Download the expression data from the GEO database, and divide the F2RL1 related genes into high and low expression groups. 248 differentially expressed F2RL1 related genes are screened out, of which 223 are up-regulated and 25 are down-regulated, and then KEGG enrichment analysis is performed.
[0154] (2) Western blotting
[0155] ① Preparation of protein sample: After collecting an appropriate amount of tissue homogenate or cells, add protein lysis solution and lyse on ice for 30 min, centrifuge and take the supernatant. The protein concentration of the sample was determined by BCA protein quantification method. Add 5x loading buffer and appropriate PBS to prepare a protein sample with a concentration of 30 μg / 20 μl, mix well and heat at 100℃ for 10 min to denature the protein. The prepared protein sample is placed at -20℃ for use.
[0156] ②SDS-PAGE gel electrophoresis: Separating and stacking gels of varying concentrations were prepared according to the target molecular weight. Protein samples and protein markers were added and electrophoresed (stacking gel 80 V, separating gel 120 V). After the protein markers were fully separated, the membranes were transferred to methanol-activated PVDF membranes (90 V, 120 min). After transfer, the membranes were blocked with 5% skim milk for 1 h at room temperature. The PVDF membranes were incubated with antibodies specific for F2RL1 (1:300), PD-L1 (1:1000), Akt (1:1000), p-Akt (1:1000), GAPDH (1:5000), or HIF-1α (1:1000) at 4°C overnight. Unbound primary antibodies were washed with TBST, and the blots were incubated with horseradish peroxidase-conjugated goat anti-rabbit or goat anti-mouse secondary antibodies for 1 h at room temperature. The blots were then detected using an ECL system (ThermoFisher Scientific, Waltham, MA, USA). The relative expression was normalized to the expression level of GAPDH. Images were processed using image processing software and semi-quantified by grayscale value.
[0157] (3) Animal model preparation, grouping and treatment
[0158] C57BL / 6 mice (male, 6–8 weeks old) were purchased from the Hubei Provincial Center for Disease Control and Prevention. Mice were acclimated to their new environment for 1 week before the experiment. The animals were housed in a pathogen-free environment with a 12-h light / dark cycle and had ad libitum access to water and food. All animal experiments were performed in accordance with the policies of the Animal Ethics Committee of the Wuhan University Animal Research Committee and the guidelines of the Association for Assessment and Accreditation of Laboratory Animal Care International. CMT167 and LLC cell suspensions were inoculated subcutaneously in the left flank of C57BL / 6 mice (2 × 10 5 After about 7 days, when the tumor volume reached about 100 mm 3 When the mice reached a certain size, they were randomly divided into four groups and given drug treatments. The control group received an equal dose of vehicle; the leonurine group received the F2RL1 inhibitor leonurine alone (40 mg / kg, once daily, 5 days a week, for 2 weeks) by oral gavage; the PD-1 monoclonal antibody group received PD-1 monoclonal antibody alone (200 μg / mouse, once every 3 days for 4 doses); and the combination group received both leonurine (40 mg / kg, once daily, 5 days a week, for 2 weeks) and PD-1 monoclonal antibody (200 μg / mouse, once every 3 days for 4 doses). Mice were sacrificed 21 days after inoculation, and tumor tissue was collected for analysis.
[0159] (4) Statistical analysis
[0160] Data from this study were analyzed and visualized using existing software programs. The Shapiro-Wilk test was first used to verify normal distribution of the data. For data that did not follow a normal distribution or had a high number of outliers, the Brown-Forsythe test was used to confirm homogeneity of variance. For data that followed a normal distribution, the Bartlett test was used to confirm homogeneity of variance. To compare significant differences between two groups of data, the t-test was used. Analysis of variance or the Kruskal-Wallis test was used to compare significant differences between three or more groups. Statistical results were expressed as mean ± standard error. All statistical tests were two-sided, and results were considered statistically significant when P < 0.05.
[0161] 2. Test results
[0162] KEGG analysis showed that the differentially expressed F2RL1-related genes were mainly associated with the PI3K-Akt signaling pathway, focal adhesion, and Rap 1 signaling pathway. These results indicate that the differentially expressed F2RL1-related genes in the PI3K-Akt signaling pathway have undergone significant changes, such as Figure 8 As shown in A-8B. In MRC-5 and L929 fibroblasts, inhibition of F2RL1 by fennelline or si-F2RL1 downregulated F2RL1, p-Akt, and PD-L1. Figure 8 As shown in C. Knockdown of Akt inhibited the expression of PD-L1 protein in MRC-5 and L929 fibroblasts. Figure 8 As shown in D-8E. F2RL1 or Akt siRNA reduced the expression of IL-6, VEGF, TGF-β, α-SMA, and FAP in MRC-5 and L929 fibroblasts. Figure 9 These results indicate that the F2RL1-Akt signaling pathway is crucial for CAFs-mediated immunosuppression.
