Bacillus for preventing and treating camellia anthracnose and application thereof
By using Bacillus CH-1-7 and its biological agents, extracellular enzymes and growth-promoting substances are used to inhibit the anthracnose pathogen in Camellia oleifera, solving the environmental pollution problem caused by chemical control of Camellia oleifera anthracnose and achieving efficient disease control and plant growth promotion.
Patent Information
- Application Number
- CN202511295718.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-11
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2045-09-11
AI Technical Summary
Anthracnose in camellia oil severely impacts the development of the camellia oil industry, and chemical control methods lead to environmental pollution, necessitating a healthier approach to prevention and control.
Bacillus CH-1-7 and its biological agents are used to inhibit the growth of anthracnose fungus in Camellia oleifera by secreting extracellular enzymes such as protease, cellulase, and amylase, which produce organophosphates, ironophiles, and nitrogen-fixing substances, and promote plant growth.
The fermentation broth of Bacillus CH-1-7 showed a 65.22% preventive effect and a 28.36% therapeutic effect against anthrax in Camellia oleifera, which is significantly better than chemical pesticides and does not pollute the environment.
Smart Images

Figure CN120775754B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant protection, specifically relating to a Bacillus species for controlling anthracnose in Camellia oleifera and its application. Background Technology
[0002] Camellia oleifera ( Camellia oleifera Camellia oleifera is a unique woody oilseed tree species in my country, with a cultivation history of over 2000 years. It is mainly distributed in the warm and humid low mountain and hilly areas of southern China. Its seed oil is rich in unsaturated fatty acids such as oleic acid and linoleic acid, with a content exceeding 90%. The human body's digestibility and absorption rate reaches 97%, earning it the reputation of "Oriental olive oil." It is widely used in the food, pharmaceutical, and cosmetic industries. However, the occurrence of anthracnose in Camellia oleifera severely restricts the development of the camellia oil industry. Camellia oleifera anthracnose is caused by *Colletotrichum gloeosporioides* (…). Colletotrichum gloeosporioides Anthracnose is a fungal disease caused by infection, primarily affecting the fruits, leaves, shoots, and buds of camellia oleifera, with the fruits being the most severely affected. Symptoms include fruit drop, leaf drop, bud drop, shoot dieback, and branch cankers, and in severe cases, the entire plant can die, significantly impacting the yield and quality of the camellia oleifera. During anthracnose outbreaks, chemical agents such as carbendazim, imazalil, and benzoyl azoxystrobin are commonly used for control. However, the use of chemical agents often causes environmental pollution. Therefore, using biocontrol agents to control anthracnose provides a new technical solution for the prevention and control of this disease and also provides the public with healthier organic camellia oil products. Summary of the Invention
[0003] In view of the existing technical problems, this application provides a Bacillus species to effectively prevent and control anthracnose disease in Camellia oleifera caused by Colletotrichum gloeosporioides.
[0004] Bacillus of the present invention Bacillus sp. was isolated from wetland mudflat weeds and designated CH-1-7. Based on Bergey's Manual of Bacterial Identification, and comparing the morphological characteristics, physiological and biochemical properties of strain CH-1-7 with phylogenetic analysis using 16S rDNA sequences, strain CH-1-7 was identified as belonging to the genus *Bacillus* (*Bacillus*). Bacillus ), recorded as Bacillus ( Bacillus sp.) CH-1-7 (This bacterium was deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC) on April 27, 2025, with accession number: GDMCC No. 66219).
[0005] The characteristics of Bacillus CH-1-7 cells and colonies are as follows: after being incubated at 30°C for 72 h on PDA medium, the colony surface is rough, opaque, slightly yellow or grayish-white, with wrinkles and protrusions. When the inoculation loop is lightly touched, the colony can be drawn into threads, and the colony edge is radial. Gram staining is positive.
[0006] Bacillus CH-1-7 possesses the ability to secrete extracellular enzymes, including proteases, cellulases, and amylases. It also has the ability to produce life-promoting substances, including organophosphates, ironophiles, and nitrogen fixation, but lacks the ability to dissolve inorganic phosphorus and potassium.
[0007] Physiological and biochemical characteristics of Bacillus CH-1-7: This strain grows well at pH 5.7 in 7% sodium chloride solution. It cannot grow anaerobicly, can decompose starch and reduce nitrate, is positive for VP test, can utilize D-xylose and citrate to produce gelatinase, but cannot utilize L-arabinose, D-mannitol, or propionate. It is Gram-positive. Referring to Bergey's Manual of Bacteriological Identification, the physiological and biochemical characteristics of this bacterium are consistent with those of Bacillus spp.
[0008] The first objective of this invention is to provide a strain of Bacillus ( Bacillus sp.) CH-1-7, accession number GDMCC No. 66219.
[0009] A second objective of this invention is to provide a biological agent using the culture, volatiles, fermentation broth, and / or metabolites of the aforementioned Bacillus CH-1-7 as active ingredients.
[0010] Preferably, the culture is prepared by the following method: Bacillus CH-1-7 is inoculated into PDA solid medium and cultured at 30°C to obtain Bacillus CH-1-7 culture;
[0011] The fermentation broth was prepared by the following method: Bacillus CH-1-7 culture was inoculated into KMB liquid medium and cultured at 30℃ and 200 rpm for 2-3 days to obtain the fermentation broth;
[0012] The metabolites were prepared by the following method: Bacillus CH-1-7 was inoculated onto KMB solid medium and cultured at 30°C for 10 days to obtain a culture. The culture was ground into powder, freeze-dried, and mixed with methanol at a ratio of 1 g: 5 mL to extract the metabolites produced by Bacillus CH-1-7.
[0013] Preferably, the PDA solid culture medium has the following composition: 200 g / L potato, 20 g / L glucose, 17 g / L agar powder, with the balance being water, and pH 7.0-7.2;
[0014] The KMB liquid culture medium has the following composition: 20 g / L glucose, 20 g / L peptone, 1.5 g / L MgSO4, 1.5 g / L K2HPO4, with the remainder being water;
[0015] The KMB solid culture medium comprises 20 g / L glucose, 20 g / L peptone, 1.5 g / L MgSO4, 1.5 g / L K2HPO4, 15 g / L agar powder, and the rest is water.
[0016] A third object of the present application is to provide the use of the Bacillus CH-1-7 or the biological agent in at least one of the following (1)-(2):
[0017] (1) inhibiting the growth of plant pathogenic bacteria;
[0018] (2) promoting plant growth.
[0019] Preferably, the plant pathogenic bacteria are Bortrytis cinerea AS-ZG-RAC, Phellinus noxius L1-0-2, Colletotrichum gloeosporioides F1, Mycosphaerella siamensis B0-2, Fusarium solani SM-LK-b5a, Colletotrichum gloeosporioides T3-2-1, Colletotrichum gloeosporioides T3-4-1, Pestalosphaeria tsugae hs2-1, Diaporthe phaseolorum var. citri E1-1-a, Alternaria alternata WBHS-YK-2, Aspergillus niger BZ-FL-1, and Neocosmospora vasinfecta GH-YB-1.
[0020] Preferably, the plant growth promotion is achieved by secreting extracellular enzymes, producing organic phosphorus, producing siderophores, and / or nitrogen fixation.
[0021] Preferably, the extracellular enzymes are proteases, cellulases, and / or amylases.
[0022] A fourth object of the present application is to provide a method for preventing and treating Camellia oleifera anthracnose, comprising the step of applying the Bacillus CH-1-7 and / or the biological agent to Camellia oleifera.
[0023] Advantages of the present application:
[0024] 1. The Bacillus CH-1-7 can be used to prepare a microbial fertilizer.
[0025] The Bacillus CH-1-7 of the present application has the ability to secrete extracellular enzymes, can secrete proteases, cellulases, and amylases, has the ability to produce life-promoting substances, can produce organic phosphorus, siderophores, and has the ability to fix nitrogen. It grows well under the conditions of pH 5.7 and 7% sodium chloride, can decompose starch, reduce nitrate, decompose glucose to produce pyruvic acid, can utilize D-xylose and citrate, and produce gelatinase.
[0026] 2. The Bacillus CH-1-7 can efficiently prevent and treat Camellia oleifera anthracnose and can be used to prepare a biological pesticide.
[0027] The fermentation liquor of the bacillus CH-1-7 of the application can effectively control the oil tea leaf spot caused by the colletotrichum gloeosporioides after the oil tea leaf is pretreated, has a good prevention effect, and the prevention effect can reach 65.22%, the crude extract of the bacteria has a prevention effect of 28.04%, and the difference compared with the positive control is significant.
[0028] The fermentation liquor of the bacillus CH-1-7 of the application can control the oil tea leaf spot caused by the colletotrichum gloeosporioides after the diseased oil tea leaf is treated, the treatment effect can reach 28.36%, which is higher than that of the pesticide treatment, the crude extract of the bacteria has a treatment effect of 19.40%, and the difference compared with the positive control is significant.