[0163] To explore the possibility of F2RL1 as a target for sensitizing anti-PD-1 therapy, we studied the therapeutic efficacy of F2RL1 inhibitor leonurine combined with PD-1 monoclonal antibody in CMT167 and LLC subcutaneous xenograft mouse models. Compared with anti-PD-1 treatment, leonurine combined with anti-PD-1 treatment significantly reduced tumor volume and tumor weight. Figure 10 Compared with monotherapy, leonurine combined with PD-1 blockade promoted IFNγ + CD8 + and GZMB + CD8 + T cell expression, and CD8+ Intratumoral infiltration of T cells, such as CD8 Figure 10 B and 11B. Compared with anti-PD-1 monotherapy, combination therapy reduced the levels of F2RL1, PD-L1 and HIF-1α in CMT167 and LLC lung cancer tissues, as shown in Figure 10 C-10D and Figure 11 C-11D. Immunofluorescence analysis confirmed that combination therapy significantly promoted tumor vessel normalization, as shown in Figure 10 E and 11E. Compared with anti-PD-1 monotherapy, combination therapy reduced the number of α-SMA + vimentin + cells and the area of interstitial fibrosis in CMT167 and LLC tumors, as shown in Figure 10 F-10G and Figure 11 F-11G. The results showed that F2RL1 inhibitor leucocyanidol could promote tumor vessel normalization, inhibit tumor growth and PD-L1 expression, and reduce the number of α-SMA + vimentin + cells and the area of interstitial fibrosis. Enhancing CD8 + T cell infiltration and effector function to enhance anti-tumor immunity, thereby enhancing the efficacy of anti-PD-1 therapy.
[0164] In summary, F2RL1 induces lung adenocarcinoma immunosuppression through pro-tumor microenvironment formation and provides a potential new target, candidate drug and combination therapy for sensitizing lung adenocarcinoma immunotherapy. Therefore, the present application has high utilization value.
[0165] The above specific embodiments describe the implementation of the present application in detail, but the present application is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concepts of the present application, the technical solutions of the present application can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present application.
Claims
1. Use of a F2RL1 inhibitor in the preparation of a lung adenocarcinoma immunotherapy drug, characterized in that: The F2RL1 inhibitor is used in combination with a PD-1 inhibitor; the F2RL1 inhibitor inhibits the expression of the F2RL1 gene or the physiological activity of the F2RL1 protein, thereby inhibiting the expression of PD-L1 in cancer-associated fibroblasts and / or promoting CD8 + T cell proliferation.
2. Use of the F2RL1 inhibitor according to claim 1 in the preparation of a lung adenocarcinoma immunotherapy drug, characterized in that: The PD-1 inhibitor is used to block the PD-1 / PD-L1 pathway.
3. Use of the F2RL1 inhibitor according to claim 2 in the preparation of a lung adenocarcinoma immunotherapy drug, characterized in that: The PD-1 inhibitor is a monoclonal antibody targeting PD-1.
4. Use of the F2RL1 inhibitor according to claim 1 in the preparation of a lung adenocarcinoma immunotherapy drug, characterized in that: The F2RL1 inhibitor is siRNA that targets and inhibits the expression of the F2RL1 gene.
5. Use of the F2RL1 inhibitor according to claim 4 in the preparation of a lung adenocarcinoma immunotherapy drug, characterized in that: The nucleotide sequence of the human siRNA is shown in SEQ ID NO.21 or SEQ ID NO.
22.
6. Use of the F2RL1 inhibitor according to claim 4 in the preparation of a lung adenocarcinoma immunotherapy drug, characterized in that: The nucleotide sequence of the mouse siRNA is shown in SEQ ID NO. 23 or SEQ ID NO.
24.
7. Use of the F2RL1 inhibitor according to claim 1 in the preparation of a lung adenocarcinoma immunotherapy drug, characterized in that: The F2RL1 inhibitor is leonurine, and its chemical structure is: 。 8. A lung adenocarcinoma immunotherapy drug, characterized in that: The method comprises the F2RL1 inhibitor and the PD-1 inhibitor according to any one of claims 1 to 7.