[0029] Preservation instruction
[0030] The bacillus CH-1-7 of the application Bacillus The bacillus CH-1-7 (bacillus CH-1-7) is preserved in Guangdong Microbial Culture Collection Center (GDMCC for short) on April 27, 2025, the preservation number is GDMCC No.66219, and the address of the preservation unit is No. 59, Building 5, 100, Xianlie Middle Road, Guangzhou. Brief description of drawings
[0031] Figure 1 It is the inhibition effect of the soil bacteria screened on the colletotrichum gloeosporioides.
[0032] Figure 2 It is the colony morphology and bacterial characteristics of the bacillus CH-1-7; A: the colony morphology of the bacillus CH-1-7 cultured on KMB, LB and PDA medium for 6 days respectively; the bacterial morphology of the bacillus CH-1-7 under an optical microscope (B) and an optical microscope after gram staining (C).
[0033] Figure 3 It is the phylogenetic tree of the bacillus CH-1-7 based on 16S rRNA gene.
[0034] Figure 4 It is the detection of the ability of the bacillus CH-1-7 to produce life activity substances and the ability of extracellular enzyme secretion.
[0035] Figure 5 It is the antagonistic effect of the bacteriostatic substance and volatile gas of the bacillus CH-1-7 on the pathogenic strain; A: the antagonistic effect of the bacteriostatic substance of the bacillus CH-1-7 on the pathogenic strain; B: the inhibition effect of the volatile gas of the bacillus CH-1-7 on the pathogenic strain; C: the inhibition rate of the bacteriostatic substance and volatile gas of the bacillus CH-1-7 on the pathogenic strain.
[0036] Figure 6 It is the prevention effect of the bacillus CH-1-7 on the oil tea leaf spot.
[0037] Figure 7 This refers to the therapeutic effect of Bacillus CH-1-7 on anthrax in Camellia oleifera. Detailed Implementation
[0038] The following embodiments are further illustrations of the present invention, but not limitations thereof.
[0039] Example 1: Method for Isolation and Screening of Antagonistic Strains
[0040] (1) Strains Isolation: Strains were isolated from rhizosphere soils of plants in forests, wetlands, parks, and other areas in various cities of Guangdong Province. Two to four soil samples were collected from each collection point, each from the rhizosphere of a different plant, taken from a depth of 10-20 cm underground. 10 g of rhizosphere soil from each plant was weighed and added to 0.1% Tween water for gradient dilution to obtain soil dilutions with concentrations of approximately 10, 100, and 1000 times. The soil dilutions were then evenly spread onto PDA plates. The PDA plates were incubated at a constant temperature of 30℃ for 1-2 days.
[0041] (2) Bacterial strain purification: The streak plate method was used. Bacteria from the plate were picked up with a sterilized toothpick and streaked on LB solid medium. The culture was kept at 30°C for 1-2 days, and single colonies were picked for preservation.
[0042] (3) Screening of bacterial strains: Plate confrontation culture method was used. A small amount of bacteria was streaked on a PDA plate (2.0 cm long) and incubated at 30℃ for 1 day. The target strain of anthracnose bacteria (the pathogenic strain of anthracnose in Chinese fir, T3-2-1) was placed 2.5 cm away from the bacteria and incubated at 30℃. The blank PDA plate was inoculated with anthracnose bacteria (the pathogenic strain of anthracnose in Chinese fir, T3-2-1) as a control and incubated at 30℃. The colony diameter and inhibition width were measured daily. The antagonistic effect of the bacterial culture on the anthracnose pathogen was determined. Among them, the colony diameter was determined by the cross-cross method. The inhibition rate of the colony diameter method was calculated as follows: pathogen growth inhibition rate = (colony growth diameter of control group - colony growth diameter of treatment group) / colony growth diameter of control group × 100%. The experimental results showed that ( Figure 1 (Table 1) Among the seven selected bacteria, CH-1-7 exhibited the strongest inhibitory ability against the target strain, with an inhibition rate as high as 87%. Homology comparison analysis using the NCBI gene bank (http: / / blast.ncbi.nlm.nih.gov / ) revealed that strain CH-1-7 belongs to the genus Bacillus (…). Bacillus In subsequent experiments, strain CH-1-7 was selected as the subject of further experiments.
[0043] Table 1. Inhibition rate of soil bacteria against anthracnose bacteria
[0044]
[0045] Example 2: Identification of Bacillus CH-1-7
[0046] 1. Morphology, culture characteristics and physiological and biochemical characteristics of Bacillus CH-1-7:
[0047] (1) The colony surface of Bacillus CH-1-7 on PDA medium was rough, opaque, yellowish or grayish white, with wrinkled protuberances, and the inoculation ring was slightly pulled. The colony edge was radial. The colony surface on KMB medium was rough, opaque, yellow, with wrinkled protuberances, and the inoculation ring was slightly pulled. The colony surface on LB medium was rough, opaque, grayish white, with wrinkled protuberances, and the inoculation ring was slightly pulled. Figure 2 The morphologies of Bacillus CH-1-7 before and after Gram staining under an optical microscope are shown in Figs. B and C of Figure 2 (1) above. According to the Bacillus biochemical identification strip (Qingdao Gaosi Technology Industrial Park Haibo Biotechnology Co., Ltd.), Bacillus CH-1-7 grew well under the conditions of pH 5.7 and 7% sodium chloride by mass fraction, could not grow anaerobically, could decompose starch, reduce nitrate, was positive in V-P test, could utilize D-xylose and citrate, produced gelatinase, and could not utilize L-arabinose, D-mannitol, and propionate (see Table 2). According to the Bergey's Manual of Determinative Bacteriology, the physiological and biochemical characteristics of the bacteria were consistent with those of Bacillus.
[0048] Table 2 Morphology and basic physiological and biochemical characteristics of Bacillus CH-1-7
[0049]
[0050] (2) DNA identification of Bacillus CH-1-7:
[0051] The genome of Bacillus CH-1-7 was extracted by thermal cracking method, a single colony was inoculated into a 1.5 mL centrifuge tube containing 50 μL sterile water, cracked at 100°C for 10 min, and centrifuged at 10000 rpm for 5 min, and the supernatant was taken as the template. The universal primers 27F and 1492R for bacterial 16S rRNA gene were selected for PCR amplification. The primer sequences were as follows: 27F: AGAGTTTGATCCTGGCTCAG, SEQ ID NO. 2; 1492R: GGTTACCTTGTTACGACTT, SEQ ID NO. 3. The PCR reaction system (25 μL) was as follows: 12.5 μL PCR Mix, 1 μL DNA template, 1 μL 27F, 1 μL 11492R, and the rest was dd water. The PCR amplification reaction program was as follows: 94°C pre-denaturation for 4 min; 94°C denaturation for 4 min, annealing for 30 s, 55°C annealing for 1 min, 72°C extension for 30 s, 35 cycles; finally 72°C terminal extension for 10 min, 4°C termination reaction. The PCR amplification product was detected by 1% agarose gel electrophoresis, and then sent to Shengong Bioengineering (Shanghai) Co., Ltd. for sequencing. A fragment of about 1.4 kb was amplified by PCR, and the nucleotide sequence is shown as SEQ ID NO. 1. The sequence was corrected by Chromas sequence splicing software, and homology comparison was performed in NCBI (http: / / blast.ncbi.nlm.nih.gov / ) gene library. The Neighbor-Joining method (Neighbor-Joining) was used to construct the phylogenetic tree by MEGA 11 software, and the system evolution analysis was performed. The numbers on each branch are the support percentages of 1000 times of Bootstrap resampling analysis.
[0052] In the early stage, homology comparison analysis in NCBI (http: / / blast.ncbi.nlm.nih.gov / ) gene library found that CH-1-7 strain belongs to Bacillus Bacillus Based on the phylogenetic analysis Figure 3 , it is further confirmed that CH-1-7 strain belongs to Bacillus and has a close genetic relationship with Bacillus amyloliquefaciens (Md1-43) strain. Combined with the morphological characteristics, physiological and biochemical characteristics and 16S rDNA of the strain, it is determined that CH-1-7 strain belongs to Bacillus, which is recorded as Bacillus (Bacillus sp.) CH-1-7. Bacillus
[0053] Example 3: Detection of the ability of Bacillus CH-1-7 to produce life activity substances and the ability to secrete extracellular enzymes
[0054] (1) Protease detection
[0055] Detection medium: 20 g skim milk powder, 15 g agar, pure water to adjust the total volume to 1000 mL, pH 7.2-7.4.
[0056] Detection method: The activated test strain cake (5 mm) was inoculated on a 1% skim milk agar plate, and cultured at 30°C for 3 days. Whether a clear transparent hydrolysis ring appeared around the colony was observed. If it appeared, it indicated that protease was produced. Each treatment was repeated 3 times.
[0057] (2) Amylase detection
[0058] Detection medium: 2 g soluble starch, 10 g tryptone, 5 g yeast extract, 10 g NaCl, deionized water to adjust the total volume to 1000 mL.
[0059] Detection method: The activated test strain cake (5 mm) was inoculated on the medium, cultured for 48 h, and after obvious colonies were formed, lugol iodine solution was added dropwise on the plate for 10 min. The plate was washed with 70% ethanol aqueous solution. A clear transparent hydrolysis ring was visible around the colony producing amylase. Each treatment was repeated 3 times.
[0060] (3) Cellulase detection
[0061] Detection medium: 6 g NaCl, 0.1 g MgSO4, 0.5 g KH2PO4, 0.1 g CaCl2, 2.0 g (NH4)SO4, 2.0 g K2HPO4, 15 g agar, 5 g CMC-Na (sodium carboxymethyl cellulose), deionized water to adjust the total volume to 1000 mL, pH adjusted to 7.0.
[0062] Detection method: The activated test strain cake (5 mm) was inoculated on the cellulose screening medium plate, and cultured at 30°C for 2 days. It was then immersed in 0.1% Congo red staining solution for 10 min, and then decolorized with 1 mol / L NaCl solution for 5 min. If the strain produces cellulase, a clear transparent ring will appear around the cake. Each treatment was repeated 3 times.
[0063] (4) Siderophore activity detection
[0064] The ability to produce siderophores was detected by chrome azurol S agar colorimetry. The detection medium used was modified siderophore solid medium (Beijing Coolai Bioscience Technology Co., Ltd., PM0821-1L).
[0065] Detection method: A single colony of Bacillus CH-1-7 cultured in LB for 24 h was spotted on the siderophore activity detection medium and cultured at 30°C for 3 d. Whether a yellow halo appeared around the colony was observed.
[0066] (5) Detection of inorganic phosphorus solubilizing ability
[0067] Detection medium: 10 g glucose, 5 g Ca3(PO4)2, 5 g MgCl2·6H2O, 0.25 g MgSO4·7H2O, 0.2 g KCl, 0.1 g (NH4)2SO4, 15 g agar, adjust the total volume to 1000 mL with deionized water, and adjust the pH to 7.0-7.2.
[0068] Detection method: inoculate the activated test strain cake (5 mm) on the inorganic phosphorus plate, and incubate at 30°C for 3 days, and observe whether hydrolysis ring appears around the colony.
[0069] (6) Detection of organic phosphorus solubilizing ability
[0070] Detection medium: 10.0 g glucose, 0.5 g ammonium sulfate, 0.3 g magnesium sulfate, 0.3 g sodium chloride, 0.3 g potassium chloride, 0.03 g ferrous sulfate, 0.03 g manganese sulfate, 0.2 g lecithin, 5.0 g calcium carbonate, 18.0 g agar, distilled water to 1 L, pH adjusted to 7.0-7.5.
[0071] Detection method: inoculate the activated test strain cake (5 mm) on the organic phosphorus plate, and incubate at 30°C for 3 days, and observe whether hydrolysis ring appears around the colony.
[0072] (7) Detection of potassium solubilizing ability
[0073] Detection medium: use potassium solubilizing medium (Beijing Coolai Bioscience Technology Co., Ltd., MM5081-250 g) to detect the ability of insoluble potassium elements in the culture medium to be converted into soluble potassium elements.
[0074] Detection method: inoculate 5 mm cake on potassium solubilizing medium, and incubate in a 30°C incubator for 3 days, and observe whether transparent oil droplet-shaped colonies appear in the potassium solubilizing bacterial medium plate. The presence of transparent oil droplet-shaped colonies indicates the presence of potassium solubilizing ability.
[0075] (8) Detection of nitrogen fixation ability
[0076] Modified Ashby nitrogen-free medium: 0.2 g MgSO4·7H2O, 0.1 g CaSO4, 0.2 g KH2PO4, 5.0 g CaCO3, 0.2 g NaCl, 10.0 g glucose, 15 g agar, and pure water to 1 000 mL, pH adjusted to 7.0-7.2.
[0077] Detection method: Inoculate 5 mm bacterial discs on modified Ashby nitrogen-free medium, incubate at 30℃ for 3 days, subculture for 3 generations, and observe whether a transparent hydrolysis zone appears around the colony.
[0078] Experimental results showed that Bacillus CH-1-7 possesses the ability to secrete extracellular enzymes, producing proteases, cellulases, and amylases. It also has the ability to produce life-promoting substances, including organophosphates, ironophiles, and nitrogen fixation, but lacks the ability to dissolve inorganic phosphorus and solubilize potassium. Figure 4 ).
[0079] Example 4: Antagonistic effect of Bacillus CH-1-7 antibacterial substance and volatile gas on Camellia oleifera anthracnose.
[0080] (1) Dip the pipette tip into the Bacillus CH-1-7 cells that have been cultured for 2 days, and streak 2 cm lines on a plate containing 20 mL PDA (containing 200 g potato, 20 g glucose and 17 g agar powder per 1000 mL, pH 7.0-7.2). Then place the plate in a constant temperature environment of 30℃ and culture for 2 days to obtain a solid culture.
[0081] (2) Growth inhibition tests were conducted on the isolated Bacillus CH-1-7 against pathogens affecting Chinese fir leaves, leaves of Avicennia marina, branches and trunks of Citrus aurantium, roots of Ficus microcarpa, Osmanthus fragrans, leaves of Ficus lindana, and seedlings of Chinese fir. The plate confrontation culture method was used, and samples of the tested pathogen *Eucalyptus scorchella* (a blight pathogen) cultured at 25℃ for 7 days on PDA medium were cut using a punch (5 mm). Calonectria ilicicola AS-ZG-RAC (Eucalyptus), Brown Root Disease ( Phellinus noxius L1-0-2 (Ficus microcarpa), Colletotrichum candida ( Colletotrichum gloeosporioides F1 (Camellia oleifera), Colletotrichum spp. ( Colletotrichum siamense B0-2 (Camellia oleifera), Fusarium solani ( Fusarium solani SM-LK-b5a (Chinese fir), *Sonneratia spp.* (Sonneratia spp.) Pestalotiopsis sonneratiae )hs2-1 (Amonella apetalis), Cocosaurus rubiginosa ( Lasiodiplodia theobromae BZ-FL-1 (White Cone), Guangdong Dark Concealed Red Shell ( Celoporthe guangdongensis E1-1-a (Aeonium apetalis), Clostridium difficile ( Neofusicoccum parvum GH-YB-1 (Osmanthus), Alternaria ( Alternaria pogostemonis WBHS-YK-2 (Aeonium apetalis), Anthracnose spp. ColletotrichumSp.) T3-2-1 (Cunninghamia lanceolata) and T3-4-1 (Cunninghamia lanceolata) were inoculated into PDA plates containing solid cultures from step (1), respectively; 5 mm diameter mycelial discs of each strain were inoculated into empty PDA plates as control groups, with three replicates for each treatment. The plates were incubated at 30℃, and the colony diameter and inhibition width were measured daily. The antagonistic effect of Bacillus CH-1-7 culture on the pathogen of Camellia oleifera anthracnose was determined.
[0082] (3) After inoculating the pathogenic bacteria cakes described in step (2) into PDA plates, they were placed together with the PDA plates containing solid culture from step (1) to form the treatment group; blank PDA plates were placed together with PDA plates inoculated with the pathogenic bacteria cakes described in step (2) to form the control group; each treatment was repeated 3 times and placed in a constant temperature culture at 30°C. The colony diameter was measured every other day, and the radial growth inhibition rate of the pathogen was calculated to determine the inhibitory effect of Bacillus CH-1-7 volatile gas on the pathogenic bacteria of Camellia anthracnose.
[0083] The calculation formula is as follows:
[0084] Pathogen growth inhibition rate = (Coronary diameter of control group - Colony diameter of treatment group) / Colony diameter of control group × 100%.
[0085] The results show that ( Figure 5 The antibacterial substances in Bacillus CH-1-7 showed varying degrees of inhibitory effects on the tested pathogenic bacteria, including those against Colletotrichum gloeosporioides (C. gloeosporioides). Colletotrichum gloeosporioides F1 (Camellia oleifera), Anthrax genus ( Colletotrichum sp.) T3-2-1 (Cunninghamia lanceolata), Siamese thorny spores ( Colletotrichum siamense B0-2 (Camellia oleifera), Sangharama spp. ( Pestalotiopsis sonneratiae ) strain hs2-1 (Avicennia marinae), Guangdong dark-skinned red shell ( Celoporthe guangdongensis The strain E1-1-a (Aeonium apetalis) showed strong inhibitory effects, with inhibition rates exceeding 70%. Figure 5 In this context, A represents the antagonistic effect of the antibacterial substance CH-1-7 of Bacillus against pathogenic strains. Figure 5 In the figure, C represents the inhibition rate of the antibacterial substances and volatile gases of Bacillus CH-1-7 on pathogenic strains.
[0086] Bacillus CH-1-7 produces antibacterial volatiles during its growth, which can significantly inhibit the growth of Colletotrichum gloeosporioides (C. anthracis). Colletotrichum gloeosporioides F1 (Camellia oleifera) and Sangharama gloeosporioides ( Pestalotiopsis sonneratiae Growth of strain hs2-1 (Avicennia marinae) was observed. Colony diameter and inhibition rate were measured as follows: Figure 5 As shown, Figure 5B in Table 1 is the inhibition effect of volatile gas of CH-1-7 strain on pathogenic strain; Figure 5 C in Table 1 is the inhibition rate of volatile gas of CH-1-7 strain on pathogenic strain. In combination with the actual application prospect, Camellia thea anthracnose fungus F1 is finally selected as the further experimental object.
[0087] Example 5: Test on the prevention effect of Bacillus CH-1-7 on Camellia thea anthracnose
[0088] 1. Test method
[0089] (1) Preparation of fermentation broth: the Bacillus CH-1-7 strain cultured for 3 days was inoculated into a 500 mL triangular flask containing 300 mL of KMB (containing 20 g of glucose, 20 g of peptone, 1.5 g of MgSO4, and 1.5 g of K2HPO4 per 1000 mL) liquid medium by using a loop, and then placed in a shaker at 30°C and 200 rpm for 64 h to obtain the fermentation broth. After the fermentation was completed, the fermentation broth was mixed with sterile KMB liquid medium at a volume ratio of 1:20, and the bacterial concentration was measured as OD 600 =0.898.
[0090] (2) Preparation of crude extract: the Bacillus CH-1-7 strain cultured for 3 days was inoculated into sterile KMB solid medium and cultured for another 10 days, and then the culture was ground into powder and freeze-dried. The secondary metabolites produced by the Bacillus CH-1-7 strain were extracted by mixing the culture and methanol at a mass-volume ratio of 1 g:5 mL to obtain the crude extract. The crude extract was diluted by mixing with sterile KMB liquid medium at a volume ratio of 1:25 to obtain the crude extract solution.
[0091] (3) Prevention effect of Bacillus CH-1-7 on Camellia thea anthracnose
[0092] The test strain Camellia thea anthracnose F1 was inoculated on a high-temperature sterilized PDA plate and cultured at 25°C in the dark for 5 days for standby use. The healthy and disease-free leaves on the spring shoots of Camellia thea were washed with clean water, sterilized with 75% ethanol aqueous solution for 30 s, and washed with sterile water for 3 times. After the leaves were dried, the petiole position was sealed with wax oil to keep the leaves in vitro for as long as possible. The leaves were selected at symmetrical positions on the surface, and two punctures were made on each leaf using a sterile syringe needle, and 30 leaves were set in each group.
[0093] The treatment groups are as follows:
[0094] Fermentation broth group: the leaves were soaked in the fermentation broth for 3 s;
[0095] Crude extract group: the leaves were soaked in the crude extract solution for 3 s;
[0096] Pesticide group: the leaves were soaked in pesticide solution (containing 150 mg / L salicylic acid and 200 mg / L prochloraz) diluted by KMB sterile liquid medium for 3 s.
[0097] Positive control group: the leaves were soaked in KMB sterile liquid medium for 3 s.
[0098] The leaves treated by the above four groups were placed in 15 mm plates (sterile filter paper wetted with sterile water was placed at the bottom of the plate), and then the plates were sealed and placed in a 28°C constant temperature incubator. After 24 h, each pinhole was inoculated with Colletotrichum gloeosporioides F1 (5 mm). Then it was placed in a 28°C constant temperature incubator, and the ex vivo control effect was calculated after 13 d. Negative control group: the leaves were soaked in KMB sterile liquid medium for 3 s, and then inoculated with blank medium after 24 h. The culture conditions were the same as the above four groups.
[0099] (4) Treatment effect of Bacillus CH-1-7 on Camellia oleifera anthracnose
[0100] Before the test, the Camellia oleifera leaves were washed, disinfected, cleaned, and punctured according to the method in the prevention test. The leaves in the fermentation liquid group, the crude extract group, the pesticide group, and the positive control group were inoculated with Colletotrichum gloeosporioides cake (5 mm) at the puncture site of the sterile syringe needle, and then placed in 15 mm plates (sterile filter paper wetted with sterile water was placed at the bottom of the plate), and then the plates were sealed. The leaves in the negative control group were inoculated with blank PDA medium. All the treated leaves were placed in a 28°C constant temperature incubator, and then soaked in different treatment groups after the disease.
[0101] Fermentation liquid group: the leaves were soaked in fermentation liquid for 3 s;
[0102] Crude extract group: the leaves were soaked in crude extract for 3 s;
[0103] Pesticide group: the leaves were soaked in pesticide solution (containing 150 mg / L salicylic acid and 200 mg / L prochloraz) diluted by KMB sterile liquid medium for 3 s;
[0104] Positive control group: the leaves were soaked in KMB sterile liquid medium;
[0105] Negative control group: the leaves were soaked in KMB sterile liquid medium.
[0106] After treatment, they were placed in a 28°C constant temperature incubator, and the ex vivo control effect was calculated after 10 d.
[0107] (5) Data statistics and analysis
[0108] The leaves were placed on the scanner and scanned by the computer to obtain the scanned photos of the leaves in different treatment groups. The photos were dragged into Image-Pro Plus 6.0 in batches, and the lesion area was measured by selecting the lesion area using Image-Pro Plus 6.0 software.
[0109] Disease grading standards of Camellia oleifera anthracnose:
[0110] 0: Lesion area of leaf ≤0.12 cm 2 (negative control group average lesion);
[0111] 1: 0.12 cm 2 <Lesion area of leaf ≤1 cm 2 ;
[0112] 2: 1 cm 2 <Lesion area of leaf ≤3 cm 2 ;
[0113] 3: 3 cm 2 <Lesion area of leaf ≤5 cm 2 ;
[0114] 4: 5 cm 2 <Lesion area of leaf ≤8 cm 2 ;
[0115] 5: 8 cm 2 <Lesion area of leaf.
[0116] The calculation formula is as follows:
[0117] Disease incidence (%) = (diseased leaf in each treatment group / total leaf in each treatment group) x 100%;
[0118] Disease index = ∑(number of leaves at each disease level x value of the disease level) / (total number of leaves x value of the highest level) x 100%;
[0119] Treatment effect or prevention effect = (disease index of the positive control group-disease index of the treatment group) / disease index of the positive control group.
[0120] 2. Test results
[0121] (1) Prevention test results
[0122] Bacillus CH-1-7 has good prevention effect on Camellia oleifera anthracnose (Table 3, Figure 6 ), among which the fermented liquid of Bacillus CH-1-7 can effectively control Camellia oleifera anthracnose caused by Colletotrichum gloeosporioides and has good prevention effect, the prevention effect can reach 65.22%, and the crude extract of the bacteria has a prevention effect of 28.04%, which is significantly different from the positive control.
[0123] Table 3 Prevention effect of Bacillus CH-1-7 fermentation broth, crude extract and pesticides on Camellia oleifera anthracnose
[0124]
[0125] (2) Treatment test results
[0126] Table 4 Treatment effect of Bacillus CH-1-7 fermentation broth, crude extract and pesticides on Camellia oleifera anthracnose
[0127]
[0128] After the treatment of Bacillus CH-1-7 fermentation broth on the diseased Camellia oleifera leaf, the Camellia oleifera anthracnose caused by Colletotrichum gloeosporioides was controlled (Table 4, Figure 7 ), the treatment effect reached 28.36%, which was higher than that of pesticides. The treatment effect of the crude extract of the bacteria was 19.40%, which was significantly different compared with the positive control.
Claims
1. A strain of Bacillus ( Bacillus sp.) CH-1-7, characterized in that, GDMCC No. 66219.
2. A biological agent, characterized in that, A culture of the Bacillus CH-1-7 according to claim 1 as an active ingredient.
3. The biological preparation of claim 2, wherein, The culture is prepared by inoculating the Bacillus CH-1-7 to PDA solid medium and culturing at 30℃ to obtain the culture of the Bacillus CH-1-7.
4. The biological preparation of claim 3, wherein, The PDA solid medium comprises 200 g / L potato, 20 g / L glucose, 17 g / L agar powder, and the rest is water, pH 7.0-7.
2.
5. The Bacillus CH-1-7 according to claim 1 or the biological preparation according to claim 2 is applied to promote plant growth by secreting extracellular enzymes, producing organic phosphorus, producing siderophores and / or nitrogen fixation; the extracellular enzymes are protease, cellulase and / or amylase.
6. A method for controlling Camellia thea anthracnose, characterized by, The method comprises the step of applying the Bacillus CH-1-7 according to claim 1 or the biological preparation according to claim 2 to the oil tea.
Citation Information
Patent Citations
Bacillus amyloliquefaciens strain and application of bacillus amyloliquefaciens strain to control over camellia oleifera anthracnose
CN109321500A
Pseudomonas and application thereof in prevention and treatment of ramulus mori apetali wilt
CN118497083A